Phenotypic Mutation 'Jialin' (pdf version)
List |< first << previous [record 7 of 30] next >> last >|
AlleleJialin
Mutation Type missense
Chromosome2
Coordinate102,865,370 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Cd44
Gene Name CD44 antigen
Synonym(s) Pgp-1, HERMES, Ly-24
Chromosomal Location 102,811,141-102,901,665 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired T lymphocyte trafficking resulting in muted inflammatory responses, altered myeloid progenitor distribution, reduced growth of tumors, and impaired uterine involution and maintenance of lactation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009851 (variant 1), NM_001039150 (variant 2), NM_001039151 (variant 3), NM_001177785 (variant 4), NM_001177786 (variant 5), NM_001177787 (variant 6); MGI:88338

Mapped Yes 
Limits of the Critical Region 102811141 - 102901625 bp
Amino Acid Change Glycine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000005218] [ENSMUSP00000062330] [ENSMUSP00000097265] [ENSMUSP00000106821] [ENSMUSP00000106822] [ENSMUSP00000106823] [ENSMUSP00000106825] [ENSMUSP00000106829]
SMART Domains Protein: ENSMUSP00000005218
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 251 276 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
PDB:2ZPY|B 710 729 1e-6 PDB
Predicted Effect possibly damaging

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
(Using ENSMUST00000005218)
SMART Domains Protein: ENSMUSP00000062330
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 229 239 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
PDB:2ZPY|B 510 529 1e-6 PDB
Predicted Effect probably benign

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
(Using ENSMUST00000060516)
SMART Domains Protein: ENSMUSP00000097265
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 225 238 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
PDB:2ZPY|B 295 314 1e-6 PDB
Predicted Effect probably damaging

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
(Using ENSMUST00000099673)
SMART Domains Protein: ENSMUSP00000106821
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 324 337 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
PDB:2ZPY|B 394 413 8e-7 PDB
Predicted Effect probably benign

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
(Using ENSMUST00000111190)
SMART Domains Protein: ENSMUSP00000106822
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
PDB:2ZPY|B 428 447 9e-7 PDB
Predicted Effect possibly damaging

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
(Using ENSMUST00000111191)
SMART Domains Protein: ENSMUSP00000106823
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 294 307 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
PDB:2ZPY|B 364 383 1e-6 PDB
Predicted Effect probably benign

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
(Using ENSMUST00000111192)
SMART Domains Protein: ENSMUSP00000106825
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
PDB:2ZPY|B 507 526 1e-6 PDB
Predicted Effect possibly damaging

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
(Using ENSMUST00000111194)
SMART Domains Protein: ENSMUSP00000106829
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
PDB:2ZPY|B 587 606 1e-6 PDB
Predicted Effect probably benign

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
(Using ENSMUST00000111198)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD44+ CD4 MFI - decreased
FACS CD44+ CD4 T cells - decreased
FACS CD44+ CD8 MFI - decreased
FACS CD44+ CD8 T cells - decreased
FACS CD44+ T cells - decreased
FACS CD44+ T MFI - decreased
FACS central memory CD4 T cells in CD4 T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - decreased
FACS effector memory CD4 T cells in CD4 T cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced(other)(1) Radiation induced(1) Targeted(13) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Cd44 APN 2 102855947 missense possibly damaging 0.73
IGL01087:Cd44 APN 2 102822262 missense probably damaging 1.00
IGL01413:Cd44 APN 2 102814287 missense probably damaging 0.99
IGL01830:Cd44 APN 2 102842258 splice site probably benign
IGL02221:Cd44 APN 2 102846513 missense probably benign 0.01
IGL02271:Cd44 APN 2 102831387 missense possibly damaging 0.93
IGL02552:Cd44 APN 2 102848731 missense probably benign 0.01
IGL02861:Cd44 APN 2 102832481 critical splice donor site probably null
IGL03309:Cd44 APN 2 102814177 missense probably damaging 1.00
IGL03352:Cd44 APN 2 102845414 intron probably benign
Kale UTSW 2 102824303 missense
N/A - 535:Cd44 UTSW 2 102814189 missense possibly damaging 0.50
R0488:Cd44 UTSW 2 102834219 splice site probably benign
R1441:Cd44 UTSW 2 102846418 missense probably damaging 0.99
R1482:Cd44 UTSW 2 102831383 missense probably damaging 1.00
R1497:Cd44 UTSW 2 102842955 splice site probably null
R1803:Cd44 UTSW 2 102834252 missense probably damaging 1.00
R1952:Cd44 UTSW 2 102853087 missense probably damaging 0.98
R2093:Cd44 UTSW 2 102814284 missense probably damaging 1.00
R2180:Cd44 UTSW 2 102828610 missense possibly damaging 0.66
R2425:Cd44 UTSW 2 102861586 missense probably damaging 1.00
R3687:Cd44 UTSW 2 102901350 utr 5 prime probably null
R3820:Cd44 UTSW 2 102901393 unclassified probably null
R3821:Cd44 UTSW 2 102901393 unclassified probably null
R3822:Cd44 UTSW 2 102901393 unclassified probably null
R4060:Cd44 UTSW 2 102901342 missense probably damaging 1.00
R4633:Cd44 UTSW 2 102853047 missense possibly damaging 0.86
R4647:Cd44 UTSW 2 102837929 missense possibly damaging 0.68
R4780:Cd44 UTSW 2 102861565 missense probably damaging 1.00
R5087:Cd44 UTSW 2 102831354 missense possibly damaging 0.83
R5118:Cd44 UTSW 2 102865370 missense probably damaging 0.99
R5449:Cd44 UTSW 2 102832546 missense probably damaging 1.00
R5642:Cd44 UTSW 2 102901342 missense probably damaging 1.00
R5928:Cd44 UTSW 2 102824303 missense probably damaging 0.99
R5995:Cd44 UTSW 2 102861670 missense probably damaging 1.00
R5999:Cd44 UTSW 2 102845397 missense probably benign 0.42
Mode of Inheritance Autosomal Dominant
Local Stock Live Mice
Repository
Last Updated 2018-09-18 9:32 AM by Anne Murray
Record Created 2017-03-12 12:12 PM by Xue Zhong
Record Posted 2018-09-18
Phenotypic Description
Figure 1. Jialin mice exhibit decreased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Jialin mice exhibit decreased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Jialin mice exhibit decreased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Jialin mice exhibit decreased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Jialin mice exhibit decreased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Jialin mice exhibit decreased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Jialin mice exhibit reduced expression of CD44 on T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Jialin mice exhibit reduced expression of CD44 on CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Jialin mice exhibit reduced expression of CD44 on CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Jialin phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5118, some of which showed reduced frequencies of CD44+ T cells (Figure 1), CD44+ CD4 T cells (Figure 2), CD44+ CD8 T cells (Figure 3), central memory CD4 T cells in CD4 T cells (Figure 4), effector memory CD4 T cells in CD4 T cells (Figure 5), and central memory CD8 T cells in CD8 T cells (Figure 6). Some mice showed reduced expression of CD44 on T cells (Figure 7), CD4 T cells (Figure 8), and CD8 T cells (Figure 9), all in the peripheral blood.

Nature of Mutation

Figure 10. Linkage mapping of the reduced frequency of CD44+ CD8 T cells using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 52 mutations (X-axis) identified in the G1 male of pedigree R5118. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations. All of the above anomalies were linked to a mutation in Cd44: a G to T transversion at base pair 102,865,370 (v38) on chromosome 2, or base pair 36,300 in the GenBank genomic region NC_000068 encoding Cd44. The strongest association was found with a dominant model of inheritance to the reduced frequency of CD44+ CD8 T cells, wherein seven variant homozygotes and 44 heterozygous mice departed phenotypically from 24 homozygous reference mice with a P value of 2.515 x 10-16 (Figure 10).  

The mutation corresponds to residue 475 in the mRNA sequence NM_009851 within exon 2 of 19 total exons.

 

458 AGTATCTCCCGGACTGAGGCAGCTGACCTCTGC

47  -S--I--S--R--T--E--A--A--D--L--C-

 

The mutated nucleotide is indicated in red.  The mutation results in a glutamic acid (E) to aspartic acid (D) substitution at position 52 (E52D) in the CD44 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.649).

Protein Prediction
Figure 11. Domain organization of CD44. The Jialin mutation results in a glutamic acid to aspartic acid substitution at position 52 in the CD44 protein. Abbreviations: SP, signal peptide; TM, transmembrane domain. The topology is indicated by brackets above the domain.

The Cd44 gene encodes CD44 (alternatively, Pgp-1 [P-glycoprotein 1]), a type I membrane glycoprotein and member of the cell adhesion molecule superfamily (Figure 11).

 

The N-terminal extracellular domain of CD44 mediates interactions with the external microenvironment and senses stimuli. The extracellular domain contains a hyaluronic acid (HA)-binding “link” domain at residues 34 to 123. HA is a glycosaminoglycan and component of the extracellular matrix. CD44 has chondroitin- and heparin-like glycosaminoglycan binding sites that recognize the α5 chain of laminin (1). The CD44 chondroitin sulfate binding site also binds type IV collagen [see the record for aoba] (2) and fibronectin (3). A stem structure separates the N-terminal globular domain from the plasma membrane and contains putative proteolytic cleavage sites (4).

 

The transmembrane domain of CD44 mediates interactions with cofactors and adaptor proteins, directs lymphocyte homing, and putatively mediates CD44 association with lipid rafts (5;6).

 

The CD44 intracellular tail binds with cytoskeletal elements (e.g., ankyrin, ERM [ezrin/radixin/moesin], and Merlin), signaling molecules (e.g., Src, Lck [see the record for iconoclast], Fyn, and Lyn [see the record for Lemon]), and activators of small Rho GTPases [reviewed in (7)]. The CD44 intracellular domain can be sequentially proteolytically cleaved by MT1-MMP (membrane type 1 matrix metalloprotease) and presenilin-1/γ (see the record for hiortron). The cleaved peptide (CD44-ICD) translocates to the nucleus to activate the transcription of several genes (8). CD44 cleavage also allows the release of cells bound to HA. Protein kinase C-mediated CD44 phosphorylation at Ser291 and Ca2+/calmodulin-dependent protein kinase II-mediated CD44 phosphorylation at Ser325 increases ERM binding to CD44 (9). Ankyrin binding is also phosphorylation-dependent.

 

Cd44 encodes multiple isoforms due to insertion of alternative exons (exons 6 [variant 1; v1] to 15 [variant 10; v10]) (10). The isoforms differ within the extracellular domain. Exons 1 through 5, exon 17 (encoding the transmembrane domain), and exons 18 and 19 (encoding the intracellular domain) are consistent among all of the isoforms (11).

 

The Jialin mutation results in a glutamic acid (E) to aspartic acid (D) substitution at position 52 (E52D); Glu52 is within the link domain.

Expression/Localization

Canonical CD44 is ubiquitously expressed. CD44 variants are expressed on a selection of epithelial cells, keratinocytes, and macrophages (12). CD44v5 is expressed on activated T cells, CD44v6 is expressed in proliferative tissues (e.g., skin and crypts of the intestine), CD44v4-7 is expressed in rat pancreatic carcinoma, CD44v4-10 is expressed on Igr5+ intestinal stem cells, CD44v6-10 and CD44v8-10  are expressed on some epithelial cells, and CD44v1-10, CD44v2-10, and CD44v3-10 are expressed on keratinocytes [reviewed in (7;13)].

Background

Figure 12. CD44 is a multifunctional receptor. The CD44 extracellular domain can bind various ligands, including hyaluronan (HA), extracellular matrix (ECM) glycoproteins and proteoglycans, growth factors, cytokines and matrix metalloproteinases. CD44 can be sequentially cleaved by membrane type 1 matrix metalloprotease (MT1-MMP) and then presenilin-1/γ secretase. Cleavage produces an extracellular domain (ECD) fragment, a transmembrane domain (TM), and a CD44 intracellular domain (ICD) fragment. CD44—ICD translocates into the nucleus to activate transcription of genes important in metastasis, cell survival, invasion, migration, and angiogenesis. The cytoplasmic domain is also responsible for signal transduction through binding to different molecules, including cytoskeleton components, kinases and activators of small Rho GTPases. CD44 can promote signaling by acting as a coreceptor to oncogenes such as c-Met and ErbB receptors. These interactions promote activation of signaling pathways that promote growth and cellular invasion. The CD44-phosphorylated ERM complex initiates activation of transforming growth factor-β receptor 1 and 2 (TGFβRI and II) and the downstream SMAD signaling complex, which contribute to fibrosis.

CD44 is a receptor that functions in HA metabolism, hematopoiesis, limb development, wound healing, inflammation, matrix adhesion, lymphocyte activation, cytokine and growth factor release, lymph node homing, cancer cell metastasis, and angiogenesis (14).

 

CD44 is the main cell surface receptor for HA (Figure 12) (14). HA binding to CD44 is required for the homing of leukemic cells in the bone marrow, neutrophil and monocyte/macrophage recruitment to sites of inflammation, quiescence and stemness regulation of acute myeloid leukemia cells, and chronic lymphocytic leukemia cell proliferation [(15-18); reviewed in (19)]. CD44 binding to HA also promotes the uptake and degradation of HA (20)

 

CD44 also binds other ligands, including osteopontin (OPN) (21), laminin (1), collagen (2), fibronectin (3), growth factors, cytokines, and matrix metalloproteinases (MMPs) [reviewed in (7;22)]. OPN-CD44 signaling promotes prostate cancer growth and progression (23) as well as cell migration out of the bloodstream to sites of inflammation (24). MMP9-CD44 association promotes MMP9 localization on the cell surface in tumor cells (25). Interaction between CD44 and a proteolytic form of MMP9 promotes the invasion of prostate cancer cells by causing the degradation of collagen IV, growth factor activation, survival mechanisms, latent TGFβ activation, and angiogenesis.

 

CD44 functions as a co-receptor for receptor tyrosine kinases (e.g., HGFR, MST1R, EGFR [see the record for Velvet], PDGFR, FGFR [see the record for Modest], and VEGFR [see the record for flywheels]) (13), CXCR4 (26), and LRP6 (27). HA binding to CD44 increases CXCR4-associated signaling to promote angiogenesis (26). CD44v6 promotes signaling downstream of receptor tyrosine kinases by driving receptor activation and by recruiting ERM proteins and the cytoskeleton to promote receptor signaling (13;28;29). LRP6 recruitment of CD44 promotes β-catenin activation and translocation to the nucleus (27).

 

Expression of the alternative CD44 isoforms has been detected in several human pathologies, including pancreatic cancer (CD44v8-10) (30), cervical cancer (CD44v6), colorectal cancer (CD44v6) (31), and head and neck squamous carcinoma (32;33). Expression of the alternative isoforms correlates with poor prognosis and metastatic potential (34-37). Expression of CD44v5, CD44v6, and CD44v10 have been detected in the synovial fluid and serum in patients with rheumatoid arthritis (38;39). CD44v6 and CD44v7 expression are associated with colonic inflammation and increased severity of inflammatory bowel disease (40-42).

 

CD44-deficient (Cd44-/-) mice exhibited impaired T lymphocyte trafficking resulting in muted inflammatory responses, altered myeloid progenitor distribution, reduced growth of tumors, and impaired uterine involution and maintenance of lactation (43-47). The Cd44-/- mice exhibited reduced mast cell numbers and histamine content in the peritoneal cavities and ear tissues (48) as well as thinning of the epidermis and delayed early barrier recovery after acute barrier disruption (49). Mice deficient in CD44v7 exhibited reduced susceptibility to experimental autoimmune encephalomyelitis (50), but exhibited persistent inflammation after exposure to trinitrobenzene sulfonic acid (experimental model of colitis) (51). The CD44v7 null mice also exhibited downregulation of Th1-type cytokines with concomitant upregulation of Th2 cytokines (51).

Putative Mechanism

The phenotypes observed in the Jialin mice indicate loss of CD44Jialin function in hematopoiesis and T lymphocyte trafficking.

Primers PCR Primer
Jialin(F):5'- CTTATTCAACTGTCAGGGAGGAG -3'
Jialin(R):5'- GCATGTTTGGCTTCTCCCAATG -3'

Sequencing Primer
Jialin_seq(F):5'- GAGGAGCCTTCCAGCCATAAG -3'
Jialin_seq(R):5'- CCCAATGCCCCATCTGG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Aijie Liu, and Bruce Beutler
List |< first << previous [record 7 of 30] next >> last >|