Phenotypic Mutation 'goodnow' (pdf version)
List |< first << previous [record 3 of 4] next >> last >|
Allelegoodnow
Mutation Type splice site
Chromosome11
Coordinate46,338,099 bp (GRCm38)
Base Change A ⇒ C (forward strand)
Gene Itk
Gene Name IL2 inducible T cell kinase
Synonym(s) Emt, Tsk, Tcsk
Chromosomal Location 46,325,150-46,389,515 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001281965 (variant 1), NM_010583 (variant 2), NM_001281966 (variant 3), NM_001281967 (variant 4), NM_001281968 (variant 5); MGI:96621

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000020664] [ENSMUSP00000104860]
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - increased 23823319
FACS B:T cells - increased
FACS CD4+ T cells - decreased 12055226
FACS CD4+ T cells in CD3+ T cells - decreased 12055226
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased 16860759
FACS CD44+ T cells - increased 16860759
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased 16880398
FACS central memory CD4 T cells in CD4 T cells - increased 16860759
FACS central memory CD8 T cells in CD8 T cells - increased 12055226
FACS effector memory CD4 T cells in CD4 T cells - increased 16860759
FACS IgD+ B cell percentage - increased 23823319
FACS IgM+ B cells - increased 23823319
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased 19009524
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU)(1) Chemically induced (other)(1) Targeted(8)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2419:Itk UTSW 11 46338217 missense probably damaging 1.00
R2859:Itk UTSW 11 46344835 intron probably benign
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R5958:Itk UTSW 11 46344855 intron probably benign
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R6849:Itk UTSW 11 46331935 missense probably damaging 1.00
U24488:Itk UTSW 11 46338144 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-01-30 11:13 AM by Anne Murray
Record Created 2017-06-20 11:49 AM by Bruce Beutler
Record Posted 2017-08-18
Phenotypic Description

Figure 1. Goodnow mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Goodnow mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Goodnow mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Goodnow mice exhibit decreased frequencies of peripheral CD4 T cells in CD3 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Goodnow mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Goodnow mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Goodnow mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Goodnow mice exhibit increased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Goodnow mice exhibit increased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Goodnow mice exhibit increased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Goodnow mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Goodnow mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Goodnow mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Goodnow mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Goodnow mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Goodnow mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Goodnow mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Goodnow mice exhibit increased expression of CD44 on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The goodnow phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5286, some of which showed an increase in the B:T cell ratio (Figure 1) due to a decrease in the frequencies of T cells (Figure 2), CD4+ T cells (Figure 3), CD4+ T cells in CD3+ T cells (Figure 4), CD8+ T cells (Figure 5), naive CD4 T cells in CD4 T cells (Figure 6), and naive CD8 T cells in CD8 T cells (Figure 7) with concomitant increased frequencies of B cells (Figure 8), IgD+ B cells (Figure 9), IgM+ B cells (Figure 10), CD44+ T cells (Figure 11), CD44+ CD8 T cells (Figure 12), central memory CD4 T cells in CD4 T cells (Figure 13), effector memory CD4 T cells in CD4 T cells (Figure 14), and central memory CD8 T cells in CD8 T cells (Figure 15), all in the peripheral blood. CD44 expression on T cells (Figure 16), CD4 T cells (Figure 17), and CD8 T cells (Figure 18) was increased.

Nature of Mutation

Figure 19. Linkage mapping of the central mmory CD8 T cells in CD8 T cells phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R5286. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations.  All of the above anomalies were linked by continuous variable mapping to a mutation in Itk:  a T to G transversion at base pair 46,338,099 (v38) on chromosome 11, or base pair 51,417 in the GenBank genomic region NC_000076 within the donor splice site of intron 12.  The strongest association was found with a recessive model of inheritance to the normalized frequency of central memory CD8 T cells in CD8 T cells, wherein three variant homozygotes departed phenotypically from nine homozygous reference mice and 14 heterozygous mice with a P value of 5.285 x 10-20 (Figure 19).

 

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in the use of a cryptic site in intron 12. The resulting transcript would have a 5-base pair insertion of intron 12, causing a frame shifted protein product beginning after amino acid 410 of the protein, which is normally 619 amino acids in length.

 
C57BL/6J:
         <--exon 12 intron 12-->      exon 13-->          <--exon 17
51401 ……GAAGTCATGAT gtgagttagagcagg…… GAAACTCTCTCAC…… ……GCTGGGCTTTAG……
407   ……-E--V--M--M                   --K--L--S--H-…… ……-A--G--L--*- 619

 

Genomic numbering corresponds to NC_000076. The donor splice site of intron 12, which is destroyed by the goodnow mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 20. Protein domain organization of mouse ITK. The location of the goodnow mutation is indicated. Abbreviations: PH, pleckstrin homology domain; Tec, Tec homology domain. See the text for more details.

ITK is one of five members of the Tec family of tyrosine kinases, which includes ITK, Btk, Tec, Bmx, and Rlk (also called Txk). ITK is a 72 kD protein with similarity to Csk and the Src and Abl family tyrosine kinases in the organization of its SH3-SH2-kinase domain cassette. However, ITK lacks the N-terminal myristoylation consensus sequence and the C-terminal negative regulatory tyrosine residue present in Src kinases, indicating a distinct regulatory mechanism. The N-terminus of ITK contains a pleckstrin homology (PH) domain that binds to the membrane phospholipid phosphatidylinositol 3,4,5-trisphosphate (PIP3), thereby recruiting ITK to the plasma membrane to interact with the activated T cell receptor (1-3). The ITK N-terminus also contains a Tec homology domain consisting of a Btk homology (BH) motif that binds to zinc and a proline-rich region that binds to SH3 domains (4)

 

Please see the entry itxaro for more information about Itk.

Putative Mechanism

Mice with the goodnow mutation of Itk displayed key phenotypes characteristic of ITK deficiency, including a reduced frequency of CD4 T cells, increased activated/memory CD4 and CD8 T cells, and elevated CD44 expression on CD4 and CD8 T cells.  

Primers PCR Primer
goodnow(F):5'- TTGTGAGCTACAAGTCCTCTTAAC -3'
goodnow(R):5'- TTCCAGGGAAGTGGGTGATC -3'

Sequencing Primer
goodnow_seq(F):5'- GAACTTACTGGCCTGGAACTAGC -3'
goodnow_seq(R):5'- TGGGTGATCCAACCCTCAGAG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Aijie Liu, Bruce Beutler
List |< first << previous [record 3 of 4] next >> last >|