Phenotypic Mutation 'patriot3' (pdf version)
Allelepatriot3
Mutation Type nonsense
Chromosome11
Coordinate60,670,696 bp (GRCm39)
Base Change C ⇒ T (forward strand)
Gene Smcr8
Gene Name Smith-Magenis syndrome chromosome region, candidate 8 homolog (human)
Synonym(s) 2310076G09Rik, D030073L15Rik
Chromosomal Location 60,668,351-60,679,113 bp (+) (GRCm39)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts homozygous for a knock-out allele show impaired autophagy induction, a reduced autophagic flux, and abnormal expression of lysosomal enzymes. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001085440, NM_175491; MGI:2444720

MappedYes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000055926] [ENSMUSP00000099728]
AlphaFold Q3UMB5
SMART Domains Protein: ENSMUSP00000055926
Gene: ENSMUSG00000049323
AA Change: Q615*

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 78 262 5e-12 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000099728
Gene: ENSMUSG00000049323
AA Change: Q615*

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 87 255 8e-10 PFAM
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (other)(1) Gene trapped(5) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Smcr8 APN 11 60669458 splice site probably null
IGL00514:Smcr8 APN 11 60669193 nonsense probably null
IGL01563:Smcr8 APN 11 60674671 missense possibly damaging 0.55
IGL01650:Smcr8 APN 11 60669010 missense probably damaging 1.00
IGL02390:Smcr8 APN 11 60670548 missense probably benign 0.03
IGL02582:Smcr8 APN 11 60669721 missense probably benign 0.00
IGL03008:Smcr8 APN 11 60669287 missense probably damaging 1.00
IGL03286:Smcr8 APN 11 60668853 unclassified probably benign
chauvenist UTSW 11 60669424 missense probably damaging 1.00
liberta UTSW 11 60669269 missense probably damaging 1.00
patriot UTSW 11 60668858 missense probably damaging 1.00
patriot2 UTSW 11 60668854 start codon destroyed probably null 1.00
R0022:Smcr8 UTSW 11 60671185 missense probably damaging 1.00
R0022:Smcr8 UTSW 11 60671185 missense probably damaging 1.00
R0197:Smcr8 UTSW 11 60668941 missense probably damaging 1.00
R0333:Smcr8 UTSW 11 60671048 missense possibly damaging 0.96
R0346:Smcr8 UTSW 11 60670576 missense probably benign 0.00
R0701:Smcr8 UTSW 11 60668941 missense probably damaging 1.00
R0720:Smcr8 UTSW 11 60669269 missense probably damaging 1.00
R0883:Smcr8 UTSW 11 60668941 missense probably damaging 1.00
R1178:Smcr8 UTSW 11 60670358 missense probably damaging 1.00
R1418:Smcr8 UTSW 11 60668858 missense probably damaging 1.00
R2012:Smcr8 UTSW 11 60669010 missense probably damaging 1.00
R3690:Smcr8 UTSW 11 60668854 start codon destroyed probably null 1.00
R3767:Smcr8 UTSW 11 60670330 missense probably benign 0.30
R4801:Smcr8 UTSW 11 60669436 splice site probably null
R4802:Smcr8 UTSW 11 60669436 splice site probably null
R4862:Smcr8 UTSW 11 60668897 missense probably benign 0.01
R5108:Smcr8 UTSW 11 60670696 nonsense probably null
R5361:Smcr8 UTSW 11 60669118 missense probably damaging 1.00
R5745:Smcr8 UTSW 11 60674977 missense probably benign 0.00
R5806:Smcr8 UTSW 11 60671208 critical splice donor site probably null
R6041:Smcr8 UTSW 11 60670394 missense probably damaging 1.00
R6277:Smcr8 UTSW 11 60669635 missense probably benign 0.07
R6289:Smcr8 UTSW 11 60669424 missense probably damaging 1.00
R6445:Smcr8 UTSW 11 60669841 missense possibly damaging 0.95
R6826:Smcr8 UTSW 11 60669688 missense possibly damaging 0.85
R7062:Smcr8 UTSW 11 60671180 missense probably damaging 1.00
R7176:Smcr8 UTSW 11 60669772 missense probably damaging 1.00
R7516:Smcr8 UTSW 11 60670814 missense probably benign 0.01
R7848:Smcr8 UTSW 11 60670750 missense probably benign
R8487:Smcr8 UTSW 11 60674822 missense probably damaging 0.98
R8552:Smcr8 UTSW 11 60670979 missense probably damaging 1.00
R8717:Smcr8 UTSW 11 60670254 missense probably damaging 1.00
R9204:Smcr8 UTSW 11 60668857 missense probably damaging 1.00
R9218:Smcr8 UTSW 11 60670705 missense probably benign
Z1186:Smcr8 UTSW 11 60670699 missense probably benign
Z1186:Smcr8 UTSW 11 60669932 missense probably benign
Z1186:Smcr8 UTSW 11 60668806 unclassified probably benign
Z1187:Smcr8 UTSW 11 60670699 missense probably benign
Z1187:Smcr8 UTSW 11 60669932 missense probably benign
Z1187:Smcr8 UTSW 11 60668806 unclassified probably benign
Z1188:Smcr8 UTSW 11 60670699 missense probably benign
Z1188:Smcr8 UTSW 11 60669932 missense probably benign
Z1188:Smcr8 UTSW 11 60668806 unclassified probably benign
Z1189:Smcr8 UTSW 11 60670699 missense probably benign
Z1189:Smcr8 UTSW 11 60669932 missense probably benign
Z1189:Smcr8 UTSW 11 60668806 unclassified probably benign
Z1190:Smcr8 UTSW 11 60670699 missense probably benign
Z1190:Smcr8 UTSW 11 60669932 missense probably benign
Z1190:Smcr8 UTSW 11 60668806 unclassified probably benign
Z1191:Smcr8 UTSW 11 60670699 missense probably benign
Z1191:Smcr8 UTSW 11 60669932 missense probably benign
Z1191:Smcr8 UTSW 11 60668806 unclassified probably benign
Z1192:Smcr8 UTSW 11 60670699 missense probably benign
Z1192:Smcr8 UTSW 11 60669932 missense probably benign
Z1192:Smcr8 UTSW 11 60668806 unclassified probably benign
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:40 PM by Anne Murray
Record Created 2017-05-31 4:45 PM
Record Posted 2019-01-07
Phenotypic Description
Figure 1. Patriot3 mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Patriot3 mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The patriot3 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5108, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) after DSS exposure.

Nature of Mutation

Figure 3. Linkage mapping of the DSS susceptibility phenotype at day 10 post-DSS treatment using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 74 mutations (X-axis) identified in the G1 male of pedigree R5108. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 74 mutations. The DSS susceptibility phenotype was linked by continuous variable mapping to a mutation in Smcr8: a C to T transition at base pair 60,779,870 (v38) on chromosome 11, or base pair 2,346 in the GenBank genomic region NC_000077 encoding Smcr8. The strongest association was found with a recessive model of inheritance to the DSS susceptibility phenotype at day 10, wherein six variant homozygotes departed phenotypically from 18 homozygous reference mice and 41 heterozygous mice with a P value of 3.043 x 10-6 (Figure 3).  

The mutation corresponds to residue 2,346 in the mRNA sequence NM_001085440 within exon 1 of 2 total exons.

2331 GTGAGCATTCCCCCACAGCGCTACATACAGAAG
610  -V--S--I--P--P--Q--R--Y--I--Q--K-
 

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 615 for a premature stop codon (Q615*) in the SMCR8 protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. Domain organization of SMCR8. The patriot3 mutation results in substitution of glutamine 615 for a premature stop codon. This image is interactive. Other mutations found in SMCR8 are noted in red. Click on each mutation for more information.

Smcr8 encodes SMCR8 (Smith-Magenis syndrome chromosome region, candidate 8). SMCR8 is a homolog of the DENN module, which is GDP-GTP exchange factor for Rab GTPases (1). The DENN module and SMCR8 both have an N-terminal longin (alternatively, u-DENN) domain, a DENN domain, and a d-DENN domain (Figure 4). The longin domain mediates interaction with GTPases (2) and has a PAS domain-like fold similar to ligand-binding domains (3).

The patriot3 mutation results in substitution of glutamine 615 for a premature stop codon (Q615*); Q615 is within the central DENN domain.

Please see the record patriot for more information about Smcr8.

Putative Mechanism

SMCR8 interacts with C9ORF72 and WDR41 (see the record for gogi) to form the SWC (SMCR8-WDR41-C9ORF72) tripartite complex (4). The SWC complex functions as a GDP-GTP exchange factor for the small GTPases RAB8A and RAB39B, which function in vesicle trafficking and autophagy (5-9). After TBK1-mediated phosphorylation of SMCR8, the SWC complex interacts with the autophagy initiation complex ULK1/FIP200/autophagy-related protein 13 (ATG13)/ATG101 via C9ORF72 binding (5;6;8). The interaction between the SWC complex and the ULK1 complex regulates the expression and activity of ULK1 (8;9). Knockout of SMCR8 or C9ORF72 resulted in enlarged lysosome vesicles, while SMCR8 knockout alone showed accumulation of lysosomes and lysosomal enzymes as well as impaired autophagy induction (5-8;10). Mouse embryonic fibroblasts from Smcr8-deficient (Smcr8-/-) mice exhibited abnormal autophagy as well as a block in lysosomal degradation (MGI; accessed August 17, 2017).

Smcr8-/- and SMCR8-mutant (Smcr8I2T/I2T) showed increased TNF production in response to the TLR9 ligand CpG (11). The Smcr8-/- and Smcr8I2T/I2T mice also showed increased TNF responses and IL-6 production in response to stimulation with TLR7 and TLR3 ligands; TNF production was normal in response to TLR2 or TLR4 stimulation. Taken together, loss of SMCR8 function results in aberrant activation of endosomal TLRs. The defects in TLR9-associated signaling is proposed to be caused by defects in the SWC complex due to loss of SMCR8-assocated function (11). Loss of SWC complex function causes defects in lysosome and phagosome maturation, resulting in protracted TLR stimulation. Smcr8-/- and Smcr8I2T/I2T mice also showed splenomegaly and lymphadenopathy at 9 and 12 months of age (11). The mice showed normal numbers of macrophages, monocytes, neutrophils, B cells, and T cells in the peripheral blood; however, the percentages of naïve CD4+ and CD8+ T cells was reduced and the percentages of activated CD4+ and CD8+ T cells was increased (11). The mice also showed increased plasma levels of the cytokine IL-12p40 compared to wild-type mice (11). Smcr8-/- macrophages showed an accumulation of putative lysosomes. Similar to the patriot mice the Smcr8-/- and Smcr8I2T/I2T mice showed susceptibility to DSS treatment. Smcr8-/- mice also exhibited autoimmunity and increased lysosomal exocytosis in macrophages (4).

The colitis phenotype observed in the patriot3 mice is putatively caused by defects in endosomal TLR signaling; the endosomal TLRs are required for protection in colitis.

Primers PCR Primer
patriot3_pcr_F: CCTATGCGGATAATGAGGGG
patriot3_pcr_R: ACTGCCCATGTAGCTAGTGG

Sequencing Primer
patriot3_seq_F: ATAATGAGGGGGCCATCCATTTCC
patriot3_seq_R: GTATCCGAGTAGTTATCCAGGCTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 401 nucleotides is amplified (chromosome 11, + strand):


1   cctatgcgga taatgagggg gccatccatt tccaggcaag tgccggctca ccagaaccgg
61  atgagactca ggagggcaac ttggaaaata tcccatccca aatagactcc agctgctgta
121 ttggaaagga gagtgaaggt cacttggtgc ctctcccaac cccagcctac actctttctg
181 atgaggacag tgtggtgagc attcccccac agcgctacat acagaaggac caggggctcc
241 acgtggactt cggagtggaa aacactgacc cttctccccg agacaacagt tgtgaaatgt
301 tcccagctta tgagctggat ccaagctgcc ttctggctag ccgagatgtt agtaagatga
361 gcctggataa ctactcggat accactagct acatgggcag t


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsWilliam McAlpine, Braden Hayse, Emre Turer, and Bruce Beutler