Phenotypic Mutation 'andalusia'

• Allele: andalusia
• Mutation Type: makesense
• Chromosome: 9
• Coordinate: 111,100,478 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Mlh1
• Gene Name: mutL homolog 1
• Synonym(s): 1110035C23Rik, colon cancer, nonpolyposis type 2
• Chromosomal Location: 111,057,296-111,100,854 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced pairing in meiotic prophase I and produce no mature germ cells. Mutants also display increased microsatellite instability and a predisposition for developing intestinal and other tumors. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Stop codon changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000035079] [ENSMUSP00000143786]
• AlphaFold: Q9JK91
• SMART Domains: Protein: ENSMUSP00000035079; Gene: ENSMUSG00000032498; AA Change: C39R

Domain	Start	End	E-Value	Type
HATPase_c	23	158	4.57e-1	SMART
DNA_mis_repair	216	335	1.08e-44	SMART
low complexity region	363	375	N/A	INTRINSIC
low complexity region	429	454	N/A	INTRINSIC
Pfam:Mlh1_C	504	760	8.3e-100	PFAM

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
  (Using ENSMUST00000035079)
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:40 PM by Anne Murray
• Record Created: 2017-05-22 8:55 AM by Bruce Beutler
• Record Posted: 2018-08-02
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi and Bruce Beutler

Accession Number

NCBI RefSeq: NM_026810, NM_001324522; MGI:101938

Alleles Listed at MGI

All Mutations and Alleles(14) : Endonuclease-mediated(1) Gene trapped(6) Targeted(7)

Phenotypic Description

Figure 1. Homozygous andalusia mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The andalusia phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5007, some of which showed diminished T-dependent antibody responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1). 

Nature of Mutation

Figure 2. Linkage mapping of the diminished T-dependent IgG responses to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 83 mutations (X-axis) identified in the G1 male of pedigree R5007. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 83 mutations. The diminished T-dependent antibody response to rSFV-β-gal phenotype was linked by continuous variable mapping to mutations in two genes on chromosome 9: Pcbp4 and Mlh1. The mutation in Mlh1 was presumed causative as a second allele was discovered in a separate pedigree (R5265; see the record for andalusia2) that phenocopied andalusia. The Mlh1 mutation is a T to C transition at base pair 111,271,410 (v38) on chromosome 9, or base pair 377 in the GenBank genomic region NC_000075 encoding Mlh1. Linkage was found with a recessive model of inheritance, wherein five variant homozygotes departed phenotypically from 14 homozygous reference mice and 24 heterozygous mice with a P value of 1.335 x 10^-6 (Figure 2).  A substantial semidominant effect was also observed (P = 6.901 x 10^-5). 

The mutation corresponds to residue 199 in the mRNA sequence NM_026810 within exon 1 of 19 total exons.

184 GAGATGATAGAAAACTGTTTAGATGCAAAATCT 34  -E--M--I--E--N--C--L--D--A--K--S-

The mutated nucleotide is indicated in red. The mutation results in a cysteine to arginine substitution at position 39 (C39R) in the MLH1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.935).

Protein Prediction

Figure 3. Domain organization of MLH1. The andalusia mutation results in a cysteine to arginine substitution at position 39. Mutations found in the MLH1 protein are shown in red. Click on each mutation for more information.

Figure 4. Crystal structure of human MLH1. β-strands are shown in cyan, and α-helices are shown in pink. UCSF Chimera model is based on PDB 4P7A. Click on the 3D structure to view it rotate.

MLH1 (mutL homolog 1 [E. coli]) is a member of the GHKL (gyrase, Hsp90, histidine kinase, MutL) ATPase/kinase superfamily of proteins (1). MLH1 has an ATPase domain, MutS homolog (MSH2, MSH3, MSH6) interaction domain, EXO1 interaction domain, PMS2/MLH3/PMS1 interaction domain, and a CTH (C-terminal homology) motif (Figure 3). The significance of the interactions between MLH1 and its interacting partners will be described in more detail in the Background section, below. The CTH is required for the spellchecker function of MLH1 (2).

The X-ray crystal structure of a the human MLH1 N-terminus (amino acids 1 to 340) has been solved [Figure 4; PDB:4P7A; (3)]. The structure included the ATPase domain and a ‘transducer’ domain linked by two helices. The ATPase domain forms an ATPase Bergerat fold, which is composed of a four-stranded, antiparallel β-sheet (β1–β3 and β5) and three α-helices (αB–αD) (4). Between helices αC and αD (residues 74–85 and 98–101) is an ATP-binding loop (3). The ATP-binding loop contains a conserved GFRGE(A/G)L motif found in mismatch repair proteins (5). The transducer domain is a small α/β barrel with a ribosomal protein S5 domain 2-like fold and a left-handed α-helical crossover (αI) between β10 and β11. 

The andalusia mutation results in a cysteine to arginine substitution at position 39 (C39R) in the MLH1 protein; Cys39 is within the ATPase domain.

Expression/Localization

Mlh1 is ubiquitously expressed.

Background

Figure 5. Model for mammalian DNA mismatch repair (MMR). The MutSα complex recognizes single nucleotide mismatches and 1-bp insertion/deletion loops. MutSα binds to DNA as a sliding clamp. MutLα then binds to hMutSα to guide an exonuclease to remove several bases from the newly synthesized DNA strand, with subsequent re-synthesis of DNA with the correct base pairing.When the MutS complexes bind DNA, they exchange ADP for ATP. For the MMR proteins to be released from DNA, ATP is hydrolyzed to ADP. Figure and legend are adapted from Jang and Chung, 2010 .

Figure 6. MLH1 functions in meiotic recombination. The two interacting DNA duplexes (chromatids) are shown as red and blue double strands. A double-strand break formed in the red duplex is resected by a 5′ to 3′ exonuclease to generate long 3′ single-strand overhangs. One single strand invades the homologous duplex, forming a heteroduplex and displacing a D loop, which is extended by DNA synthesis. The resulting D loop can either follow the synthesis-dependent strand annealing (SDSA) or double-strand break repair (DSBR) pathway. In the SDSA pathway, the D loop intermediate is disassembled by displacement of the newly synthesized DNA strand, which then anneals with the second single-strand overhang. Repair of the break is completed by DNA synthesis and ligation. The SDSA pathway generates only non-crossover products. In the DSBR pathway, the D loop anneals to the second 3′ end overhang, serving as a template for additional DNA synthesis. Ligation of the newly synthesized strands to the recessed ends leads to the formation of a Double Holliday junction with heteroduplex DNA flanking the double-strand break site. MutLγ (MLH1-MLH3) localizes to sites of crossing over in the meiotic chromosomes. This recombination intermediate can be resolved by cutting the outside strands or the inside strands of each junction. The resolution always involves opposite sense cutting (two outside strands and two inside strands); only one of the two alternatives is shown here. This modified version of the DSBR pathway would generate only crossover products. Legend was modified from Dooner, H.K. (2002) .

The DNA mismatch repair (MMR) pathway removes base mismatches and insertion/deletion mispairs that occur during DNA replication and recombination (Figure 5). During MMR, a MutS heterodimer [MSH2-MSH6 (see the record for medea) (MutSα) or MSH2–MSH3 (MutSβ)] binds to DNA mismatches (6). MutSα preferentially recognizes single base (G/T) mismatches and one- or two-nucleotide insertion/deletion mispairs (7), while MutSβ preferentially recognizes insertion/deletion mispairs that contain two or more extra bases. Upon binding, the MutS undergoes an ADP to ATP exchange and a conformational change, followed by recruitment of MutLα (a MLH1-PMS2 heterodimer), MutLβ (a MLH1-PMS1 heterodimer), or MutLγ (a MLH1-MLH3 heterodimer). MutLα primarily functions in MMR, the function of MutLβ is unknown, and MutLγ primarily functions in meiotic recombination (8;9). The MutL complexes cleave the defective strand near the mismatch site. The MutS-MutL complex then recruits an exonuclease, subsequently leading to strand-specific excision; PCNA coordinates with the exonuclease to excise the mismatch-containing region. The removed DNA fragment is resynthesized by DNA polymerase δ and the repair process is completed by DNA ligase.

MLH1 (in complex with MLH3 [i.e., MutLγ]) functions in meiotic recombination (Figure 6). Meiotic recombination is initiated by a DNA double-strand break. After the DNA break, there is pairing of a homologous chromosome and strand invasion to initiate repair. Gap repair can proceed by crossover or non-crossover events. Crossover recombination putatively occurs by the Double Holliday Junction model, and non-crossover recombination putatively occurs by the Synthesis-dependent Strand Annealing model. MutLγ localizes to sites of crossing over in the meiotic chromosomes (10), and is required for oocytes to progress through metaphase II of meiosis (11).

Mutations in MLH1 are linked to hereditary nonpolyposis colorectal cancer type 2 (HNPCC2; OMIM: # 609310; (12)), mismatch repair cancer syndrome (OMIM: #276300; (13)), and Muir-Torre syndrome (OMIM: #158320; (14)). Muir-Torre syndrome is an autosomal dominant disorder characterized by development of sebaceous gland tumors and skin cancers, including keratoacanthomas and basal cell carcinomas. Patients can have several internal malignancies, including colorectal, endometrial, urologic, and upper gastrointestinal neoplasms. 

Male and female Mlh1-deficient (Mlh1^-/-) mice exhibited infertility (10;15) and premature death. The Mlh1^-/- mice showed reduced levels of chiasmata (10;16). The chromosomes in Mlh1^-/- sperm separate prematurely during spermatogenesis. In addition, the first division of meiosis is frequently arrested (10). Mlh1^-/- mice exhibit increased incidences of intestinal adenocarcinomas and adenomas, uterus tumor incidence, skin tumor incidence, and lymphoma incidence (15;17-20).

Primers

PCR Primer
andalusia_pcr_F: TTCGGCCGTGTGCATAATG
andalusia_pcr_R: TAAAAGCGCTTGACTGGCATTC

Sequencing Primer
andalusia_seq_F: GCCGTGTGCATAATGGGAAACC
andalusia_seq_R: CATTCATGCTGCCCAATCAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 426 nucleotides is amplified (chromosome 9, - strand):

1   taaaagcgct tgactggcat tcatgctgcc caatcagcac ttgccgctgg gaagacggcg
61  caggactgca gtcggccgaa gctgaaggaa gaacttgagc gtgaggagct cgagtgattg
121 gctgactggg aactcgggcg ccaatatggc gtttgtagca ggagttattc ggcgtctgga
181 cgagacggta gtgaaccgca tagcggcggg ggaagtcatt cagcggccgg ccaatgctat
241 caaagagatg atagaaaact ggtacggagg gagcggagcc gagttccccg actgagagcc
301 ggggcgggcc gacccacctg ctgcagtcgg ccaccgtgcg gggcaccgag cacggggacc
361 gtgggggcat cgggcacagg gaccctgcgc gtgccaggct ggtttcccat tatgcacacg
421 gccgaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Dutta, R., and Inouye, M. (2000) GHKL, an Emergent ATPase/kinase Superfamily. Trends Biochem Sci. 25, 24-28.

  2. Pang, Q., Prolla, T. A., and Liskay, R. M. (1997) Functional Domains of the Saccharomyces Cerevisiae Mlh1p and Pms1p DNA Mismatch Repair Proteins and their Relevance to Human Hereditary Nonpolyposis Colorectal Cancer-Associated Mutations. Mol Cell Biol. 17, 4465-4473.

  3. Wu, H., Zeng, H., Lam, R., Tempel, W., Kerr, I. D., and Min, J. (2015) Structure of the Human MLH1 N-Terminus: Implications for Predisposition to Lynch Syndrome. Acta Crystallogr F Struct Biol Commun. 71, 981-985.

  4. Bergerat, A., de Massy, B., Gadelle, D., Varoutas, P. C., Nicolas, A., and Forterre, P. (1997) An Atypical Topoisomerase II from Archaea with Implications for Meiotic Recombination. Nature. 386, 414-417.

  5. Sehgal, M., and Singh, T. R. (2012) Identification and Analysis of Biomarkers for Mismatch Repair Proteins: A Bioinformatic Approach. J Nat Sci Biol Med. 3, 139-146.

  6. Palombo, F., Gallinari, P., Iaccarino, I., Lettieri, T., Hughes, M., D'Arrigo, A., Truong, O., Hsuan, J. J., and Jiricny, J. (1995) GTBP, a 160-Kilodalton Protein Essential for Mismatch-Binding Activity in Human Cells. Science. 268, 1912-1914.

  7. Clark, A. B., Deterding, L., Tomer, K. B., and Kunkel, T. A. (2007) Multiple Functions for the N-Terminal Region of Msh6. Nucleic Acids Res. 35, 4114-4123.

  8. Cannavo, E., Marra, G., Sabates-Bellver, J., Menigatti, M., Lipkin, S. M., Fischer, F., Cejka, P., and Jiricny, J. (2005) Expression of the MutL Homologue hMLH3 in Human Cells and its Role in DNA Mismatch Repair. Cancer Res. 65, 10759-10766.

  9. Ranjha, L., Anand, R., and Cejka, P. (2014) The Saccharomyces Cerevisiae Mlh1-Mlh3 Heterodimer is an Endonuclease that Preferentially Binds to Holliday Junctions. J Biol Chem. 289, 5674-5686.

  10. Baker, S. M., Plug, A. W., Prolla, T. A., Bronner, C. E., Harris, A. C., Yao, X., Christie, D. M., Monell, C., Arnheim, N., Bradley, A., Ashley, T., and Liskay, R. M. (1996) Involvement of Mouse Mlh1 in DNA Mismatch Repair and Meiotic Crossing Over. Nat Genet. 13, 336-342.

  11. Kan, R., Sun, X., Kolas, N. K., Avdievich, E., Kneitz, B., Edelmann, W., and Cohen, P. E. (2008) Comparative Analysis of Meiotic Progression in Female Mice Bearing Mutations in Genes of the DNA Mismatch Repair Pathway. Biol Reprod. 78, 462-471.

  12. Papadopoulos, N., Nicolaides, N. C., Wei, Y. F., Ruben, S. M., Carter, K. C., Rosen, C. A., Haseltine, W. A., Fleischmann, R. D., Fraser, C. M., and Adams, M. D. (1994) Mutation of a mutL Homolog in Hereditary Colon Cancer. Science. 263, 1625-1629.

  13. Hamilton, S. R., Liu, B., Parsons, R. E., Papadopoulos, N., Jen, J., Powell, S. M., Krush, A. J., Berk, T., Cohen, Z., and Tetu, B. (1995) The Molecular Basis of Turcot's Syndrome. N Engl J Med. 332, 839-847.

  14. Bapat, B., Xia, L., Madlensky, L., Mitri, A., Tonin, P., Narod, S. A., and Gallinger, S. (1996) The Genetic Basis of Muir-Torre Syndrome Includes the hMLH1 Locus. Am J Hum Genet. 59, 736-739.

  15. Edelmann, W., Yang, K., Kuraguchi, M., Heyer, J., Lia, M., Kneitz, B., Fan, K., Brown, A. M., Lipkin, M., and Kucherlapati, R. (1999) Tumorigenesis in Mlh1 and Mlh1/Apc1638N Mutant Mice. Cancer Res. 59, 1301-1307.

  16. Wei, K., Kucherlapati, R., and Edelmann, W. (2002) Mouse Models for Human DNA Mismatch-Repair Gene Defects. Trends Mol Med. 8, 346-353.

  17. Trinh, B. N., Long, T. I., Nickel, A. E., Shibata, D., and Laird, P. W. (2002) DNA Methyltransferase Deficiency Modifies Cancer Susceptibility in Mice Lacking DNA Mismatch Repair. Mol Cell Biol. 22, 2906-2917.

  18. Kawate, H., Sakumi, K., Tsuzuki, T., Nakatsuru, Y., Ishikawa, T., Takahashi, S., Takano, H., Noda, T., and Sekiguchi, M. (1998) Separation of Killing and Tumorigenic Effects of an Alkylating Agent in Mice Defective in Two of the DNA Repair Genes. Proc Natl Acad Sci U S A. 95, 5116-5120.

  19. Avdievich, E., Reiss, C., Scherer, S. J., Zhang, Y., Maier, S. M., Jin, B., Hou, H.,Jr, Rosenwald, A., Riedmiller, H., Kucherlapati, R., Cohen, P. E., Edelmann, W., and Kneitz, B. (2008) Distinct Effects of the Recurrent Mlh1G67R Mutation on MMR Functions, Cancer, and Meiosis. Proc Natl Acad Sci U S A. 105, 4247-4252.

  20. Albertson, T. M., Ogawa, M., Bugni, J. M., Hays, L. E., Chen, Y., Wang, Y., Treuting, P. M., Heddle, J. A., Goldsby, R. E., and Preston, B. D. (2009) DNA Polymerase Epsilon and Delta Proofreading Suppress Discrete Mutator and Cancer Phenotypes in Mice. Proc Natl Acad Sci U S A. 106, 17101-17104.