Phenotypic Mutation 'hallon' (pdf version)
Allelehallon
Mutation Type critical splice donor site
Chromosome2
Coordinate164,099,827 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Stk4
Gene Name serine/threonine kinase 4
Synonym(s) Ysk3, sterile 20-like kinase 1, Kas-2, Mst1
Chromosomal Location 164,070,322-164,155,524 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021420; MGI:1929004

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000018353]
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000116745
Gene: ENSMUSG00000018209

DomainStartEndE-ValueType
Blast:S_TKc 2 26 8e-6 BLAST
PDB:3COM|B 2 26 4e-7 PDB
low complexity region 27 42 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased 19339990
FACS B:T cells - increased
FACS B1a cells in B1 cells - decreased
FACS B1b cells in B1 cells - increased
FACS B220 MFI - decreased
FACS CD4:CD8 - increased
FACS CD4+ T cells - decreased 19073936
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased 19073936
FACS CD8+ T cells in CD3+ T cells - decreased 19073936
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased 19073936
FACS effector memory CD8 T cells in CD8 T cells - increased 19073936
FACS IgD MFI - decreased
FACS IgD+ B cell percentage - decreased 19339990
FACS IgM+ B cells - decreased 19339990
FACS macrophages - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS NK cells - increased
FACS T cells - decreased 19339990
Fasting Insulin (Female) - increased
IgA response to 2nd OVA/Alum Challenge (day 7) - increased
OVA-specific IgE - increased
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Total IgE After 2nd OVA/Alum Challenge (day 7) - increased
total IgE level - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(53) : Chemically induced (ENU)(2) Gene trapped(38) Targeted(13)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Stk4 APN 2 164118079 missense probably benign 0.05
IGL01583:Stk4 APN 2 164074214 start codon destroyed probably null 0.21
IGL01933:Stk4 APN 2 164098585 unclassified probably benign
IGL02084:Stk4 APN 2 164086607 missense probably benign 0.05
IGL02423:Stk4 APN 2 164086499 missense probably benign 0.00
IGL02601:Stk4 APN 2 164086542 missense probably damaging 1.00
IGL02712:Stk4 APN 2 164096897 missense probably damaging 1.00
iwo_jima UTSW 2 164088959 missense possibly damaging 0.94
ribeye UTSW 2 164079566 missense probably damaging 1.00
sergeant UTSW 2 164099712 missense probably benign
stryker UTSW 2 164083688 nonsense probably null
R0377:Stk4 UTSW 2 164096800 missense probably damaging 1.00
R0607:Stk4 UTSW 2 164098542 missense probably damaging 1.00
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1972:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1973:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1976:Stk4 UTSW 2 164100528 missense probably benign 0.04
R2025:Stk4 UTSW 2 164096831 missense probably damaging 1.00
R3155:Stk4 UTSW 2 164151743 missense probably benign 0.01
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3733:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3734:Stk4 UTSW 2 164088908 missense probably benign 0.05
R4288:Stk4 UTSW 2 164099712 missense probably benign
R4296:Stk4 UTSW 2 164117984 missense possibly damaging 0.69
R4360:Stk4 UTSW 2 164088959 missense possibly damaging 0.94
R4829:Stk4 UTSW 2 164099827 critical splice donor site probably null
R4954:Stk4 UTSW 2 164151681 missense possibly damaging 0.75
R4954:Stk4 UTSW 2 164151682 missense probably damaging 1.00
R5088:Stk4 UTSW 2 164083688 nonsense probably null
R5188:Stk4 UTSW 2 164088908 missense possibly damaging 0.85
R5283:Stk4 UTSW 2 164110279 nonsense probably null
R5554:Stk4 UTSW 2 164099725 missense probably benign
R5605:Stk4 UTSW 2 164079566 missense probably damaging 1.00
R5694:Stk4 UTSW 2 164100564 missense possibly damaging 0.87
R5711:Stk4 UTSW 2 164099754 missense probably benign 0.20
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2019-02-01 1:13 PM by Diantha La Vine
Record Created 2017-03-31 9:40 AM by Xue Zhong
Record Posted 2018-08-15
Phenotypic Description
Figure 1. Hallon mice exhibit reduced frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Hallon mice exhibit an increase in the CD4+ to CD8+ T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Hallon mice exhibit reduced frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Hallon mice exhibit reduced frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Hallon mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Hallon mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Hallon mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Hallon mice exhibit reduced IgD expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Hallon mice exhibit increased CD44 expression on peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Hallon mice exhibit increased CD44 expression on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Hallon mice exhibit increased levels of OVA-specific IgE after OVA/alum challenge. ELISA analysis was utilized to determine IgE expression. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Homozygous hallon mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hallon phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4829, some of which showed a decrease in the frequency T cells (Figure 1) in the peripheral blood. Some mice also showed an increase in the CD4+ to CD8+ T cell ratio (Figure 2) due to a decrease in the frequency of CD4+ T cells (Figure 3) and a lesser diminution in the frequency of CD8+ T cells (Figure 4) in the peripheral blood. Some mice also showed an increased frequency of macrophages (Figure 5), neutrophils (Figure 6), and natural killer (NK) cells (Figure 7), all in the peripheral blood. Expression of IgD was reduced on the surface of peripheral blood B cells (Figure 8). CD44 expression on the surface of peripheral blood CD4+ (Figure 9) and CD8+ T cells (Figure 10) was increased. The level of OVA-specific IgE after OVA/Alum challenge was increased (Figure 11). The T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) was diminished (Figure 12). 

 

The phenotypes observed in the hallon mice were validated by CRISPR/Cas9 targeting of Stk4.

Nature of Mutation
Figure 13. Linkage mapping of the increased CD44 MFI on CD8+ T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 101 mutations (X-axis) identified in the G1 male of pedigree R4829. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 101 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Stk4: a T to C transition at base pair 164,099,827 (v38) on chromosome 2, or base pair 25,715 in the GenBank genomic region NC_000068 within the donor splice site of intron 8. The strongest association was found with a recessive model of linkage to the expression of CD44 on CD8+ T cells, wherein six variant homozygotes departed phenotypically from 19 homozygous reference mice and 28 heterozygous mice with a P value of 5.355 x 10-19 (Figure 13).  A strong semidominant effect was observed in most of the assays, but the mutation is predominantly recessive. A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of cryptic splice site within intron 8. The resulting transcript would have a 62-base pair insertion of intron 8, which would cause a frame shifted protein beginning after amino acid 319 of the protein. The protein would terminate after the inclusion of 43 aberrant amino acids.

 

           <--exon 7      <--exon 8 intron 8-->          exon 9-->       <--exon 11

24453 ……CAGCTCCTACAG ……GAGGAGAACTCA gtgagtggctgctctctg…… GAGGAGGATGAA……CAGAACTTCTGA
274   ……-Q--L--L--Q- ……-E--E--N--S-                      -E--E--D--E-……-Q--N--F--*- 487

 

Genomic numbering corresponds to NC_000068. The donor splice site of intron 8, which is destroyed by the hallon mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 14. Domain organization of MST1. The hallon mutation destroys the donor splice site of intron 8. Other mutations found in the MST1 protein are shown in red. Click on each mutation for more information. Abbreviations: CC, coiled-coil; SARAH, Salvador/Rassf/Hippo domain.

Stk4 encodes mammalian sterile 20-like kinase 1 (MST1; alternatively, serine/threonine protein kinase 4 [STK4]), a member of the MST family of kinases that also includes MST2 (STK3), MST3 (STK24), MST4 (STK26), and YSK1 (STK25) [reviewed in (1)].

 

MST1 has two domains, an N-terminal kinase domain and a C-terminal SARAH (Salvador/Rassf/Hippo) domain (Figure 14). The MST1 SARAH domain interacts with the SARAH domains of the tumor suppressors RASSF1 and RASSF5 (alternatively, Nore1), subsequently promoting apoptosis (2;3). The SARAH domain is also involved in dimerization (2). The SARAH domain has two helices (h1, amino acids 433 to 437; h2, amino acids 441 to 480). In a MST1 dimer the helices interact through hydrophobic interactions between amino acids 436, 439, 441, and 444 from one monomer and amino acids 473 and 477 from the other (2).

 

MST1 is autophosphorylated at Thr183 (see the Background section for more information) (4). The association of MST1/2 with RASSF1 and RASSF5 suppress MST1/2 autophosphorylation (4). Thr183 can also be phosphorylated by TAO kinases (TAOK1/2/3; see the record for taoist). MST1 is also phosphorylated by PKB/AKT1 at Thr387, which prevents MST1 activation, nuclear translocation, and Thr183 autophosphorylation (5;6). During apoptosis, MST1 is cleaved by caspase-3 at Asp326 to produce a 37-kDa form (5). Proteolytic cleavage of MST1 results in its activation and nuclear translocation (7;8).

 

The hallon mutation is predicted to result in a frame-shifted protein beginning after amino acid 319 of the protein and premature termination after the inclusion of 43 aberrant amino acids. The mutation would affect both the 37-kDa and 18-kDa forms of MST1.

Expression/Localization

A 7.0-kb STK4 transcript is ubiquitously expressed, while a 3.4-kb putative splice variant is highly expressed in kidney, placenta, and skeletal muscle (1). MST1 localizes to the cytoplasm, but the catalytic fragment of MST1 translocates to the nucleus.

Background
Figure 15. MST1 functions in both the YAP/TAZ and FOXO signaling pathways. Signals from GPCRs, the Wnt pathway, mechanical stress, tight junctions, adherent junctions, as well as some soluble growth factors promote the phosphorylation of MST1/2. MST1/2 phosphorylates LATS1/2, subsequently inhibiting the transcriptional function of YAP/TAZ by creating a 14-3-3 binding site, which promotes cytoplasmic localization of YAP/TAZ, resulting in YAP/TAZ cytoplasmic retention and degradation. In the FOXO signaling pathway, MST1/2 phosphorylates AKT and subsequently disrupts its function of interaction between FOXO3 with 14-3-3 proteins. In T cells, MST1/2 promotes T cell migration via the MST1-MOB1-DOCK8-Rac1 axis or by activating and clustering LFA-1 through DENND1C-RAB13, RIAM-Kindlin-3-Talin or VASP signaling. MST1/2 enhances Treg differentiation via promoting Foxp3’s acetylation and activity. In dendritice cells, MST1/2 modulates Th17 differentiation in an MST1/2-p38-IL6-IL-6R-STAT3-dependent manner. This image is interactive. Mutations found in the pathway are noted in red. Click on each mutation for more information.

MST1 is a serine/threonine kinase with both proaopototic and antiapoptotic functions in several systems, including the immune system (9;10), cardiovascular system (11;12), digestive system (13;14), respiratory system (15), and the central nervous system [reviewed in (16)]. MST1 and MST2 are mammalian orthologs of Drosophila Hippo. Hippo is within a pathway that restricts cell proliferation and promotes apoptosis during development, growth, repair, and homeostasisThe Hippo pathway is activated by TAOK1/2/3 upon sensing of stressful stimuli (Figure 15). Upon Hippo pathway activation, the TAOKs phosphorylate Thr183 of MST1 (and Thr180 in MST2), resulting in MST1/2 activation (17). MST1/2 (in complex with the regulatory scaffold protein SAV1 [alternatively, WW45]) phosphorylate and activate large tumor suppressor 1/2 (LATS1/2). NF2/Merlin interacts with LATS1/2 and facilitates LATS1/2 phosphorylation by the MST1/2–SAV1 complex (18). G-protein-coupled receptors (GPCRs) can either activate (Gα12/13 and Gαq/11) or suppress (GαS) LATS1/2 (19). Cell polarity and architecture can also control LATS1/2 activation. Activated LATS1/2 in complex with the regulatory protein MOB1 subsequently phosphorylates and inactivates the oncoprotein Yes-associated protein-1 (YAP1) (see the record for Puddel_hunde) and the transcriptional coactivator with PDZ-binding motif (TAZ). YAP1 and TAZ phosphorylation promotes binding with 14-3-3 in the cytoplasm, preventing translocation of YAP1 and TAZ to the nucleus. LATS-induced YAP1 and TAZ phosphorylation induces YAP1/TAZ phosphorylation by casein kinase 1δ/ε, recruitment of the SCF E3 ubiquitin ligase, and subsequent YAP1/TAZ ubiquitination and degradation. When active, YAP1 and TAZ translocate to the nucleus to bind the TEAD transcription factor family (homologs of Drosophila Scalloped) and induce the expression of its target genes involved in cell proliferation, cell death, and cell migration.

 

MST1/2 can also activate the non-canonical Hippo signaling pathway through Mps one binder 1A and B (MOB1A/B) and/or NDR1/2 [reviewed in (20)]. The MST1/2-WW45 complex phosphorylates and activates the LATS1/2-MOB1A/B complex, which in turn phosphorylates YAP/TAZ. The MST1-MOB1-DOCK8 (see the record for captain_morgan)-Rac1 axis promotes T cell migration by activating and clustering LFA-1 through DENND1C-RAB13, RIAM-Kindlin-3-Talin, or VASP signaling. The MST1-NDR1 pathway phosphorylates TAZ to promote Th17 differentiation.

 

MST1/2 has several functions unrelated to Hippo signaling. MST1/2 can activate the JNK/SAPK pathway after actin cytoskeleton disruption to induce cell cycle arrest, apoptosis, or cell survival (21). MST1/2 promote neuronal cell death by phosphorylating (and activating) forkhead box O (FOXO) transcription factors in response to oxidative stress. The FOXO transcription factors subsequently promote the expression of proapoptotic genes (22). In cancer cells, MST1-FOXO1 promotes the transcription of the proapoptotic mediator NOXA to control apoptosis (23). MST1/2-mediated phosphorylation and subsequent stabilization of FOXA2 regulates pneumocyte maturation and surfactant homeostasis (15). The MST1-FOXO signaling pathway also maintains naïve T cell homeostasis and enhances Treg differentiation by promoting the acetylation and activity of Foxp3 (24). The 37-kDa MST1 fragment enters the nucleus and phosphorylates histones H2AX and H2B, which promotes chromatin condensation, DNA fragmentation, and subsequently apoptotic cell death (8;25;26).

 

Mutations in STK4 are linked to T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations (OMIM: #614868) (27;28). Patients exhibit T- and B-cell lymphopenia, intermittent neutropenia, and atrial septal defects as well as recurring bacterial infections, viral infections, skin abscesses, cutaneous warts, and mucocutaneous candidiasis (28).

Putative Mechanism

Mice that lack either Stk3 or Stk4 are viable, but mice that lack both Stk3 and Stk4 (Stk3-/-; Stk4-/-) are not (29). The Stk3-/-; Stk4-/- mice exhibited growth retardation, failed placental development, impaired yolk sac/embryo vascular patterning and primitive hematopoiesis, increased apoptosis in placentas and embryos, and disorganized proliferating cells in the embryo. A liver-specific double-knockout model exhibits hepatomegaly and hepatocellular carcinoma.

 

Stk4-deficient (Stk4-/-) mice exhibit progressive loss of T and B cells due to excessive apoptosis (29;30). Stk4-/- mice have reduced numbers of naïve T cells in secondary lymphoid organs and in the peripheral blood. Stk4-/- mice exhibited an accumulation of mature thymocytes in the thymus, a reduction of lymphocytes in blood and peripheral lymphoid tissues, and reduced ability to traffic to peripheral lymph nodes (9). Thymocytes from the Stk4-/- mice showed diminished chemotactic responses to CCL19, but not S1P (9). Mature T cells from the Stk4-/- mice exhibited a reduced capacity to egress from the thymus. Stk4-/- mice also exhibited inefficient migration and antigen recognition of CD4+ T cells within the medulla (31). Stk4-/- naïve T cells exhibited increased proliferation in response to T-cell receptor stimulation; the proliferative responses of Stk4-/- effector/memory T cells were comparable to that in wild-type mice (30).

 

The phenotype of the hallon mice indicate loss of MST1 function.

Primers PCR Primer
hallon(F):5'- CAAACCGTGTCCATTGTTGTC -3'
hallon(R):5'- CTAGGGGATGTCTCTGTCTCTC -3'

Sequencing Primer
hallon_seq(F):5'- GTCCACTTTGTTATTTAAGCACCCG -3'
hallon_seq(R):5'- GGGATGTCTCTGTCTCTCACTGTC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, Aijie Liu, Evan Nair-Gill, Takuma Misawa, Ying Wang, Tao Yue, Zhao Zhang and Bruce Beutler