Phenotypic Mutation 'metallica' (pdf version)
Allelemetallica
Mutation Type nonsense
Chromosome13
Coordinate95,015,174 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Wdr41
Gene Name WD repeat domain 41
Synonym(s) B830029I03Rik, MSTP048
Chromosomal Location 94,976,344-95,023,314 bp (+)
MGI Phenotype FUNCTION: This gene encodes a protein of unknown function, but which contains a WD40 domain consisting of six WD40 repeats. The WD40 domain is one of the most abundant protein domains in eukaryotes, and is found in proteins with widely varying cellular functions. However, proteins with this domain often provide a rigid scaffold for protein-protein interactions. [provided by RefSeq, Aug 2012]
Accession Number

NCBI RefSeq: NM_172590; MGI:2445123

Mapped No 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000055145] [ENSMUSP00000138501] [ENSMUSP00000138543] [ENSMUSP00000124033] [ENSMUSP00000129595] [ENSMUSP00000152667]
SMART Domains Protein: ENSMUSP00000055145
Gene: ENSMUSG00000042015
AA Change: Q281*

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138501
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000138543
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 1e-5 BLAST
internal_repeat_2 224 281 1.46e-11 PROSPERO
internal_repeat_1 233 315 2.35e-20 PROSPERO
internal_repeat_2 306 365 1.46e-11 PROSPERO
internal_repeat_1 353 435 2.35e-20 PROSPERO
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000138569
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
internal_repeat_2 1 37 2.8e-14 PROSPERO
internal_repeat_1 2 42 7.42e-17 PROSPERO
internal_repeat_1 38 78 7.42e-17 PROSPERO
internal_repeat_2 43 79 2.8e-14 PROSPERO
Predicted Effect noncoding transcript
SMART Domains Protein: ENSMUSP00000124033
Gene: ENSMUSG00000042015
AA Change: Q281*

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000129595
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect probably benign
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10
DSS: sensitive day 7
FACS B1a cells - increased
FACS B220 MFI - increased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS NK T cells - increased
Nlrc4 inflammasome: low response
NLRP3 inflammasome: low response
TLR signaling defect: hypersensitivity to CpG + IFNg
TLR signaling defect: hypersensitivity to LPS
TLR signaling defect: hypersensitivity to PAM3CSK4
TLR signaling defect: hypersensitivity to poly I:C
TLR signaling defect: hypersensitivity to R848
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (other)(1) Endonuclease-mediated(1) Gene trapped(2) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Wdr41 APN 13 95017456 unclassified probably benign
IGL02813:Wdr41 APN 13 94995245 splice site probably null
gogi UTSW 13 95015217 critical splice donor site probably null
R0047:Wdr41 UTSW 13 95010287 missense probably damaging 1.00
R0110:Wdr41 UTSW 13 95018111 unclassified probably benign
R0243:Wdr41 UTSW 13 95017406 missense probably damaging 1.00
R0537:Wdr41 UTSW 13 94995305 splice site probably benign
R2025:Wdr41 UTSW 13 95018948 missense probably damaging 1.00
R2116:Wdr41 UTSW 13 95015029 critical splice acceptor site probably null
R3953:Wdr41 UTSW 13 94997063 missense probably damaging 1.00
R4886:Wdr41 UTSW 13 95015174 nonsense probably null
R5055:Wdr41 UTSW 13 95015217 critical splice donor site probably null
R5266:Wdr41 UTSW 13 94995251 missense probably damaging 1.00
R5276:Wdr41 UTSW 13 95017450 critical splice donor site probably null
R5738:Wdr41 UTSW 13 94978488 missense possibly damaging 0.55
R5957:Wdr41 UTSW 13 94997187 critical splice donor site probably null
R6682:Wdr41 UTSW 13 95013131 missense probably damaging 1.00
R6815:Wdr41 UTSW 13 95018174 missense probably damaging 1.00
R6817:Wdr41 UTSW 13 94997304 intron probably null
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-01-09 12:52 PM by Anne Murray
Record Created 2017-05-16 10:37 AM
Record Posted 2019-01-07
Phenotypic Description
Figure 1. The metallica (Wdr41mca/mca) mice show increased TNF secretion in response to endosomal TLR stimulation. (A) ELISA analysis of TNF secretion by peritoneal macrophages stimulated for 6 hours with indicated concentrations of poly(I:C), R848, and CpG. (B,C) Frequency of CD44+CD62L- CD4+ (B) and CD8+ (C) T cells in peripheral blood from mice at 6 months of age. Data points represent individual mice. Data are expressed as means ± s.d. and the significance of differences between genotypes was determined by one-way ANOVA with Dunnett’s multiple comparisons (A-C) (ns, not significant, P≥0.05; *P<0.05, **P<0.01, ***P<0.001). Figure and legend adapted from (1).

The metallica phenotype was not identified in the traditional phenotypic screening pipeline, but was phenotypically analyzed as the R4886 pedigree contained a Wdr41 allele. The metallica mice showed elevated TNF production after stimulation with the TLR ligands poly(I:C), R848, and CpG (Figure 1A) (1). The mice also showed increased frequencies of activated T cells in the peripheral blood (Figure 1B and C).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. All of the above anomalies were linked to a mutation in Wdr41: a C to T transition at base pair 95,015,174 (v38) on chromosome 13, or base pair 38,960 in the GenBank genomic region NC_000079. The mutation corresponds to residue 1,036 in the mRNA sequence NM_172590 within exon 10 of 14 total exons.

 

1021 AAGCTCTTCCAAAAACAAAATGATATTTCTATT

276  -K--L--F--Q--K--Q--N--D--I--S--I-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 281 for a premature stop codon (Q281*) in the WDR41 protein.

Protein Prediction
Figure 2. Domain organization of WDR41. WDR41 is a member of the WD repeat protein family and has six WD repeats.The metallica mutation results in substitution of glutamine 281 for a premature stop codon. This image is interactive. Other mutations found in WDR41 are noted. Click on each mutation for more information.

Wdr41 encodes WDR41 (WD repeat-containing protein 41), a member of the WD repeat protein family. WDR41 has six WD repeats (Figure 2). WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes.

 

The metallica mutation results in substitution of glutamine 281 for a premature stop codon (Q281*); Gln281 is within an undefined region between the fourth and fifth WD repeat.

 

Please see the record gogi for more information about Wdr41.

Putative Mechanism

WDR41 interacts with C9ORF72 and SMCR8 (see the record for patriot) to form the SWC (SMCR8-WDR41-C9ORF72) tripartite complex (2;3). The SWC complex functions as a GDP-GTP exchange factor for the small GTPases RAB8A and RAB39B, which function in vesicle trafficking and autophagy (3-7). After TBK1-mediated phosphorylation of SMCR8, the SWC complex interacts with the autophagy initiation complex ULK1/FIP200/autophagy-related protein 13 (ATG13)/ATG101 via C9ORF72 binding (3;4;6). The interaction between the SWC complex and the ULK1 complex regulates the expression and activity of ULK1 (6;7). Knockout of SMCR8 or C9ORF72 resulted in enlarged lysosome vesicles, while SMCR8 knockout alone showed accumulation of lysosomes and lysosomal enzymes as well as impaired autophagy induction (3-6;8). The function of WDR41 is unknown, but it is a putative scaffold protein that regulates the localization of C9orf72 and SMCR8 to the lysosome (9).

 

Wdr41-deficient mice have not been phenotypically characterized (MGI; accessed September 15, 2017).

 

Toll-like receptors (TLRs) play an essential role in the innate immune response as key sensors of invading microorganisms by recognizing conserved molecular motifs found in many different pathogens, including bacteria, fungi, protozoa and viruses. TLR signaling initiates a cascade of signaling events involving various kinases, adaptors and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7. The endosomal TLRs recognize exogenous nucleic acids:  double-stranded DNA unmethylated at CpG motifs (TLR9), single-stranded (ss) RNA viruses (TLR7 and TLR8) and double-stranded RNA (dsRNA; TLR3). Plasmacytoid dendritic cell recognition of some ssRNA viruses via TLR7 requires the transport of cytosolic viral replication intermediates into lysosomes by autophagy (10), a process by which cells engulf parts of their own cytoplasm to eliminate foreign material or recycle various molecules. Proteolytic cleavage of TLR7 and TLR9 within their respective ectodomains occurs in the endolysosome (11;12). Although full length and cleaved forms of TLR9 are capable of binding ligand, only the cleaved form can recruit MyD88 and lead to signaling. The cleavage mechanism has been postulated to restrict receptor activation to endolysosomal compartments and prevent responses to self-nucleic acids (11).
Once activated, TLR9 signaling requires the adapter MyD88 and, like other MyD88-dependent TLRs, recruits IL-1R-associated kinase 1 (IRAK1), IRAK4 and tumor necrosis factor receptor-associated factor 6 (TRAF6), leading to NF-κB and MAP kinase activation (13). MyD88, together with TRAF6 and IRAK4, has also been shown to bind interferon regulatory factor 7 (IRF7) directly in order to stimulate IFN-α production (14;15).

 

The defects in TLR9-associated signaling observed in the metallica mice is proposed to be caused by defects in the SWC complex due to loss of WDR41-assocated function (1). Loss of SWC complex function causes defects in lysosome and phagosome maturation, resulting in protracted TLR stimulation.

Primers Primers cannot be located by automatic search.
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R48860088_PCR_F: 5’- TGGTCTTCACATTGACACTCTAATC-3’

R48860088_PCR_R: 5’- GGATCCTGTCCATTGAACTTCAG-3’

 

Sequencing Primers

R48860088_SEQ_F: 5’- AGTTCTAGCCTAGAGACCATGATTGG-3’
 

R48860088_SEQ_R: 5’- GTCCATTGAACTTCAGTTATAAGTGC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 441 nucleotides is amplified (NCBI RefSeq: NC_000079, chromosome 13:95014918-95015358):

 

tggtcttcac attgacactc taatctttct gattagcttg tcaccttaac acatttttta       

gttctagcct agagaccatg attggtaatg gagcatttgt gaacttttcc tagatacagg       

tttcgtcact ggctcccacg ttggcgagct gctcatctgg gatgccctgg actggactgt      

gcaggcctgt gagcgcacct tctggagccc gaccgcacag ctggatgccc agcaggaaat      

aaagctcttc caaaaacaaa atgatatttc tattaatcat ttcacatgcg atgaagaggt      

aggtagtata attgttgcaa ataaaattag tatctggtat ttaaagcctt ctatattaga      

tataaaaagt tatgattctg ggttgttgag agggctcagt gtgcaaaagc acttataact      

gaagttcaat ggacaggatc c

  

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = C>T).

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsLei Sun, William McAlpine, Emre Turer, and Bruce Beutler