Phenotypic Mutation 'andalusia2'

• Allele: andalusia2
• Mutation Type: start codon destroyed
• Chromosome: 9
• Coordinate: 111,100,591 bp (GRCm39)
• Base Change: A ⇒ C (forward strand)
• Gene: Mlh1
• Gene Name: mutL homolog 1
• Synonym(s): 1110035C23Rik, colon cancer, nonpolyposis type 2
• Chromosomal Location: 111,057,296-111,100,854 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced pairing in meiotic prophase I and produce no mature germ cells. Mutants also display increased microsatellite instability and a predisposition for developing intestinal and other tumors. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Methionine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000035079] [ENSMUSP00000143786]
• AlphaFold: Q9JK91
• SMART Domains: Protein: ENSMUSP00000035079; Gene: ENSMUSG00000032498; AA Change: M1R

Domain	Start	End	E-Value	Type
HATPase_c	23	158	4.57e-1	SMART
DNA_mis_repair	216	335	1.08e-44	SMART
low complexity region	363	375	N/A	INTRINSIC
low complexity region	429	454	N/A	INTRINSIC
Pfam:Mlh1_C	504	760	8.3e-100	PFAM

• Predicted Effect: probably null ; PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
  (Using ENSMUST00000035079)
• Predicted Effect: probably null ; PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
  (Using ENSMUST00000135218)
• Meta Mutation Damage Score: 0.9702
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Anne Murray
• Record Created: 2017-06-16 1:08 PM by Jin Huk Choi
• Record Posted: 2018-08-02
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Braden Hayse, Tao Yue, Bruce Beutler

Accession Number

NCBI RefSeq: NM_026810, NM_001324522; MGI:101938

Alleles Listed at MGI

All Mutations and Alleles(14) : Endonuclease-mediated(1) Gene trapped(6) Targeted(7)

Phenotypic Description

Figure 1. Homozygous andalusia2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Andalusia2 mice exhibited decreased total IgE in the serum. IgE levels were determined by ELISA. Log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The andalusia2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5265, some of which showed a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1). Some mice showed reduced amounts of total IgE in the serum (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the diminished T-dependent IgG responses to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 59 mutations (X-axis) identified in the G1 male of pedigree R5265. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 59 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Mlh1: a T to G transversion at base pair 111,271,523 (v38) on chromosome 9, or base pair 264 in the GenBank genomic region NC_000075 encoding Mlh1. The mutation in Mlh1 was presumed causative as a second allele was discovered in a separate pedigree (R5007; see the record for andalusia) that phenocopied andalusia2. The strongest association was found with a recessive model of inheritance to the T-dependent antibody response phenotype, wherein six variant homozygotes departed phenotypically from nine homozygous reference mice and 15 heterozygous mice with a P value of 2.301 x 10^-7 (Figure 3).  

The mutation corresponds to residue 86 in the mRNA sequence NM_026810 within exon 1 of 19 total exons.

85 ……ATGGCGTTTGTAGCA…… 1    -M--A--F--V--A-……

The mutated nucleotide is indicated in red. The mutation results in a methionine to arginine substitution at position 1 (M1R) in the MLH1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.933).

Protein Prediction

Figure 4. Domain organization of MLH1. The andalusia2 mutation results in a methionine to arginine substitution at position 1. Mutations found in the MLH1 protein are shown in red. Click on each mutation for more information.

MLH1 (mutL homolog 1 [E. coli]) is a member of the GHKL (gyrase, Hsp90, histidine kinase, MutL) ATPase/kinase superfamily of proteins (1). MLH1 has an ATPase domain, MutS homolog (MSH2, MSH3, MSH6) interaction domain, EXO1 interaction domain, PMS2/MLH3/PMS1 interaction domain, and a CTH motif.

MLH1 forms a heterodimer with PMS2 (designated MutLα), PMS1 (designated MutLβ), or MLH3 (designated MutLγ). MutLα functions in mismatch repair (MMR), the function of MutLβ is unknown, and MutLγ functions in meiotic recombination (2;3).

The andalusia2 mutation results in a methionine to arginine substitution at position 1 (M1R) in the MLH1 protein.

For more information about Mlh1, please see the record andalusia.

Putative Mechanism

During MMR, a MutS heterodimer binds to DNA mismatches (4). Upon binding, the MutS undergoes an ADP to ATP exchange and a conformational change, followed by recruitment of MutLα, MutLβ, or MutLγ. The MutL complexes cleave the defective strand near the mismatch site. The MutS-MutL complex then recruits an exonuclease, subsequently leading to strand-specific excision. PCNA coordinates with the exonuclease to excise the mismatch-containing region. The removed DNA fragment is resynthesized by DNA polymerase δ and the repair process is completed by DNA ligase.

In addition to MMR, MLH1 functions in meiotic recombination. MutLγ localizes to sites of crossing over in the meiotic chromosomes (5), and is required for oocytes to progress through metaphase II of meiosis (6). Male and female Mlh1-deficient (Mlh1^-/-) mice exhibited infertility (5;7) and premature death. The Mlh1^-/- mice showed reduced level of chiasmata (5;8)fa. The chromosomes in Mlh1^-/- sperm separate prematurely during spermatogenesis. In addition, the first division of meiosis is frequently arrested (5).

Mutations in MLH1 are linked to hereditary nonpolyposis colorectal cancer type 2 (HNPCC2; OMIM: # 609310; (9)), mismatch repair cancer syndrome (OMIM: #276300; (10)), and Muir-Torre syndrome (OMIM: #158320; (11)). Muir-Torre syndrome is an autosomal dominant disorder characterized by development of sebaceous gland tumors and skin cancers, including keratoacanthomas and basal cell carcinomas. Patients can manifest a wide spectrum of internal malignancies, which include colorectal, endometrial, urologic, and upper gastrointestinal neoplasms. Mlh1^-/- mice exhibit increased incidences of intestinal adenocarcinomas and adenomas, uterus tumor incidence, skin tumor incidence, and lymphoma incidence (7;12-15).

Primers

PCR Primer
andalusia2_pcr_F: CCGTGTGCATAATGGGAAAC
andalusia2_pcr_R: TTTAGAGCGGGACAGAGATCC

Sequencing Primer
andalusia2_seq_F: GAAACCAGCCTGGCACG
andalusia2_seq_R: CGGGACAGAGATCCCAGGAAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 456 nucleotides is amplified (chromosome 9, - strand):

1   tttagagcgg gacagagatc ccaggaactg acgtgtaaaa gcgcttgact ggcattcatg
61  ctgcccaatc agcacttgcc gctgggaaga cggcgcagga ctgcagtcgg ccgaagctga
121 aggaagaact tgagcgtgag gagctcgagt gattggctga ctgggaactc gggcgccaat
181 atggcgtttg tagcaggagt tattcggcgt ctggacgaga cggtagtgaa ccgcatagcg
241 gcgggggaag tcattcagcg gccggccaat gctatcaaag agatgataga aaactggtac
301 ggagggagcg gagccgagtt ccccgactga gagccggggc gggccgaccc acctgctgca
361 gtcggccacc gtgcggggca ccgagcacgg ggaccgtggg ggcatcgggc acagggaccc
421 tgcgcgtgcc aggctggttt cccattatgc acacgg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Dutta, R., and Inouye, M. (2000) GHKL, an Emergent ATPase/kinase Superfamily. Trends Biochem Sci. 25, 24-28.

  2. Cannavo, E., Marra, G., Sabates-Bellver, J., Menigatti, M., Lipkin, S. M., Fischer, F., Cejka, P., and Jiricny, J. (2005) Expression of the MutL Homologue hMLH3 in Human Cells and its Role in DNA Mismatch Repair. Cancer Res. 65, 10759-10766.

  3. Ranjha, L., Anand, R., and Cejka, P. (2014) The Saccharomyces Cerevisiae Mlh1-Mlh3 Heterodimer is an Endonuclease that Preferentially Binds to Holliday Junctions. J Biol Chem. 289, 5674-5686.

  4. Palombo, F., Gallinari, P., Iaccarino, I., Lettieri, T., Hughes, M., D'Arrigo, A., Truong, O., Hsuan, J. J., and Jiricny, J. (1995) GTBP, a 160-Kilodalton Protein Essential for Mismatch-Binding Activity in Human Cells. Science. 268, 1912-1914.

  5. Baker, S. M., Plug, A. W., Prolla, T. A., Bronner, C. E., Harris, A. C., Yao, X., Christie, D. M., Monell, C., Arnheim, N., Bradley, A., Ashley, T., and Liskay, R. M. (1996) Involvement of Mouse Mlh1 in DNA Mismatch Repair and Meiotic Crossing Over. Nat Genet. 13, 336-342.

  6. Kan, R., Sun, X., Kolas, N. K., Avdievich, E., Kneitz, B., Edelmann, W., and Cohen, P. E. (2008) Comparative Analysis of Meiotic Progression in Female Mice Bearing Mutations in Genes of the DNA Mismatch Repair Pathway. Biol Reprod. 78, 462-471.

  7. Edelmann, W., Yang, K., Kuraguchi, M., Heyer, J., Lia, M., Kneitz, B., Fan, K., Brown, A. M., Lipkin, M., and Kucherlapati, R. (1999) Tumorigenesis in Mlh1 and Mlh1/Apc1638N Mutant Mice. Cancer Res. 59, 1301-1307.

  8. Wei, K., Kucherlapati, R., and Edelmann, W. (2002) Mouse Models for Human DNA Mismatch-Repair Gene Defects. Trends Mol Med. 8, 346-353.

  9. Papadopoulos, N., Nicolaides, N. C., Wei, Y. F., Ruben, S. M., Carter, K. C., Rosen, C. A., Haseltine, W. A., Fleischmann, R. D., Fraser, C. M., and Adams, M. D. (1994) Mutation of a mutL Homolog in Hereditary Colon Cancer. Science. 263, 1625-1629.

  10. Hamilton, S. R., Liu, B., Parsons, R. E., Papadopoulos, N., Jen, J., Powell, S. M., Krush, A. J., Berk, T., Cohen, Z., and Tetu, B. (1995) The Molecular Basis of Turcot's Syndrome. N Engl J Med. 332, 839-847.

  11. Bapat, B., Xia, L., Madlensky, L., Mitri, A., Tonin, P., Narod, S. A., and Gallinger, S. (1996) The Genetic Basis of Muir-Torre Syndrome Includes the hMLH1 Locus. Am J Hum Genet. 59, 736-739.

  12. Trinh, B. N., Long, T. I., Nickel, A. E., Shibata, D., and Laird, P. W. (2002) DNA Methyltransferase Deficiency Modifies Cancer Susceptibility in Mice Lacking DNA Mismatch Repair. Mol Cell Biol. 22, 2906-2917.

  13. Kawate, H., Sakumi, K., Tsuzuki, T., Nakatsuru, Y., Ishikawa, T., Takahashi, S., Takano, H., Noda, T., and Sekiguchi, M. (1998) Separation of Killing and Tumorigenic Effects of an Alkylating Agent in Mice Defective in Two of the DNA Repair Genes. Proc Natl Acad Sci U S A. 95, 5116-5120.

  14. Avdievich, E., Reiss, C., Scherer, S. J., Zhang, Y., Maier, S. M., Jin, B., Hou, H.,Jr, Rosenwald, A., Riedmiller, H., Kucherlapati, R., Cohen, P. E., Edelmann, W., and Kneitz, B. (2008) Distinct Effects of the Recurrent Mlh1G67R Mutation on MMR Functions, Cancer, and Meiosis. Proc Natl Acad Sci U S A. 105, 4247-4252.

  15. Albertson, T. M., Ogawa, M., Bugni, J. M., Hays, L. E., Chen, Y., Wang, Y., Treuting, P. M., Heddle, J. A., Goldsby, R. E., and Preston, B. D. (2009) DNA Polymerase Epsilon and Delta Proofreading Suppress Discrete Mutator and Cancer Phenotypes in Mice. Proc Natl Acad Sci U S A. 106, 17101-17104.