Phenotypic Mutation 'bemr3'

• Allele: bemr3
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 115,912,092 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Rho
• Gene Name: rhodopsin
• Synonym(s): opsin 2, Noerg1, Rod Opsin, Long Wavelength Sensitive opsin, LWS opsin, L opsin, Red Opsin, Ops, RP4, Opn2
• Chromosomal Location: 115,908,709-115,916,997 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Targeted null homozygotes fail to develop retinal rod outer segments and lose their photoreceptors while heterozygotes exhibit some disorganization of their photoreceptors and a shortening of the outer segments with age. Some point mutants have only light-induced photoreceptor degeneration. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P15409
• SMART Domains: Protein: ENSMUSP00000032471; Gene: ENSMUSG00000030324; AA Change: C185R

Domain	Start	End	E-Value	Type
Pfam:Rhodopsin_N	2	37	1e-23	PFAM
Pfam:7TM_GPCR_Srv	40	323	1.2e-12	PFAM
Pfam:7TM_GPCR_Srw	42	324	7.9e-12	PFAM
Pfam:7TM_GPCR_Srsx	48	321	4.9e-11	PFAM
Pfam:7tm_1	54	306	5.1e-49	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000032471)
• SMART Domains: Protein: ENSMUSP00000144952; Gene: ENSMUSG00000030324; AA Change: C26R

Domain	Start	End	E-Value	Type
Pfam:7tm_1	6	147	1.6e-17	PFAM
Pfam:7TM_GPCR_Srw	19	165	1.2e-8	PFAM
Pfam:7TM_GPCR_Srsx	25	162	1.2e-4	PFAM
Pfam:7TM_GPCR_Srv	29	164	7.3e-7	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
  (Using ENSMUST00000203877)
• SMART Domains: Protein: ENSMUSP00000145464; Gene: ENSMUSG00000030324

Domain	Start	End	E-Value	Type
low complexity region	20	41	N/A	INTRINSIC
low complexity region	48	54	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000144768; Gene: ENSMUSG00000030324; AA Change: C43R

Domain	Start	End	E-Value	Type
Pfam:7tm_1	1	164	4.1e-24	PFAM
Pfam:7TM_GPCR_Srw	11	182	5.4e-9	PFAM
Pfam:7TM_GPCR_Srv	13	181	1.6e-7	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000204711)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.116)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: None
• Last Updated: 2018-11-01 3:58 PM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2009-10-16
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Haiquan Liu, Xin Du, Bruce Beutler, Xiaohua Gong

Accession Number

NCBI RefSeq: NM_145383; MGI: 97914

Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(4) Targeted, other(4) Chemically induced(1)

Repository

Please contact Dr. Xioahua Gong, University of California at Berkeley

Phenotypic Description

The Bemr3 (R3) mutation was first identified in a fundus screen of G1 mice born to ENU-mutagenized sires. For fundus examination, mouse pupils were dilated with a mixture of 1% atropine and 1% phenylephrine and the fundus examined with an indirect opthalmoscope. The founder G1 R3 male mouse displayed attenuated retinal vessels and unevenly distributed pigment patches, phenotypes that are typical of retinal degeneration (RD) (1). 

 

The R3 mutation causes dominant RD with rapid disease progression, but the RD phenotype is more severe in homozygous animals. Electroretinograms demonstrated a severely reduced photoreceptor cell function in both heterozygote and homozygote animals, with greater reduction of function in R3/R3 mice. Retinal histology showed a rapid loss of the outer nuclear layer (ONL) for both homozygous and heterozygous R3 mice. By postnatal day (P) 18, the ONL layer of homozygous mice is reduced to a single row of photoreceptors consisting of only cone cells, while the ONL in heterozygotes is reduced by 50%. Animals with one R3 allele and one null allele for rhodopsin had an intermediate rate of ONL loss when compared to R3/+ and R3/R3 mutant mice. Examination of the ultrastructure of mutant and wild-type retinas by transmission electron microscopy showed that R3/+ mice displayed short outer segments with disorganized discs. No outer segments or discs could be seen in homozygous animals by P7. Apoptotic cells were prevalent in the ONL of R3/R3 retinas. 

 

The mutant rhodopsin protein produced from the R3 allele accumulates in the photoreceptor inner segments and/or cell bodies at P14, instead of trafficking to the photoreceptor outer segments. Mislocalization of cone opsins also occurred in homozygous R3 mice. The level of mutant protein was reduced in both homozygous and heterozygous retinas, with a more severe reduction in R3/R3 animals.

Nature of Mutation

The R3 mutation was mapped to Chromosome 6, and corresponds to a T to C transition at position 631 of the Rho cDNA, in exon 3 of 5 total exons.

 

538 CCTGAGGGCATGCAATGTTCATGCGGGATTGAC

180 -P--E--G--M--Q--C--S--C--G--I--D-

 

The mutated nucleotide is indicated in red lettering, and results in a cysteine to arginine substitution at amino acid 185 of the rhodopsin protein.

Protein Prediction

Rhodopsin, also known as visual purple, is the photoreceptor molecule from retinal rod cells, responsible for both the formation of rod photoreceptor cells, and the perception of low-intensity light (2-5). Rhodopsin belongs to the G-protein coupled receptor (GPCR) family and consists of a protein with seven transmembrane helices covalently bound to the photoreactive chromophore, retinal, in a central pocket. Isomerization of 11-cis-retinal into all-trans-retinal by light induces a conformational change in the opsin that activates an associated guanine nucleotide-binding (G) protein and triggers a second messenger cascade known as phototransduction (please see Background for more details) (4;5). 

 

GPCRs are the largest superfamily of proteins known, and consist of seven transmembrane-spanning α-helices connected by alternating intracellular (C-) and extracellular (E-) loops. The N-terminus is located on the extracellular side and the C-terminus on the intracellular side (5). In the case of rhodopsin, the extracellular loops are located in the intradiscal spaces of rod photoreceptors (4). In vertebrates, three major GPCR subfamilies exist known as the class A, class B, and class C receptors. Rhodopsin, along with adrenergic and adenosine receptors, belongs to the class A subfamily, which are characterized by a highly conserved (E/D)RY motif at the cytoplasmic end of the third transmembrane helix (TM3) (5). Many GPCRs also contain an NPXXY motif located in the TM7, and a stabilizing Cys-Cys disulfide bond (6). The rhodopsin protein family contains several closely related opsins in animals. Humans have four photopsins that regulate color vision and differ from each other by only a few amino acids and by the wavelengths of light that they absorb most strongly (7) (please see Background for more details).

 

The structure of rhodopsin has been studied in detail by X-ray crystallography (8-10), atomic force microscopy (AFM) (11;12), electron microscopy, and nuclear magnetic resonance (NMR) [reviewed by (5;6;13)] (Figure 1).  The chromophore 11-cis-retinal is bound to the receptor at Lys-296 through a protonated Schiff base, which is stabilized by the negatively charged counterion Glu-113 in TM3 (14). In the dark, the β-ionone ring of the retinal appears to be crosslinked to Trp-265 in TM7 (15). The retinal binding pocket is further stabilized by the presence of surrounding polar residues including Tyr-43, Met-44, and Leu-47 in TM1, Thr-94 in TM2, and Phe-293 and Phe-294 in TM7, which help position the Lys-296 side chain (8;9) The crystal structure of inactivated rhodopsin reveals a compact arrangement of the intradiscal portions of the protein, with the second intradiscal loop forming a plug over the retinal binding pocket. Here, Cys-187 forms the stabilizing disulfide bond typical of GPCRs with Cys-110 near the extracellular surface of TM3 (16). The cytoplasmic portion of the protein is not highly organized, except for a helical region, helix 8 (H8) that lies almost perpendicular to the C-terminal end of TM7. H8 is achored to the membrane via palmitoyl chains attached to Cys-232 and Cys-323. Absence of these palmitoyl chains was shown to destabilize the C-terminal end of the receptor and inhibit subsequent signal transduction (17). The TM helices contain several conserved amino acids that appear to form important contacts for maintaining the inactive state of rhodopsin. These include Asn-55 in TM1, Asn-78 and Asp-83 in TM2, Asn-302, Pro-303, and Tyr-306 in TM7 (part of the NPPY motif) [reviewed in (4)]. Conserved residues from the NPXXY motif stabilize the cytoplasmic domain (8;9;18), while Arg-135 from the (E/D)RY motif interacts with Glu-134, as well as Glu-247 and Thr-251 at the cytoplasmic end of TM6 (8). Low-affinity zinc binding sites in the intradiscal regions involving His-100 and His-195 are also implicated in rhodopsin stabilization (19).  

 

During phototransduction, rhodopsin undergoes several conformational changes, ultimately transforming the receptor from an inactive to an active signaling state. The photointermediates of rhodopsin are known as photorhodopsin, bathorhodopsin, which thermally relaxes to the blue shifted intermediate bathorhodopsin or BSI, followed by lumirhodopsin and then metarhodopsin I (MI). The activated form of rhodopsin is known as metarhodopsin II (MII or R*). In MI, retinal remains bound to opsin. During the MI to MII transition, the Schiff base proton is transferred from retinal to the Glu-113 counterion, and MII decays to form free all-trans-retinal and opsin. Both MI and MII states can exist in two forms (a and b), in a pH-dependent equilibrium. MIIb is the only form capable of signaling, and requires the protonation of Glu-134 present in the (E/D)RY motif (4;5;20). Of these rhodopsin photointermediates, bathorhodopsin (21), lumirhodopsin (22), MI (23), a form resembling MII (24), and chromophore-free opsin have been structurally determined. The structural differences between most rhodopsin forms are small, but are necessary to transfer the stored photon energy from the bound retinal to the surrounding opsin (5). During these changes, the retinal ionone ring flips over and becomes crosslinked to Ala-169 in TM4, triggering changes the cytoplasmic membrane loops that interact with signaling molecules (15). The transformation from MI to MII primarily causes relaxation of the third cytoplasmic loop prior to the release of retinal from the binding pocket (24). Crystallization of opsin revealed the presence of two openings in the retinal-binding site, suggesting different retinal entrance and exit routes (25;26).

 

Rhodopsin contains two N-linked oligosaccharides in the N-terminus attached to Asn-2 and Asn-15, but the significance of these is unknown (4). The C-terminus of rhodopsin, particularly the final five amino acids QVAPA, is critical for proper protein trafficking to photoreceptor discs by binding and recruiting the small GTPase ARF4, which is necessary for vesicle budding (27;28). Phosphorylation sites present in the C-terminus domain have been shown to be necessary for rhodopsin deactivation (29).   

 

In rod photoreceptor discs, rhodopsin molecules dimerize and form paracrystalline arrays (11;12). The dimeric interface between two rhodopsin molecules is the strongest interaction and is believed to be between TM4 of one rhodopsin protein and TM5 of another (6;30). The dimeric interface may also involve interactions between TM1 and TM2, and the cytoplasmic helix, H8 (24). 

 

During the phototransduction cycle, rhodopsin binds to various proteins. These include the retinal G protein transducin (25;31), the rhodopsin kinase (RK, RHOK or GRK1), arrestin, which strongly binds phosphorylated, activated rhodopsin to block signaling via transducin, and protein phosphatase 2 A (PP2A), which dephosphorylates retinal-free opsin and prepares it for binding to 11-cis-retinal (13). The organization of rhodopsin dimers into higher order oligomers is important for these interactions and is necessary for efficient signal transduction (32). The presence of phospholipids in the membrane is also needed for the proper formation, stability, and function of these complexes (33). For more details concerning the phototransduction cycle, please see Background [reviewed by (13)].

 

The R3 mutation results in substitution of a cysteine for an arginine at amino acid 185 of rhodopsin. This residue is located in the second intradiscal loop (E-II) between TM4 and TM5.

Expression/Localization

Rhodopsin is first expressed in postmitotic, differentiated rod photoreceptor cells after birth in mammals (34), and is localized to the disk membranes found in the rod outer segments (ROS). Rhodopsin is the most abundantly expressed protein in these membranes, accounting for 90% of the total membrane protein in the disks and occupying roughly 50% of the disk surface area (4;6).  

Background

The retina consists of highly specialized, multilayered neuronal tissues that function to perceive and process light signals. The retinal pigment epithelium (RPE) contains parts of the retinoid acid cycle and is involved in the continuous regeneration of visual pigments. The outer nuclear layer (ONL) of the retina contains the rod and cone photoreceptor nuclei responsible for vision. The cells of the inner nuclear layer (INL) are responsible for trophic support, signal processing, and signal transmission to the ganglion cell layer. Axons of ganglion cells form the optic nerve, which transmits visual information to the brain (35). The photoreceptor cells are specialized neurons that absorb photons from the field of view and signal this information through a change in membrane potential. Photoreceptors use the aldehyde of Vitamin A1, 11-cis-retinal, as the light-absorbing chromophore bound to opsins that are able to sense different types of light. Cone opsins are low-sensitivity, high-acuity opsins found in cone photoreceptors, while rhodopsin is a high-sensitivity, low-acuity opsin that is very sensitive to low levels of light and is used in night vision. Rhodopsin is most sensitive to wavelengths of light around 498 nm (green-blue), and is completely insensitive to wavelengths longer than about 640 nm (red). The number and ratio of rods to cones varies among species, dependent on whether an animal is primarily diurnal or nocturnal (7).

 

Figure 2. The phototransduction cycle in rod cells. In the dark, opsin is bound to 11-cis-retinal to form inactive rhodopsin (R) in the disc membranes. Basal activity of the guanylyl cyclase (GC) keeps cGMP levels high. The binding of Ca²⁺-bound calmodulin (CaM) confers high affinity for cGMP to cGMP-gated channels in the plasma membrane, allowing these channels to remain open. Both Na⁺ and Ca²⁺ enter the channels resulting in high Ca²⁺ levels and Ca²⁺-bound guanylate cyclase-activating protein (GCAP). Light (hv) results in photoisomerization of 11-cis-retinal to all-trans-retinal, forming activated rhodopsin (R^*), which binds and activates the heterotrimeric G protein, transducin (αβγ). The GTP-bound transducin α subunit activates cGMP phosphodiesterase (PDE), which hydrolyzes cGMP to GMP, reducing the cGMP concentration and the binding of cGMP to the cGMP-gated channels. The probability of channel closing increases proportional to light intensity, reducing Ca²⁺ influx. Intracellular Ca²⁺ is further depleted by activity of the Na⁺-Ca²⁺, K⁺ exchanger. Low intracellular Ca²⁺ leads to active GCAP, which in turn activates GC to synthesize cGMP from GTP supplied by the guanine nucleotide cycle. This comprises guanylate kinase (GK) and nucleoside diphosphate kinase (NDPK). Release of Ca²⁺ from CaM leads to its dissociation from the cGMP-gated channels conferring a lower affinity from cGMP and further closure of the channels. This image is interactive. Other mutations found in the pathway are noted in red. Click on each mutation for more information.

 

Both rod and cone cells have the same basic structure with an axon terminal located closest to the visual field, an organelle containing cell body, followed by a mitochondrial-rich inner segment and finally the outer segment, which contains the light-absorbing materials (Figure 2). The axon terminal forms a synapse with another neuron and releases neurotransmitters. The chief function of the inner segment is to provide ATP for the sodium-potassium pump that maintains the cell membrane potential. The outer segments are modified cilia that contain disks filled with opsin, as well as voltage-gated sodium channels. Rod cells differ from cone cells not only in the type of opsin they contain, but also in the amount of opsin as the sensitivity of rod cells to light is provided in part by the large amounts of rhodopsin they contain in their outer segments. In addition to being more sensitive to light than cone cells, rod cells respond more slowly to light (36). 

 

Visual phototransduction is a process by which light is converted into electrical signals in the rod cells, cone cells and photosensitive ganglion cells in the retina. This process is initiated by the absorption of photons and isomerization of 11-cis-retinal into all-trans-retinal, resulting in rhodopsin activation (Figure 2). The first step of the phototransduction cascade is the transitory binding of photoactivated rhodopsin (Rho*) and transducin, a heterotrimeric G protein that alternates between an inactive guanosine diphosphate (GDP) and an active guanosine triphosphate (GTP) bound state. The GDP form of transducin docks onto the Rho* surface, and GDP then dissociates from the complex allowing GTP to bind to transducin. GTP-bound transducin then dissociates from Rho*, interacts with the γ subunits of the cyclic GMP (cGMP) phosphodiesterase PDE6, which activates the catalytic α or β subunits and results in hydrolysis of cGMP. Depletion of cGMP in the ROS results in closure of cGMP-gated channels in the plasma membrane and hyperpolarization of the photoreceptor cell, which prevents the release of neurotransmitters. Once activated, rhodopsin can activate hundreds of transducin molecules, each of which in turn activate a phosphodiesterase molecule, which can break down over a thousand cGMP molecules per second (4;13;37).  

 

Rods make use of several inhibitory mechanisms to allow rapid reversion to the resting state after a flash of light. The rhodopsin kinase (RK) phosphorylates Rho* C-terminal serines, partially inhibiting the activation of transducin. Arrestin is then able to bind the phosphorylated rhodopsin, further inhibiting its activity by preventing transducin binding and promoting receptor internalization via a clathrin-dependent endocytosis pathway. The rate of rhodopsin phosphorylation is regulated by a Ca²⁺-binding protein, recoverin (Rec), which binds to and inhibits RK at high Ca²⁺ levels. While arrestin shuts off rhodopsin, the intrinsic GTPase activity of the GTP-form of transducin is enhanced by the interaction with PDE6γ, and the GTPase accelerator protein (RGS9-1-Gβ5L) and its anchor protein R9AP. In addition, hyperpolarization of the rod cell results in continuous function of the plasma membrane Na⁺-Ca²⁺, K⁺ exchanger, which causes Ca²⁺ depletion and results in activation of the Ca²⁺-binding guanylate cyclase activating protein (GCAP). In turn, GCAP activates GC allowing the accelerated synthesis of cGMP from GTP supplied by the guanine nucleotide cycle (4;13;37).  

 

Retinol metabolism also plays an essential role in the proper functioning of photoreceptors. Following isomerization and release from opsin, all-trans-retinal is reduced to all-trans-retinol and is transported back to the RPE where it is converted back to 11-cis-retinal, a process that involves esterification by lecithin-retinol acyltransferase (LRAT) followed by isomerase activity of the isomerohydrolase RPE65 (37).

 

Rhodopsin not only mediates phototransduction in rod photoreceptors, it is also necessary for their proper formation as the absence of rhodopsin prevents the formation of ROS and leads to photoreceptor loss (2;3). Rhodopsin is expressed in terminally differentiated rod photoreceptor cells under the control of two transcription factors, the neural retina leucine zipper (NRL) and the paired-type homeodomain protein Crx (34). ROS formation and renewal in rod photoreceptors is mediated by the polarized sorting of rhodopsin and associated proteins and lipids, in post-Golgi vesicles that bud from the Golgi and fuse with the plasma membrane near the cilium that connects the inner segment and the ROS. In addition to the small GTPase, ARF4, this process requires several members of the Rab family of small GTPases including Rab6, Rab8, Rab3A, and Rab11 [reviewed by (38)].

 

Rhodopsin mutations are an important cause of the retinal degeneration disease, retinitis pigmentosa (RP; OMIM +180380) with over 140 mutations found giving rise to approximately 10% of human RP cases. Symptoms include night blindness, the development of tunnel vision, and an accumulation of retinal pigment-like deposits (39). Rhodopsin mutations can cause both dominant and recessive forms of the disease with a wide range of clinical phenotypes observed even amongst individuals carrying the same mutation (40). Mutation-induced rod cell death is followed by secondary cone cell death. The degeneration of both rods and cones results in tertiary degeneration of inner retina neurons (35). Mutations in 40 genes are now known to cause RP (http://www.sph.uth.tmc.edu/Retnet/home.htm), and their gene products have roles in diverse cellular processes including phototransduction, retinol metabolism, intercellular transport, transcription and support of photoreceptor structures (39). Some of the factors involved include the rhodopsin kinase, subunits of the cGMP-gated cation channel, proteins involved in guanine nucleotide cycling and synthesis like GUCA1B and IMPDH1, PDE6, arrestin (OMIM +181031), NRL, CRX, semaphorin B (OMIM #610282), the scaffolding protein peripherin (PRPH2), which is implicated in ROS formation, LRAT, RPE65, retinol dehydrogenases like RDH12, the ATP-binding transporter ABCA4 involved in exporting byproducts of the retinoid cycle (OMIM #601718), proteins involved in the ubiquitin-proteasome pathway, proteins necessary for mitochondrial function, structural proteins, as well as a number of factors involved in splicing such as PRPF3 (OMIM #601414), PRPF8 (OMIM #600059), PRPF31 (OMIM #600138), RPGR, and SNRNP200. 

 

In addition to RP, mutations in rhodopsin also cause a dominant form of congenital stationary night blindness (CSNBAD1; OMIM #610445). Studies of the rhodopsin mutations causing these disorders, both in in vitro systems and in transgenic animal models, have led to the proposal of a variety of mechanisms that can cause disease (40). CSNB was suggested to result from the constitutive activation of rhodopsin, caused by mutations that disrupted the interaction between the retinal-binding Lys-296 and Glu-113 and facilitated proton transfer (14;40). Other studies suggested that abnormal and prolonged rhodopsin activation could lead to photoreceptor cell death and the generation of RP (41;42). It is likely that the milder CSNB phenotype is caused by mutations that can partially terminate signaling, thus slowing the rate of degeneration, while more severe mutations result in RP where prolonged rhodopsin activation triggers apoptotic cell death caused in part by a decrease in intracellular calcium (42). Many rhodopsin mutations lead to partial or complete misfolding of the protein with various functional consequences. These can include impaired retinal binding (41), the aggregation of misfolded protein with ubiquitin in inclusion bodies leading to disruption of cellular processes, and the activation of the unfolded protein response (UPR), endoplasmic reticulum (ER) stress and apoptosis of photoreceptor cells (43). The complete absence of rhodopsin, as seen in targeted mouse knockouts and mutations that lead to protein degradation, results in failure to form the ROS (2;3;44).  Mutations in the C-terminal tail affect post-Golgi trafficking, resulting in mislocalized rhodopsin (45). Activation of mislocalized rhodopsin is suggested to result in cell death (46). Some rhodopsin mutations lead to hyperphosphorylation of the protein and high affinity binding to arrestin, which damaged receptor-mediated endocytic functions (47). Interestingly, human eyes with age-related macular degeneration (ARMD; OMIM #153800) have a significant reduction in both arrestin and rhodopsin content (48).

 

Aside from phototransduction, rhodopsin is implicated in the phosphorylation of the insulin receptor (IR) in rod cells, subsequent activation of the phosphatidylinositol 3-kinase (PI3K) pathway resulting in cell survival. IR phosphorylation in rod cells is light-dependent and requires the presence of rhodopsin and the retinal chromophore, but is independent of the phototransduction pathway (49). Activation of survival pathways downstream of the IR play an important role in preventing cell death in response to light. 

Putative Mechanism

A previous study studying the effects of mutating Cys-185 to an alanine found no effect on the ability of the protein to fold properly in vivo (50). However, three-dimensional structural modeling of the amino acid alteration caused by the R3 mutation predicts that the large side chain of the substituted arginine residue disrupts the proper folding and assembly of the mutant rhodopsin protein, likely destabilizing the open-pocket binding conformation of rhodopsin and resulting in misfolded protein (1). The cysteine altered by the R3 mutation is highly conserved and located near one of the cysteines (Cys-187) involved in the conserved GPCR disulfide bond (16). Interestingly, many mutant rhodopsin proteins form a non-native disulfide bond between Cys-185, the residue altered by the R3 mutation, and Cys-187, thus altering the conformation of the retinal binding pocket (40).

 

Like R3, many rhodopsin mutations cause a dominant form of disease (40). Homozygous R3 mutant mice display a more severe retinal degeneration defect than mice with one R3 allele and one null allele. Heterozygous R3 animals with one wild type allele exhibit an even slower retinal degeneration. However, these animals still display complete rod loss by P42. The dominant nature of the defect suggests that the misfolded rhodopsin protein could be interfering with the trafficking of normal rhodopsin protein as well, and the accumulation of misfolded rhodopsin in the ER likely leads to the UPR response and photoreceptor cell death. 

Primers

Primers cannot be located by automatic search.

Genotyping

R3 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.  The same primers are used for both PCR and sequencing.

 

Primers

R3(F): 5’- AGCCATTCATGCTTATGTCC -3’

R3(R): 5’- ATGGCGTCTGTACGAACCCT -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

The following sequence of 330 nucleotides (from Genbank genomic region NC_000072f or linear genomic sequence of Rho) is amplified:

 

3111                                                        agccattcat

3121 gcttatgtcc agctgggcgt gtgttctctt cctgttttat catcccttgc gctgaccatc

3181 aggtacatcc ctgagggcat gcaatgttca tgcgggattg actactacac actcaagcct

3241 gaggtcaaca acgaatcctt tgtcatctac atgttcgtgg tccacttcac cattcctatg

3301 atcgtcatct tcttctgcta tgggcagctg gtcttcacag tcaaggaggt atgagcaggg

3361 gggccgcccc agcctcgtgc cgggtgggtg ggcagagcca ggtgggcaga gctgggtgcc

3421 agggttcgta cagacgccat

 

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

  1. Liu, H., Wang, M., Xia, C. H., Du, X., Flannery, J. G., Ridge, K. D., Beutler, B., and Gong, X. (2009) A Novel Rhodopsin Mutation Causes Severe Retinal Degeneration. Invest. Ophthalmol. Vis. Sci.

  2. Humphries, M. M., Rancourt, D., Farrar, G. J., Kenna, P., Hazel, M., Bush, R. A., Sieving, P. A., Sheils, D. M., McNally, N., Creighton, P., Erven, A., Boros, A., Gulya, K., Capecchi, M. R., and Humphries, P. (1997) Retinopathy Induced in Mice by Targeted Disruption of the Rhodopsin Gene. Nat. Genet. 15, 216-219.

  3. Gross, A. K., Decker, G., Chan, F., Sandoval, I. M., Wilson, J. H., and Wensel, T. G. (2006) Defective Development of Photoreceptor Membranes in a Mouse Model of Recessive Retinal Degeneration. Vision Res. 46, 4510-4518.

  4.Ridge, K. D., and Palczewski, K. (2007) Visual Rhodopsin Sees the Light: Structure and Mechanism of G Protein Signaling. J. Biol. Chem. 282, 9297-9301.

  5. Mustafi, D., and Palczewski, K. (2009) Topology of Class A G Protein-Coupled Receptors: Insights Gained from Crystal Structures of Rhodopsins, Adrenergic and Adenosine Receptors. Mol. Pharmacol. 75, 1-12.

  6. Fotiadis, D., Jastrzebska, B., Philippsen, A., Muller, D. J., Palczewski, K., and Engel, A. (2006) Structure of the Rhodopsin Dimer: A Working Model for G-Protein-Coupled Receptors. Curr. Opin. Struct. Biol. 16, 252-259.

  7. Terakita, A. (2005) The Opsins. Genome Biol. 6, 213.

  8. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and Miyano, M. (2000) Crystal Structure of Rhodopsin: A G Protein-Coupled Receptor. Science. 289, 739-745.

  9. Teller, D. C., Okada, T., Behnke, C. A., Palczewski, K., and Stenkamp, R. E. (2001) Advances in Determination of a High-Resolution Three-Dimensional Structure of Rhodopsin, a Model of G-Protein-Coupled Receptors (GPCRs). Biochemistry. 40, 7761-7772.

10. Okada, T., Fujiyoshi, Y., Silow, M., Navarro, J., Landau, E. M., and Shichida, Y. (2002) Functional Role of Internal Water Molecules in Rhodopsin Revealed by X-Ray Crystallography. Proc. Natl. Acad. Sci. U. S. A. 99, 5982-5987.

11. Fotiadis, D., Liang, Y., Filipek, S., Saperstein, D. A., Engel, A., and Palczewski, K. (2003) Atomic-Force Microscopy: Rhodopsin Dimers in Native Disc Membranes. Nature. 421, 127-128.

12. Liang, Y., Fotiadis, D., Filipek, S., Saperstein, D. A., Palczewski, K., and Engel, A. (2003) Organization of the G Protein-Coupled Receptors Rhodopsin and Opsin in Native Membranes. J. Biol. Chem. 278, 21655-21662.

13. Ridge, K. D., Abdulaev, N. G., Sousa, M., and Palczewski, K. (2003) Phototransduction: Crystal Clear. Trends Biochem. Sci. 28, 479-487.

14. Rao, V. R., Cohen, G. B., and Oprian, D. D. (1994) Rhodopsin Mutation G90D and a Molecular Mechanism for Congenital Night Blindness. Nature. 367, 639-642.

15. Borhan, B., Souto, M. L., Imai, H., Shichida, Y., and Nakanishi, K. (2000) Movement of Retinal Along the Visual Transduction Path. Science. 288, 2209-2212.

16. Karnik, S. S., and Khorana, H. G. (1990) Assembly of Functional Rhodopsin Requires a Disulfide Bond between Cysteine Residues 110 and 187. J. Biol. Chem. 265, 17520-17524.

17. Park, P. S., Sapra, K. T., Jastrzebska, B., Maeda, T., Maeda, A., Pulawski, W., Kono, M., Lem, J., Crouch, R. K., Filipek, S., Muller, D. J., and Palczewski, K. (2009) Modulation of Molecular Interactions and Function by Rhodopsin Palmitylation. Biochemistry. 48, 4294-4304.

18. Fritze, O., Filipek, S., Kuksa, V., Palczewski, K., Hofmann, K. P., and Ernst, O. P. (2003) Role of the Conserved NPxxY(x)5,6F Motif in the Rhodopsin Ground State and during Activation. Proc. Natl. Acad. Sci. U. S. A. 100, 2290-2295.

19. Gleim, S., Stojanovic, A., Arehart, E., Byington, D., and Hwa, J. (2009) Conserved Rhodopsin Intradiscal Structural Motifs Mediate Stabilization: Effects of Zinc (Dagger). Biochemistry.

20. Hofmann, K. P. (1999) Signalling States of Photoactivated Rhodopsin. Novartis Found. Symp. 224, 158-75; discussion 175-80.

21. Nakamichi, H., and Okada, T. (2006) Crystallographic Analysis of Primary Visual Photochemistry. Angew. Chem. Int. Ed Engl. 45, 4270-4273.

22. Nakamichi, H., and Okada, T. (2006) Local Peptide Movement in the Photoreaction Intermediate of Rhodopsin. Proc. Natl. Acad. Sci. U. S. A. 103, 12729-12734.

23. Ruprecht, J. J., Mielke, T., Vogel, R., Villa, C., and Schertler, G. F. (2004) Electron Crystallography Reveals the Structure of Metarhodopsin I. EMBO J. 23, 3609-3620.

24. Salom, D., Lodowski, D. T., Stenkamp, R. E., Le Trong, I., Golczak, M., Jastrzebska, B., Harris, T., Ballesteros, J. A., and Palczewski, K. (2006) Crystal Structure of a Photoactivated Deprotonated Intermediate of Rhodopsin. Proc. Natl. Acad. Sci. U. S. A. 103, 16123-16128.

25. Scheerer, P., Park, J. H., Hildebrand, P. W., Kim, Y. J., Krauss, N., Choe, H. W., Hofmann, K. P., and Ernst, O. P. (2008) Crystal Structure of Opsin in its G-Protein-Interacting Conformation. Nature. 455, 497-502.

26. Park, J. H., Scheerer, P., Hofmann, K. P., Choe, H. W., and Ernst, O. P. (2008) Crystal Structure of the Ligand-Free G-Protein-Coupled Receptor Opsin. Nature. 454, 183-187.

27. Deretic, D., Puleo-Scheppke, B., and Trippe, C. (1996) Cytoplasmic Domain of Rhodopsin is Essential for Post-Golgi Vesicle Formation in a Retinal Cell-Free System. J. Biol. Chem. 271, 2279-2286.

28. Deretic, D., Williams, A. H., Ransom, N., Morel, V., Hargrave, P. A., and Arendt, A. (2005) Rhodopsin C Terminus, the Site of Mutations Causing Retinal Disease, Regulates Trafficking by Binding to ADP-Ribosylation Factor 4 (ARF4). Proc. Natl. Acad. Sci. U. S. A. 102, 3301-3306.

29. Mendez, A., Burns, M. E., Roca, A., Lem, J., Wu, L. W., Simon, M. I., Baylor, D. A., and Chen, J. (2000) Rapid and Reproducible Deactivation of Rhodopsin Requires Multiple Phosphorylation Sites. Neuron. 28, 153-164.

30. Kota, P., Reeves, P. J., Rajbhandary, U. L., and Khorana, H. G. (2006) Opsin is Present as Dimers in COS1 Cells: Identification of Amino Acids at the Dimeric Interface. Proc. Natl. Acad. Sci. U. S. A. 103, 3054-3059.

31. Jastrzebska, B., Golczak, M., Fotiadis, D., Engel, A., and Palczewski, K. (2009) Isolation and Functional Characterization of a Stable Complex between Photoactivated Rhodopsin and the G Protein, Transducin. FASEB J. 23, 371-381.

32. Jastrzebska, B., Fotiadis, D., Jang, G. F., Stenkamp, R. E., Engel, A., and Palczewski, K. (2006) Functional and Structural Characterization of Rhodopsin Oligomers. J. Biol. Chem. 281, 11917-11922.

33. Jastrzebska, B., Goc, A., Golczak, M., and Palczewski, K. (2009) Phospholipids are Needed for the Proper Formation, Stability, and Function of the Photoactivated Rhodopsin-Transducin Complex. Biochemistry. 48, 5159-5170.

34. Morrow, E. M., Belliveau, M. J., and Cepko, C. L. (1998) Two Phases of Rod Photoreceptor Differentiation during Rat Retinal Development. J. Neurosci. 18, 3738-3748.

35. Sancho-Pelluz, J., Arango-Gonzalez, B., Kustermann, S., Romero, F. J., van Veen, T., Zrenner, E., Ekstrom, P., and Paquet-Durand, F. (2008) Photoreceptor Cell Death Mechanisms in Inherited Retinal Degeneration. Mol. Neurobiol. 38, 253-269.

36. Nickle, B., and Robinson, P. R. (2007) The Opsins of the Vertebrate Retina: Insights from Structural, Biochemical, and Evolutionary Studies. Cell Mol. Life Sci. 64, 2917-2932.

37. Cai, X., Conley, S. M., and Naash, M. I. (2009) RPE65: Role in the Visual Cycle, Human Retinal Disease, and Gene Therapy. Ophthalmic Genet. 30, 57-62.

38. Deretic, D. (2006) A Role for Rhodopsin in a Signal Transduction Cascade that Regulates Membrane Trafficking and Photoreceptor Polarity. Vision Res. 46, 4427-4433.

39. Hims, M. M., Diager, S. P., and Inglehearn, C. F. (2003) Retinitis Pigmentosa: Genes, Proteins and Prospects. Dev. Ophthalmol. 37, 109-125.

40. Garriga, P., and Manyosa, J. (2002) The Eye Photoreceptor Protein Rhodopsin. Structural Implications for Retinal Disease. FEBS Lett. 528, 17-22.

41. Andres, A., Garriga, P., and Manyosa, J. (2003) Altered Functionality in Rhodopsin Point Mutants Associated with Retinitis Pigmentosa. Biochem. Biophys. Res. Commun. 303, 294-301.

42. Lem, J., and Fain, G. L. (2004) Constitutive Opsin Signaling: Night Blindness Or Retinal Degeneration? Trends Mol. Med. 10, 150-157.

43. Illing, M. E., Rajan, R. S., Bence, N. F., and Kopito, R. R. (2002) A Rhodopsin Mutant Linked to Autosomal Dominant Retinitis Pigmentosa is Prone to Aggregate and Interacts with the Ubiquitin Proteasome System. J. Biol. Chem. 277, 34150-34160.

44. Lem, J., Krasnoperova, N. V., Calvert, P. D., Kosaras, B., Cameron, D. A., Nicolo, M., Makino, C. L., and Sidman, R. L. (1999) Morphological, Physiological, and Biochemical Changes in Rhodopsin Knockout Mice. Proc. Natl. Acad. Sci. U. S. A. 96, 736-741.

45. Sung, C. H., and Tai, A. W. (2000) Rhodopsin Trafficking and its Role in Retinal Dystrophies. Int. Rev. Cytol. 195, 215-267.

46. Alfinito, P. D., and Townes-Anderson, E. (2002) Activation of Mislocalized Opsin Kills Rod Cells: A Novel Mechanism for Rod Cell Death in Retinal Disease. Proc. Natl. Acad. Sci. U. S. A. 99, 5655-5660.

47. Chuang, J. Z., Vega, C., Jun, W., and Sung, C. H. (2004) Structural and Functional Impairment of Endocytic Pathways by Retinitis Pigmentosa Mutant Rhodopsin-Arrestin Complexes. J. Clin. Invest. 114, 131-140.

48. Ethen, C. M., Feng, X., Olsen, T. W., and Ferrington, D. A. (2005) Declines in Arrestin and Rhodopsin in the Macula with Progression of Age-Related Macular Degeneration. Invest. Ophthalmol. Vis. Sci. 46, 769-775.

49. Rajala, A., Anderson, R. E., Ma, J. X., Lem, J., Al-Ubaidi, M. R., and Rajala, R. V. (2007) G-Protein-Coupled Receptor Rhodopsin Regulates the Phosphorylation of Retinal Insulin Receptor. J. Biol. Chem. 282, 9865-9873.

50. Hwa, J., Reeves, P. J., Klein-Seetharaman, J., Davidson, F., and Khorana, H. G. (1999) Structure and Function in Rhodopsin: Further Elucidation of the Role of the Intradiscal Cysteines, Cys-110, -185, and -187, in Rhodopsin Folding and Function. Proc. Natl. Acad. Sci. U. S. A. 96, 1932-1935.