Phenotypic Mutation 'Arruda' (pdf version)
AlleleArruda
Mutation Type missense
Chromosome13
Coordinate11,658,781 bp (GRCm39)
Base Change C ⇒ T (forward strand)
Gene Ryr2
Gene Name ryanodine receptor 2, cardiac
Synonym(s) 9330127I20Rik
Chromosomal Location 11,567,988-12,121,831 bp (-) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_023868; MGI:99685

MappedYes 
Amino Acid Change Arginine changed to Glutamine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021750] [ENSMUSP00000127991] [ENSMUSP00000152510]
AlphaFold no structure available at present
PDB Structure X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: R3614Q

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
(Using ENSMUST00000021750)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: R3614Q

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000170156)
Predicted Effect unknown
Predicted Effect possibly damaging

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
(Using ENSMUST00000221527)
Meta Mutation Damage Score 0.8617 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category Autosomal Semidominant
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(56) : Gene trapped(27) Targeted(29)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11848978 splice site probably benign
IGL00757:Ryr2 APN 13 11633490 splice site probably null
IGL00838:Ryr2 APN 13 11583389 missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11600364 missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11750388 missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11718430 missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11653371 critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11602125 missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11571571 missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11606238 missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11756922 missense probably benign 0.10
IGL01419:Ryr2 APN 13 11814723 missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11866090 missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11736676 missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11736647 missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11616644 critical splice donor site probably null
IGL01611:Ryr2 APN 13 11606202 missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11609854 missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11707563 missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11600366 missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11616728 missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11610311 missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11569436 missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11805249 missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11805249 missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11611998 missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11762450 missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11587143 missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11807648 nonsense probably null
IGL02086:Ryr2 APN 13 11750442 missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11774645 missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11752759 missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11756755 missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11762544 splice site probably benign
IGL02202:Ryr2 APN 13 11745274 missense probably damaging 0.97
IGL02369:Ryr2 APN 13 11634382 missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11737607 splice site probably benign
IGL02400:Ryr2 APN 13 11620130 splice site probably benign
IGL02423:Ryr2 APN 13 11760084 missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11760560 missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11720585 missense probably benign 0.15
IGL02602:Ryr2 APN 13 11569397 utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11620075 missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11753206 missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11670563 missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11610076 missense probably benign 0.21
IGL02876:Ryr2 APN 13 11722679 missense probably benign 0.39
IGL02878:Ryr2 APN 13 11933205 missense probably benign 0.10
IGL02887:Ryr2 APN 13 11606155 missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11774721 missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11699365 missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11658788 critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11650468 splice site probably benign
IGL03152:Ryr2 APN 13 11868036 missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11756909 nonsense probably null
IGL03180:Ryr2 APN 13 11583449 missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11739273 splice site probably benign
IGL03390:Ryr2 APN 13 11787302 missense probably benign
IGL03410:Ryr2 APN 13 11603033 missense probably damaging 0.99
Arruda2 UTSW 13 11894382 missense probably damaging 1.00
Arruda3 UTSW 13 11570334 missense possibly damaging 0.91
barricuda UTSW 13 11609900 missense probably benign 0.06
BB006:Ryr2 UTSW 13 11705181 nonsense probably null
BB006:Ryr2 UTSW 13 11609680 missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11705181 nonsense probably null
BB016:Ryr2 UTSW 13 11609680 missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11732027 splice site probably benign
IGL02799:Ryr2 UTSW 13 11680848 missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11776192 missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11722682 missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11609641 missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11570334 missense probably benign 0.29
R0003:Ryr2 UTSW 13 11839265 missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11680805 missense probably benign
R0018:Ryr2 UTSW 13 11610109 missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11610670 missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11610670 missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11683924 missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11884002 critical splice donor site probably null
R0062:Ryr2 UTSW 13 11884002 critical splice donor site probably null
R0080:Ryr2 UTSW 13 11583361 missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11724807 missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11729434 missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11691137 splice site probably benign
R0226:Ryr2 UTSW 13 11787442 missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11731863 missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11683725 missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11720570 missense probably benign 0.45
R0415:Ryr2 UTSW 13 11884042 missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11848981 splice site probably benign
R0558:Ryr2 UTSW 13 11814747 missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11653329 missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11746555 missense probably benign 0.02
R0586:Ryr2 UTSW 13 11650445 missense probably null
R0601:Ryr2 UTSW 13 11720519 critical splice donor site probably null
R0610:Ryr2 UTSW 13 11637838 missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11739219 missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11581771 missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11569415 missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11753012 missense probably benign 0.35
R0884:Ryr2 UTSW 13 11569415 missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11684855 missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11960867 missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11674999 missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11774589 missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11897929 critical splice donor site probably null
R1296:Ryr2 UTSW 13 11702765 splice site probably benign
R1400:Ryr2 UTSW 13 11609962 missense probably benign 0.08
R1439:Ryr2 UTSW 13 11729389 splice site probably benign
R1443:Ryr2 UTSW 13 11794152 missense probably benign 0.19
R1446:Ryr2 UTSW 13 11753035 missense probably benign 0.09
R1458:Ryr2 UTSW 13 11741908 missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11616727 missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11569478 missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11569435 nonsense probably null
R1551:Ryr2 UTSW 13 11800029 critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11774563 missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11809449 missense probably benign 0.01
R1645:Ryr2 UTSW 13 11733368 nonsense probably null
R1686:Ryr2 UTSW 13 11618665 splice site probably benign
R1696:Ryr2 UTSW 13 11746543 missense probably benign 0.02
R1708:Ryr2 UTSW 13 11602328 splice site probably null
R1728:Ryr2 UTSW 13 11602308 missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11805153 missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11760062 critical splice donor site probably null
R1776:Ryr2 UTSW 13 11760062 critical splice donor site probably null
R1783:Ryr2 UTSW 13 11715257 nonsense probably null
R1801:Ryr2 UTSW 13 11610167 missense probably benign 0.01
R1812:Ryr2 UTSW 13 11575472 missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11602202 missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11784764 missense probably benign 0.06
R1868:Ryr2 UTSW 13 11746586 missense probably benign 0.02
R1869:Ryr2 UTSW 13 11676961 missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11753242 missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11673844 nonsense probably null
R1897:Ryr2 UTSW 13 11765818 missense probably benign 0.09
R1899:Ryr2 UTSW 13 11606222 missense probably benign
R1909:Ryr2 UTSW 13 11715235 missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11571584 missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11683848 missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11746609 missense probably benign 0.10
R1956:Ryr2 UTSW 13 11695966 missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11600288 splice site probably null
R2018:Ryr2 UTSW 13 11866074 missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11866074 missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11610622 missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11680764 splice site probably null
R2088:Ryr2 UTSW 13 11677115 missense probably benign 0.04
R2089:Ryr2 UTSW 13 11960863 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11960863 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11960863 missense probably benign 0.23
R2127:Ryr2 UTSW 13 11727081 missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11575493 missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11592759 missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11720679 nonsense probably null
R2207:Ryr2 UTSW 13 11825823 missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11677146 missense probably benign 0.18
R2258:Ryr2 UTSW 13 11753102 missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11753128 missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11606123 missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11816734 missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11774589 missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11607979 missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11607979 missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11776235 missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11776235 missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11787466 critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11603045 missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11753095 missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11787313 missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11933300 missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11707568 missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11794153 missense probably benign 0.22
R4127:Ryr2 UTSW 13 11602323 missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11752759 missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11765611 missense probably benign 0.20
R4355:Ryr2 UTSW 13 11664698 missense probably benign 0.05
R4384:Ryr2 UTSW 13 11620119 missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11731952 nonsense probably null
R4430:Ryr2 UTSW 13 11750413 missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12121301 missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11764395 missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11765571 splice site probably null
R4668:Ryr2 UTSW 13 11608003 missense probably benign
R4677:Ryr2 UTSW 13 11721553 missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11839255 missense probably benign 0.34
R4680:Ryr2 UTSW 13 11610119 missense probably benign 0.04
R4685:Ryr2 UTSW 13 11707532 missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11731884 missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11592795 missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11592795 missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11592795 missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11752639 missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11671933 missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11702818 missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11723113 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11702818 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11723113 missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11731983 missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11670584 missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11760638 missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11683706 missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11767104 missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11609872 missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11609872 missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11724849 missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11960831 missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11756897 missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11799966 missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11848878 missense probably benign 0.00
R4964:Ryr2 UTSW 13 11729497 missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11729497 missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11848878 missense probably benign 0.00
R4997:Ryr2 UTSW 13 11610192 missense probably benign 0.09
R4998:Ryr2 UTSW 13 11658781 missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11602140 missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11650422 missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11715240 missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11727129 nonsense probably null
R5135:Ryr2 UTSW 13 11677016 missense probably benign 0.05
R5138:Ryr2 UTSW 13 11675175 missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11767207 missense probably benign
R5187:Ryr2 UTSW 13 11787338 missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11653316 critical splice donor site probably null
R5262:Ryr2 UTSW 13 11787323 missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11705249 missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11571544 missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11670599 missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11720542 missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11720587 missense probably null 0.15
R5509:Ryr2 UTSW 13 11760487 missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11702795 missense probably benign 0.01
R5571:Ryr2 UTSW 13 11570334 missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11609900 missense probably benign 0.06
R5619:Ryr2 UTSW 13 11723088 missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11616691 missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11610468 missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11774722 missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11784848 missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11618618 missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11575460 missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11599040 missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11805218 missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11702788 missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11675008 missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11741839 missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11677124 nonsense probably null
R5974:Ryr2 UTSW 13 11729397 splice site probably null
R6104:Ryr2 UTSW 13 11814711 missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11807575 missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11683903 missense probably benign
R6208:Ryr2 UTSW 13 11910106 missense probably benign 0.04
R6217:Ryr2 UTSW 13 11848964 missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11674993 missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11695885 missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11894382 missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11695885 missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11776282 missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11677269 missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11848893 missense probably benign 0.29
R6548:Ryr2 UTSW 13 11683707 missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11609609 missense probably benign 0.01
R6623:Ryr2 UTSW 13 11724951 missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11610529 missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11609609 missense probably benign 0.01
R6770:Ryr2 UTSW 13 11753348 missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11701852 missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11741816 missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11844540 missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11842445 missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11760487 missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11581834 missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11816129 missense probably benign 0.28
R6997:Ryr2 UTSW 13 11669266 missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11727052 missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11809491 missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11839286 missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11664662 missense probably benign 0.10
R7125:Ryr2 UTSW 13 11684873 missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11670599 missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11683697 critical splice donor site probably null
R7131:Ryr2 UTSW 13 11655213 missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11825794 missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11816063 missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11701864 missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11774643 missense probably benign
R7189:Ryr2 UTSW 13 11898009 missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11680799 missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11612032 missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11753080 missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11760517 missense probably benign
R7365:Ryr2 UTSW 13 11655161 missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11695885 missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11799997 missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11750506 missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11571634 splice site probably null
R7425:Ryr2 UTSW 13 11720530 missense probably benign 0.20
R7444:Ryr2 UTSW 13 11570349 missense probably benign 0.25
R7456:Ryr2 UTSW 13 11767168 missense probably benign
R7460:Ryr2 UTSW 13 11720596 missense probably benign 0.10
R7474:Ryr2 UTSW 13 11609762 missense probably benign 0.04
R7543:Ryr2 UTSW 13 11653317 critical splice donor site probably null
R7549:Ryr2 UTSW 13 11752871 missense probably benign 0.15
R7558:Ryr2 UTSW 13 11814711 missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11575539 missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11776213 missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11776201 missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11705219 missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11745229 missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11765897 missense probably benign
R7797:Ryr2 UTSW 13 11816066 missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11842493 missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11721509 nonsense probably null
R7872:Ryr2 UTSW 13 11610610 missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11807634 missense probably benign 0.01
R7929:Ryr2 UTSW 13 11609680 missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11705181 nonsense probably null
R7952:Ryr2 UTSW 13 11661313 splice site probably null
R8008:Ryr2 UTSW 13 11671980 missense probably benign 0.30
R8011:Ryr2 UTSW 13 11603026 critical splice donor site probably null
R8097:Ryr2 UTSW 13 11960881 missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11618584 missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11842439 missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11610392 nonsense probably null
R8351:Ryr2 UTSW 13 11814718 missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11683821 missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11699364 missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11673894 missense probably benign 0.00
R8509:Ryr2 UTSW 13 11592664 critical splice donor site probably null
R8551:Ryr2 UTSW 13 11575479 missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11702875 missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11701833 missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11683855 missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11750509 missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11572934 missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11794152 missense probably benign 0.19
R8889:Ryr2 UTSW 13 11799990 missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11814768 missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11609924 missense probably benign 0.00
R9013:Ryr2 UTSW 13 11618618 missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11609672 missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11752989 nonsense probably null
R9056:Ryr2 UTSW 13 11610817 missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11616724 missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11618741 intron probably benign
R9116:Ryr2 UTSW 13 11587185 missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11669292 missense probably benign 0.28
R9148:Ryr2 UTSW 13 11900424 missense probably benign 0.02
R9210:Ryr2 UTSW 13 11844560 missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11844560 missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11610772 missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11898002 missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11765854 missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11897976 missense probably benign 0.10
R9278:Ryr2 UTSW 13 11897976 missense probably benign 0.10
R9309:Ryr2 UTSW 13 11721578 missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11898002 missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11695973 missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11809459 missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11787463 missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11752680 missense probably benign 0.00
R9467:Ryr2 UTSW 13 11571490 missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11602101 critical splice donor site probably null
R9562:Ryr2 UTSW 13 11760104 missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11683848 missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11737646 missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11701935 missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11609785 missense probably benign 0.13
R9776:Ryr2 UTSW 13 11707599 missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11884042 missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11718387 missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11658689 critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11613497 critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11809435 nonsense probably null
Z1177:Ryr2 UTSW 13 11765759 missense possibly damaging 0.87
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-09-04 9:40 PM by Anne Murray
Record Created 2017-03-07 3:29 PM
Record Posted 2018-10-24
Phenotypic Description

Figure 1. Arruda mice exhibited increased average heart rates. TNormalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Arruda phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4998, some of which showed an increase in the average heart rate (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased heart rate phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 92 mutations (X-axis) identified in the G1 male of pedigree R4998. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 92 mutations. The heart rate phenotype was linked by continuous variable mapping to a mutation in Ryr2: a G to A transition at base pair 11,643,895 (v38) on chromosome 13, or base pair 463,051 in the GenBank genomic region NC_000079 encoding Ryr2.  Linkage was found with an additive model of inheritance, wherein eight variant homozygotes and 23 heterozygous mice departed phenotypically from 20 homozygous reference mice with a P value of 3.858 x 10-5 (Figure 2).  

The mutation corresponds to residue 11,340 in the mRNA sequence NM_023868 within exon 77 of 105 total exons.

11324 AATCTGCCAAGGCATCGGGCGGTCAATCTTTTT

3609  -N--L--P--R--H--R--A--V--N--L--F-

The mutated nucleotide is indicated in red.  The mutation results in an arginine (R) to glutamine (Q) substitution at position 3,614 (R3614Q) in the Ryr2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.491).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. Domain and topology of RYR2. A. Domain organization of RYR2. Please see the text for more information about the domains shown. The Arruda mutation results in an arginine to glutamine substitution at position 3,614. B. Topology of RYR2. Two monomers of the RYR homotetramer are shown. NTD, N-terminal domain; SPRY, SpIa and RYR; MIR, mannosyltransferase, inositol 1,4,5-trisphosphate receptor, and RYR; LZ, leucine zipper; EF, EF hand domain; TM, transmembrane; PF, pore-forming; CTD, C-terminal domain. This image in interactive. Other mutations found in the RYR2 protein are noted in red. Click on each mutation for more information.
Figure 4. Cryo-EM structure of RYR2 in open state. Each monomer in the homotetramer is colored individually. UCSF Chimera model is based on PDB 5GOA, Peng et al. Science354 (2016). Click on the 3D structure to view it rotate.

Ryr2 encodes cardiac ryanodine receptor 2 (RYR2), one of three RYRs (i.e., RYR1, RYR2, and RYR3). RYR1 is the major RYR form found in skeletal muscle (1), RYR2 is the major form in cardiac muscle, and RYR3 is more widely expressed with high levels in the brain; the function of RYR3 is unknown (2). The three isoforms share approximately 66% sequence identity, but each RYR exhibits different Ca2+ binding affinities with RyR1  >  RyR2  > RyR3.

Functional RYRs are homotetramers that form a pore. Each monomer has a large cytoplasmic N-terminal tail, six transmembrane domains, and a short C-terminal tail (Figure 3). The cytoplasmic tail of RYR2 consists of an N-terminal domain (NTD), three SPRY (SpIa and RYR) domains, four armadillo repeat-containing domains (termed the Handle domain), five MIR (Mannosyltransferase, Inositol 1,4,5-trisphosphate receptor, and Ryanodine receptor) domains, two RYR domains (alternatively P1 and P2 domains), three leucine zippers, and two putative EF-hand motifs (3-7). The NTD contains three subdomains: A (alternatively, Pfam domain: Ins145_P3_rec; amino acids 1 to 217), B (alternatively, Pfam domain: MIR; amino acids 218 to 409), and C (alternatively, Pfam domain: RIH; amino acids 410 to 543) (6;8). Overall, the NTD is not required for channel gating (7); however, subdomain A is involved in channel termination, subdomain B functions in channel suppression, and subdomain C functions in channel activation and RYR2 expression (7). SPRY domains are found in members of the immunoglobulin superfamily; the function of SPRY domains is unknown. MIR domains are found in protein O-mannosyltransferases, inositol trisphosphate receptors, and RYR proteins. The MIR domains putatively participate in the structure of the clamp domain (9). The P1 domain is a component of the clamp, while the P2 domain contains the Ser2808 and Ser2814 phosphorylation sites. The leucine zippers function as specific anchoring sites for muscle A-kinase-anchoring protein (mAKAP), spinophilin, and PR130, which regulates RYR2 phosphorylation (10). The EF-hand motifs mediate Ca2+ binding and contribute to Ca2+ modulation of the RYR1 channel (11). In RYR2, the EF-hand motifs are not required for cytosolic Ca2+ modulation of the RYR2 channel, but are required for luminal Ca2+ modulation of the RYR2 channel and for store overload-induced Ca2+ release (12). The luminal loops within the transmembrane domain region of the RYR2 monomers contribute to the pore structure and amino acids Glu4832, Ile4829, Gly4826, and Gln4881 (rabbit RYR2) directly mediate Ca2+ passage through the pore (13-15). The last 15 amino acids of the C-terminal tail are putatively required for tetramer formation (16). A second study proposed that the tetramerization domain was between amino acids 4869 and 5019 in RyR1 (17).

Single-particle electron microscopy (EM) of stained and unstained frozen-hydrated RYR2 showed a four-fold symmetric mushroom-shaped architecture, with the four copies of the cytosolic domain forming an umbrella, and a small cylindric transmembrane domain containing the pore [Figure 4; PDB: 5GOA; (18;19). Later studies using high-resolution cryo-EM showed that RYR1 (and RYR2) has an insertion between the S2 and S3 helices (S2S3 domain), a 90 Å long pore helix ending with a C-terminal domain containing a zinc finger and an acidic disordered loop between S1 and S2 (20). The activation domain contains a domain in the shape of a thumb and forefingers, which clamps the zinc finger-containing C-terminal domain. RYRs are principally composed of three α-solenoid repeats. The core solenoid (CSol) is part of the activation domain, and links the pore domain to the shell. The bridging (BSol) and N-terminal solenoids (NSol) are joined by the junctional solenoid (JSol) (21). The RYRs are closed at low levels of cytosolic Ca2+ ([Ca2+] ~100–200 nM). Increased levels of cytosolic Ca2+ ([Ca2+]cyto ~10 μM) stimulate channel opening. RYR2 undergoes conformational changes when opening, including expansion of the clamp domain, rotation of the transmembrane domains relative to the cytoplasmic region, and expansion of the pore to 18 Å (15;22;23).

RYR2 is phosphorylated at Ser2808, Ser2814, and Ser2030. Other sites (e.g., Thr2876, Thr2781, Tyr2821, and Ser2822) can also be putatively phosphorylated by protein kinase A (PKA). Ser2808 can be phosphorylated by both PKA and Ca2+/calmodulin-dependent protein kinase II (CaMKII) (24;25). High basal levels of Ser2808 phosphorylation is important for normal excitation–contraction coupling (26-28). CamKII phosphorylates Ser2814, which increases the Ca2+ sensitivity and open probability (Po) of RYR2 (29-31). Ser2030 is phosphorylated by PKA and protein kinase G (but not CaMKII) (32;33). Ser2030 phosphorylation affects RYR2 sensitivity during b-adrenergic stimulation. For more information on the effects of RYR2 phosphorylation, see Table 1 and Table 2 (in the Background section).

RYRs interact with several ligands that putatively regulate gating of the channel, including ions (primarily Ca2+ and Mg2+), the voltage-gated Ca2+ channel, and small molecules (e.g., adenine nucleotides and caffeine) (21). RYR2 also serves as a scaffold for several regulatory subunits and enzymes (Table 1).

Table 1. RYR2-associated regulatory proteins

RYR2 interacting region

Regulatory protein

Description

RYR2-associated function

References

Cytoplasmic N-terminus

FKBP12.6 (alternatively, calstabin2) and FKBP12 (putatively species specific)

Immunophilins and FK-506 binding proteins

Stabilizes the closed state of the channel and prevents the pathological leak of Ca2+

(34-37)

Calmodulin

Ca2+-binding protein

Inhibits RYR2 at [Ca2+] < 10 μM; assists RYR2 closing after sarcoplasmic reticulum Ca2+ release in EC-coupling

(38-41)

CaMKII

Kinase

Phosphorylates Ser2815 (Ser2814 in mouse), which sensitizes the channel to cytosolic Ca2+

(10;42;43)

PKA

Kinase

Phosphorylates Ser2809 (Ser2808 in mouse) and Ser2030, which activates the channel by increasing the sensitivity of RyR2 to cytosolic Ca2+ and promoting dissociation from FKBP12.6

(26;42;44)

3′,5′-cyclic phosphodiesterase 4D (pDE4D)

cAMP-specific enzyme

Provides negative-feedback mechanism to limit phosphorylation of RyR2-Ser2808

(45)

mAKAP

Scaffold protein

Targets PKA and pDE4D to RYR2

(46;47)

Sorcin

Ca2+-binding protein

Reduces the Po

of RYR2

(48;49)

Spinophilin and PR130

Spinophilin: PP1 regulatory subunit; PR130: PP2A regulatory subunit

Target the protein phosphatases PP1 and PP2A to RyR2

(10)

PP1 (anchored by spinophilin) and PP2A (anchored by PR130)

Phosphatases

Regulates channel activity

(10;42)

C-terminus

Calsequestrin

Ca2+-binding protein which sequesters Ca2+ in the sarcoplasmic reticulum

Regulates RYR2 activity

(50)

Triadin

Integral sarcoplasmic reticulum membrane protein

Necessary for proper orientation and activity of the RYR-L-type Ca2+ channel Ca2+ release unit; links calsequestrin to RYR2

(51)

Junctin

Integral sarcoplasmic reticulum membrane protein

Stabilizes RYR2 in the myocardium

(52)

Ryr2 is alternatively spliced (removing exons 4 [corresponding to amino acids 92 to 98 in human RYR2] and 75 [corresponding to amino acids 3564 to 3575 in human RYR2]) to generate a mRNA that is predominantly expressed in pancreatic islets, cerebrum, and cerebellum (53). HEK293 cells transfected with the “islet-type” RYR2 expression vector showed increased Ca2+ release after treatment with cyclic ADP-ribose (stimulates intracellular Ca2+ mobilization) compared to cells transfected with a canonical RYR2 expression vector (53). Two additional alternatively spliced variants with 30- and 24-base pair insertions have been identified in humans (54). The two variants were expressed in cardiomyocytes and localized to the sarcoplasmic reticulum, perinuclear Golgi apparatus, and invaginations of the nuclear envelope (nucleoplasmic reticulum). The 24-base pair variant was required for RYR2 targeting to the intranuclear Golgi apparatus. Expression of the 30- and 24-base pair splice variants resulted in reduced amplitude variability of nuclear and cytoplasmic Ca2+ fluxes in nonstimulated cardiomyocytes as well as lower basal levels of apoptosis (54). Expression of the 24-base pair variant suppressed intracellular Ca2+ fluxes following prolonged caffeine exposure that protected cells from apoptosis. The 30-base pair variant did not protect cardiomyocytes from caffeine-evoked apoptosis.

The Arruda mutation results in an arginine (R) to glutamine (Q) substitution at position 3,614 (R3614Q); Arg3614 is within an undefined region between the last leucine zipper and the first EF-hand motif.

Expression/Localization

RYR2 is expressed in cardiomyocytes, pancreatic islets, and the dentate gyrus of the hippocampus (31;55). RYR2 localizes to the membrane of the sarcoplasmic reticulum.

Background
Figure 5. RYR2 function in cardiac myocyte contraction. In cardiac muscle, depolarization of the plasma membrane activates Ca2+ influx via Cav1.2, triggering Ca2+ release from the sarcoplasmic reticulum via RyR2 channels. The accessory proteins indicated in the purple bubble bind each RYR2 monomer. Triadin, junctin, and calsequestrin (CSQ) bind at the luminal SR surface to ryanodine receptors. See Table 1 for more information about RYR2 accessory proteins. The resulting release of calcium leads to a transitory increase in intracellular Ca2+ that binds to troponin C, enabling myocardial contraction.

Ca2+ signaling is essential for development, proliferation, neuronal transmission, learning and memory, muscle contraction, cell motility, cell growth, and cell death as well as regulation of enzyme activity, permeability of ion channels, and activity of ion pumps [reviewed in (56)]. RYR2-associated Ca2+ release is required for cardiac muscle excitation-contraction coupling [(57;58); reviewed in (59)]. In cardiac muscle, depolarization of the plasma membrane activates Ca2+ influx via the L-type Ca2+ channel (Cav1.2; see the record hera for more information about voltage-dependent calcium channels), which subsequently activates RYR2 (Figure 5) (60). Calcium sensors within RYR2 bind calcium and facilitate opening of the channel, resulting in release of calcium from the sarcoplasmic reticulum via the Ca2+-induced Ca2+-release (CICR) mechanism (59;61). The CICR mechanism causes a transitory increase in intracellular Ca2+ that binds to troponin C, enabling actin-myosin binding and signaling contractile myofilaments to generate force, sarcomere shortening, and myocardial contraction. Termination of sarcoplasmic reticulum Ca2+ release promotes relaxation. During relaxation, Ca2+ returns to diastolic Ca2+ levels via the activity of sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA)2a and the sarcolemma Na+/Ca2+ exchanger (NCX) [reviewed in (62)].

RYR2 also functions in cognitive function (63) and insulin secretion (64). Ca2+ signaling regulates insulin secretion from the islets of Langerhans. Insulin secretion largely depends on voltage-activated Ca2+ influx, and RYR2 regulates β cell insulin release and glucose homeostasis (64). Mutations that are linked to aberrant RYR2 function in cardiac myocytes also cause impaired glucose homeostasis, activation of the ER stress response, and fuel-stimulated insulin release (64).

Mutations in RYR2 are linked to arrhythmogenic right ventricular dysplasia 2 [ARVD2; OMIM: #600996; (65;66)] and catecholaminergic polymorphic ventricular tachycardia 1 [CPVT1; OMIM: #604772; (67;68)]. ARVD2 is characterized by partial degeneration of the myocardium of the right ventricle, effort-induced polymorphic ventricular tachycardias, and sudden death. CPVT1 is characterized by a reproducible form of polymorphic ventricular tachycardia induced by physical activity, stress, or catecholamine infusion, which can deteriorate into ventricular fibrillation. Patients exhibit recurrent syncope, seizures, or sudden death after physical activity or emotional stress; the heart is morphologically normal.

Several mouse Ryr2 mutant mouse strains have been generated and characterized (Table 2). Most mutant mice showed heart rhythm abnormalities due to aberrant channel function, and some mutations resulted in sudden death of the mouse.

Table 2. Phenotypes of RYR2 mutant mice

Mutation

Mutation note

Phenotype (homozygous)

References

Ryr2-/-

Removed the first protein coding sequence of 48 base pairs and part of the first intron

Embryonic lethality (~E10.5), abnormal cardiomyocyte morphology, abnormal myocardial trabeculae morphology, disorganized myocardium, abnormal epicardium morphology, and embryonic growth retardation

(69) & MGI

Ryr2flox/ Ryr2flox

A1cfTg(Myh6-cre/Esr1*)1Jmk/0

Inducible, cardiac-specific RYR2 knockout

Bradycardia, arrhythmia, lethargy sudden death

(70)

RYR2 Ex3-del (exon 3 deletion)

Mimics human CPVT1 mutation

Embryonic lethal; heterozygous cardiomyocytes showed increased time-to-peak and time-to-50% decay of calcium release evoked by depolarization

(71)

R176Q

ARVD2

Reduced right ventricular end-diastolic volume, and the mice showed ventricular tachycardia after caffeine and epinephrine injection

(72;73)

L433P

Mimics human CPVT1 mutation

Atrial fibrillation, leaky calcium channels in the sarcoplasmic reticulum of atrial myocytes

(74)

R420W

ARVD2

Increased thymus and spleen weights as well as increased lymphocytic density in the spleen; heart morphology was normal

(75)

S2246L*

Mimics human CPVT1 mutation

Ventricular tachycardia; cardiomyocytes exhibit reduced threshold of sarcoplasmic reticulum calcium load for channel activation

(76)

P2328S

Mimics human CPVT1 mutation

Ventricular tachycardia

(77)

R2386I*

Mimics human CPVT1 mutation

Atrial fibrillation and leaky calcium channels in the sarcoplasmic reticulum of atrial myocytes

R2474S

Mimics human CPVT1 mutation

Spontaneous generalized tonic-clonic seizures (in the absence of cardiac arrhythmias), exercise-induced ventricular arrhythmias, and sudden death

(78)

V2475F

Mimics human CPVT1 mutation

Embryonic lethality (~E9); heterozygous mice showed normal cardiac morphology and functional echocardiogram at rest, but irregular heartbeats after beta-adrenergic stimulation

(79)

S2080A

PKA phosphorylation mutant

In the absence of induced myocardial infarction, the morphology of homozygous hearts is similar to wild-type; less susceptibility to myocardial infarction-induced heart failure; cardiomyocytes showed slower time constant of decay for calcium transients

(26-28)

S2814A

CaMKII phosphorylation mutant

Ventricular tachycardia; increased response of heart to induced stress

(73;80)

S2814D

CaMKII phosphorylation mutant

Reduced cardiac muscle contractility, reduced heart rate and ventricular tachycardia after treatment with caffeine and epinephrine, increased response of the heart to induced stress

(80)

W3587A/L3591AD/F3603A

In exon 75, which encodes the CaM-binding site of RyR2

Postnatal lethality (P9), enlarged hearts, cardiac fibrosis, reduced ventricle muscle contractility, reduced heart rates, reduced body weights, thin interventricular septum

(81)

L3591D

Eliminates CaM and S100A1 inhibition

Increased heart weight, thick interventricular septum, cardiac hypertrophy

(82)

R4496C

Mimics human CPVT1 mutation

Increase in RYR2 channel activity, ventricular fibrillation, ventricular tachycardia, and enhanced RYR2 sensitivity to Ca2+ and caffeine

(83;84)

A4860G

Mimics human CPVT1 mutation

Prenatal lethality; heterozygotes showed reduced heart rate and ventricular fibrillation

(85)

E4872Q

E4872 is an element of the RYR2 luminal Ca2+ sensing mechanism

Embryonic lethality (~E10.5); heterozygous mice are resistant to store overload-induced Ca2+ waves and completely protected against Ca2+-triggered ventricular tachycardia

(86)

* Studied in heterozygous mice only

Putative Mechanism

The phenotype of the Arruda mice indicates loss of RYR2-associated function.

Primers PCR Primer
Arruda_pcr_F: GTCATAACCAGTAAATGTGGCAAC
Arruda_pcr_R: ACCCAAAGTCAGTATGTGATCTGAG

Sequencing Primer
Arruda_seq_F: GGCAACAGTGAGAATTAAAGTTTTC
Arruda_seq_R: GTCAGTATGTGATCTGAGAAAACTGC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 406 nucleotides is amplified (chromosome 13, - strand):


1   acccaaagtc agtatgtgat ctgagaaaac tgcttttatt ggatgcaagg agttgtctgt
61  gaagagagga atcaataata ggaagtttat tttttatttt atattttagt gcacagatca
121 tctggtaata agcactattg aattcttgtt catatattta aaatcccttt gtttgacatt
181 gcatttatct tttaggcatc gggcggtcaa tctttttctt cagggatatg aaaagtcttg
241 gattgaaaca gaagaacatt actttgagga taaattgatt gaagatttag cggtaagctt
301 tttaatgaga ttataaaatg aaagaagatg gaaagaaaat cattacactg catgttggtc
361 ttagaaaact ttaattctca ctgttgccac atttactggt tatgac


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsSamantha Teixeira and Bruce Beutler