Phenotypic Mutation 'contraire'

• Allele: contraire
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 84,682,540 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Asf1b
• Gene Name: anti-silencing function 1B histone chaperone
• Synonym(s): 1700003K02Rik
• Chromosomal Location: 84,682,323-84,696,824 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the H3/H4 family of histone chaperone proteins and is similar to the anti-silencing function-1 gene in yeast. The encoded protein is the substrate of the tousled-like kinase family of cell cycle-regulated kinases, and may play a key role in modulating the nucleosome structure of chromatin by ensuring a constant supply of histones at sites of nucleosome assembly. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutant mice are viable and fertile and exhibit no overt abnormal phenotype. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Phenylalanine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000005607]
• AlphaFold: Q9DAP7
• SMART Domains: Protein: ENSMUSP00000005607; Gene: ENSMUSG00000005470; AA Change: F28S

Domain	Start	End	E-Value	Type
Pfam:ASF1_hist_chap	1	154	1.2e-74	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000005607)
• Meta Mutation Damage Score: 0.9596
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2022-04-23 7:37 AM by Diantha La Vine
• Record Created: 2017-05-27 11:10 AM
• Record Posted: 2018-09-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Evan Nair-Gill, Xue Zhong, Bruce Beutler

Accession Number

NCBI RefSeq: NM_024184; MGI:1914179

Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (other)(1) Gene trapped(6) Radiation induced(1) Targeted(2)

Phenotypic Description

Figure 1. Contaire mice exhibited increased amounts of OVA-specific IgE in response to OVA/alum stimulation. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The contraire phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5156, some of which showed increased amounts of OVA-specific IgE after OVA/alum administration (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced NK cell killing using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 55 mutations (X-axis) identified in the G1 male of pedigree R5156. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. CRISPR- Asf1b mice exhibited increased amounts of OVA-specific IgE in response to OVA/alum stimulation. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 55 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Asf1b:  a T to C transition at base pair 83,955,911 (v38) on chromosome 8, or base pair 218 in the GenBank genomic region NC_000074 encoding Asf1b.  The strongest association was found with a recessive model of inheritance to the normalized amount of NK-associated cell killing, wherein 10 variant homozygotes departed phenotypically from 20 homozygous reference mice and 23 heterozygous mice with a P value of 1.741 x 10^-6 (Figure 2).  

The mutation corresponds to residue 218 in the mRNA sequence NM_024184 within exon 1 of 4 total exons.

202 CGGTTCGAGATCAGCTTCGAATGCAGTGAGGCC 23  -R--F--E--I--S--F--E--C--S--E--A-

The mutated nucleotide is indicated in red.  The mutation results in a phenylalanine to serine substitution at position 28 (F28S) in the ASF1B protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Mice with a CRISPR/Cas9-mediated replacement of the asilomar allele (CRISPR-Asf1b ) showed increased amounts of OVA-specific IgE in response to OVA/alum stimulation confirming that Asf1b was causative for that phenotype in the asilomar mice (Figure 3).

Protein Prediction

Figure 4. Structure of Saccharomyces cerevisiae ASF1 bound to (Xenopus laevis) histones H3 and H4. This image is based on English, et al. ASF1 is shown in blue; H3 is purple; H4 is cyan. Click on the image to view the structure rotate. UCSF Chimera model is based on PDB 2HUE.

ASF1B (anti-silencing function 1b) is a member of the ASF1 protein family along with its paralog, ASF1A (in mammals). ASF1A and ASF1B share approximately 70% identical amino acids. ASF1 proteins do not have defined domains, but have a highly conserved 155-amino acid globular N-terminal domain and a variable-length (47-amino acids in mouse ASF1B) C-terminal tail.

The N-terminal ASF1 domains adopt a compact immunoglobulin-like beta sandwich fold topped by three helical linkers [PDB:1ROC, (1) and PDB:1TEY, (2)]. The core has a concave face made of beta strands β3, β4, and β6 trough β9 (3). The structure of the globular domain of yeast ASF1 (amino acids 1 to 169) bound to histones H3 (amino acids 60 to 135) and H4 (amino acids 20 to 102) has been solved [Figure 4; PDB:2HUE; (3)]. H3 binds the concave face of the beta sandwich fold. ASF1 binds the C-terminus of histone H3, blocking formation of the H3/H4 heterotetramer (see the Background section for more information). ASF1 undergoes subtle conformation changes after binding of H3/H4. The β3-β4 loop moves approximately 6 Å closer to H3 from its position in free Asf1 (PDB:1ROC), and the strands β3 and β4 move nearly 2 Å away from H3 around residue D54 in β4. The C-terminus of H4 undergoes a major conformational change upon binding to ASF1 and adds a beta strand to the ASF1 beta-sheet sandwich. The tail of H4 putatively acts as a lever to promote chromatin disassembly/assembly. The structure of the C-terminal tail of human ASF1A is unstructured and flexible (2). The function of the C-terminal tail is unknown, but may function in species-specific regulation of the ASF1 proteins or in binding interactions.

The contraire mutation results in a phenylalanine to serine substitution at position 28 (F28S) in the ASF1B protein; Phe28 is within the N-terminal domain.

Expression/Localization

ASF1A is broadly expressed, while ASF1B is highly expressed in testes, neutrophils, and bone marrow and at lower levels in the small intestine and colon (4-6).

Background

Figure 5. The role of ASF1 in nucleosome assembly. The color key is shown at the bottom right. A, Replication-dependent nucleosome assembly. Histone chaperones coordinate to regulate DNA replication-coupled nucleosome assembly. Once newly synthesized histone H3–H4 is imported into the nucleus, new H3–H4 of the Asf1-H3–H4 complex is transferred to CAF-1 for (H3–H4) 2 formation and deposition onto newly synthesized DNA. Deposition onto replicated DNA depends, in part, on the interaction between CAF-1 and PCNA. B, Replication-independent nucleosome assembly. HIRA mediates replication-independent nucleosome assembly of H3.3–H4. In human cells, H3.3–H4 of the Asf1a–H3.3–H4 complex is transferred to HIRA for deposition of H3.3–H4 at genic regions, possibly through interactions with RNA polymerase II and double-stranded DNA. Figure and legend adapted from Burgess,R.J. and Zhang,Z. (2013) .

Packaging of DNA into chromatin is required for normal development, growth, and differentiation. Chromatin regulates DNA transcription, replication, recombination, and repair. The repeating unit of chromatin is the nucleosome core, which is comprised of 147 base pairs of DNA wrapped around a histone octamer. A histone octomer is two H2A/H2B dimers and a (H3/H4)₂ tetramer; histone stoichiometry is controlled to ensure genome integrity (7). The (H3/H4)₂ tetramer organizes the central approximately 80 base pairs of DNA, while the peripheral approximately 40 base pairs of DNA are bound more loosely by the H2A/H2B dimer.

After DNA replication in the S phase, nucleosomes are assembled using parental histones and newly synthesized histones. Nucleosome assembly can also occur throughout the cell cycle in a replication-independent manner during gene transcription and histone exchange. Nucleosomes are assembled with the help of histone chaperone proteins. Histone chaperones bind specific histones to promote histone storage, removal, or deposition from/into the chromatin (8-10). ASF1B and ASF1A are histone H3/H4 (H3.1/H4 or H3.3/H4 [H3.1 and H3.3 are H3 variants]) chaperone proteins that function in both replication-dependent and replication-independent chromatin assembly (11-14). ASF1B and ASF1A modulate the nucleosome structure of chromatin by synergizing with H3/H4 cochaperones CAF-1 (chromatin assembly factor 1) and HIRA (histone regulator A) to promote a supply of histones at sites of nucleosome assembly (Figure 5) (15;16). ASF1 putatively transfers histones to the CAF-1 complex using a DNA replication-dependent pathway or to HIRA sing a DNA replication-independent pathway [(12;17); reviewed in (18)]]. ASF1 proteins are essential for proper DNA replication, DNA damage response and repair, DNA recombination, and transcription regulation. ASF1A functions in DNA repair and cell senescence, and ASF1B primarily functions in cell proliferation (4;19).

Asf1b-deficient (Asf1b^-/-) mice were viable, but Asf1b^-/- female mice exhibited diminished fertility; perinatal lethality was increased in the offspring of Asf1b^-/- female mice  (20).

Putative Mechanism

Aberrant ASF1B function in the contraire mice may lead to defects in histone trafficking, subsequent nucleosome assembly, and V(D)J and class-switch recombination (CSR). Immunoglobulin and T cell receptor loci consist of linear arrays of gene segments that require combinatorial assembly to form functional coding sequences. During lymphoid cell development, V-J or V-D-J segments of Ig or TCR loci are joined by the process of V(D)J recombination to generate a variable region exon, which is subsequently linked to the C region gene by RNA splicing. Ultimately, pre-B cells and thymocytes can survive to maturity only if they successfully carry out V(D)J recombination that will give them in-frame Ig and TCR chains, to be assembled into the final B cell receptor (BCR) and TCR complexes. For more information on V(D)J recombination, please see the record for maladaptive. CSR facilities the production of antibodies of different isotypes in mature B cells during a humoral immune response. CSR is a recombination reaction that occurs between paired DSBs in immunoglobulin heavy chain (Igh) switch regions (S-regions) that flank Igh constant regions. During CSR, activation-induced cytidine deaminase (AID; see the record for bellezza) converts cytosines into uracils at the S-region. The excision of uracils from both DNA strands results in staggered DNA breaks at donor and acceptor switch regions. The Igh locus lesions are detected as DNA double-strand breaks by the MRN [MRE11 (meiotic recombination 11)–Rad50–NBS1 (Nijmegen breakage syndrome 1)] complex, which leads to phosphorylation of H2AX, the recruitment of 53BP1 (see the record for lentil) to the Igh locus, and eventual end joining by C- or A-non-homologous endjoining (NHEJ) (49). For more information on CSR, please see the lentil page.

Primers

PCR Primer
contraire_pcr_F: TATTTGAAGGGAGCGCGCTG
contraire_pcr_R: AATGTACACTGGACAGAGCC

Sequencing Primer
contraire_seq_F: AGACGCAGGGAGGTTTCC
contraire_seq_R: ACTGGACAGAGCCGGCTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 413 nucleotides is amplified (chromosome 8, + strand):

1   tatttgaagg gagcgcgctg agcggaggag cgcttcagag ggaagagttg ggagacgcag
61  ggaggtttcc gtcctgtcgt cccccccttc ttctctgtcg caagtcactg tgaagaagtc
121 tccacagcag ctgcggctcc cgggcgcggt gatggccaag gtgtcggtgc tgaatgtggc
181 tgtgctggag aacccgagcc ctttccacag ccccttccgg ttcgagatca gcttcgaatg
241 cagtgaggcc ctgtctgacg gtgaggccgg gcctgagccg gggaccccag accctcctgc
301 cctcggggtt tcgccacccc caatctcccg gggccaacta gatctcccat tagatacgcc
361 tccatggccc agctccggtc tctcggtgga gccggctctg tccagtgtac att

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Daganzo, S. M., Erzberger, J. P., Lam, W. M., Skordalakes, E., Zhang, R., Franco, A. A., Brill, S. J., Adams, P. D., Berger, J. M., and Kaufman, P. D. (2003) Structure and Function of the Conserved Core of Histone Deposition Protein Asf1. Curr Biol. 13, 2148-2158.

  2. Mousson, F., Lautrette, A., Thuret, J. Y., Agez, M., Courbeyrette, R., Amigues, B., Becker, E., Neumann, J. M., Guerois, R., Mann, C., and Ochsenbein, F. (2005) Structural Basis for the Interaction of Asf1 with Histone H3 and its Functional Implications. Proc Natl Acad Sci U S A. 102, 5975-5980.

  3. English, C. M., Adkins, M. W., Carson, J. J., Churchill, M. E., and Tyler, J. K. (2006) Structural Basis for the Histone Chaperone Activity of Asf1. Cell. 127, 495-508.

  4. Corpet, A., De Koning, L., Toedling, J., Savignoni, A., Berger, F., Lemaitre, C., O'Sullivan, R. J., Karlseder, J., Barillot, E., Asselain, B., Sastre-Garau, X., and Almouzni, G. (2011) Asf1b, the Necessary Asf1 Isoform for Proliferation, is Predictive of Outcome in Breast Cancer. EMBO J. 30, 480-493.

  5. Umehara, T., and Horikoshi, M. (2003) Transcription Initiation Factor IID-Interactive Histone Chaperone CIA-II Implicated in Mammalian Spermatogenesis. J Biol Chem. 278, 35660-35667.

  6. Abascal, F., Corpet, A., Gurard-Levin, Z. A., Juan, D., Ochsenbein, F., Rico, D., Valencia, A., and Almouzni, G. (2013) Subfunctionalization Via Adaptive Evolution Influenced by Genomic Context: The Case of Histone Chaperones ASF1a and ASF1b. Mol Biol Evol. 30, 1853-1866.

  7. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., and Richmond, T. J. (1997) Crystal Structure of the Nucleosome Core Particle at 2.8 A Resolution. Nature. 389, 251-260.

  8. Burgess, R. J., and Zhang, Z. (2013) Histone Chaperones in Nucleosome Assembly and Human Disease. Nat Struct Mol Biol. 20, 14-22.

  9. Laskey, R. A., Honda, B. M., Mills, A. D., and Finch, J. T. (1978) Nucleosomes are Assembled by an Acidic Protein which Binds Histones and Transfers them to DNA. Nature. 275, 416-420.

  10. Mattiroli, F., D'Arcy, S., and Luger, K. (2015) The Right Place at the Right Time: Chaperoning Core Histone Variants. EMBO Rep. 16, 1454-1466.

  11. Munakata, T., Adachi, N., Yokoyama, N., Kuzuhara, T., and Horikoshi, M. (2000) A Human Homologue of Yeast Anti-Silencing Factor has Histone Chaperone Activity. Genes Cells. 5, 221-233.

  12. Tagami, H., Ray-Gallet, D., Almouzni, G., and Nakatani, Y. (2004) Histone H3.1 and H3.3 Complexes Mediate Nucleosome Assembly Pathways Dependent Or Independent of DNA Synthesis. Cell. 116, 51-61.

  13. Nakatani, Y., Ray-Gallet, D., Quivy, J. P., Tagami, H., and Almouzni, G. (2004) Two Distinct Nucleosome Assembly Pathways: Dependent Or Independent of DNA Synthesis Promoted by Histone H3.1 and H3.3 Complexes. Cold Spring Harb Symp Quant Biol. 69, 273-280.

  14. English, C. M., Maluf, N. K., Tripet, B., Churchill, M. E., and Tyler, J. K. (2005) ASF1 Binds to a Heterodimer of Histones H3 and H4: A Two-Step Mechanism for the Assembly of the H3-H4 Heterotetramer on DNA. Biochemistry. 44, 13673-13682.

  15. Mello, J. A., Sillje, H. H., Roche, D. M., Kirschner, D. B., Nigg, E. A., and Almouzni, G. (2002) Human Asf1 and CAF-1 Interact and Synergize in a Repair-Coupled Nucleosome Assembly Pathway. EMBO Rep. 3, 329-334.

  16. Tyler, J. K., Collins, K. A., Prasad-Sinha, J., Amiott, E., Bulger, M., Harte, P. J., Kobayashi, R., and Kadonaga, J. T. (2001) Interaction between the Drosophila CAF-1 and ASF1 Chromatin Assembly Factors. Mol Cell Biol. 21, 6574-6584.

  17. Green, E. M., Antczak, A. J., Bailey, A. O., Franco, A. A., Wu, K. J., Yates, J. R.,3rd, and Kaufman, P. D. (2005) Replication-Independent Histone Deposition by the HIR Complex and Asf1. Curr Biol. 15, 2044-2049.

  18. Loyola, A., and Almouzni, G. (2004) Histone Chaperones, a Supporting Role in the Limelight. Biochim Biophys Acta. 1677, 3-11.

  19. Groth, A., Ray-Gallet, D., Quivy, J. P., Lukas, J., Bartek, J., and Almouzni, G. (2005) Human Asf1 Regulates the Flow of S Phase Histones during Replicational Stress. Mol Cell. 17, 301-311.

  20. Messiaen, S., Guiard, J., Aigueperse, C., Fliniaux, I., Tourpin, S., Barroca, V., Allemand, I., Fouchet, P., Livera, G., and Vernet, M. (2016) Loss of the Histone Chaperone ASF1B Reduces Female Reproductive Capacity in Mice. Reproduction. 151, 477-489.