Phenotypic Mutation 'poison' (pdf version)
Allelepoison
Mutation Type splice acceptor site (13 bp from exon)
Chromosome1
Coordinate52,151,225 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Stat1
Gene Name signal transducer and activator of transcription 1
Synonym(s) 2010005J02Rik
Chromosomal Location 52,119,440-52,161,865 bp (+)
MGI Phenotype Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass.
Accession Number

NCBI RefSeq: NM_009283; MGI: 103063

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000066743 (fasta)
Ensembl: ENSMUSP00000066743 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 1.2e-64 PFAM
Pfam:STAT_bind 317 567 4.4e-121 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 3.1e-15 PFAM
Predicted Effect probably benign
Phenotypic Category decrease in NK cell response, immune system, MCMV susceptibility
Penetrance 100% 
Alleles Listed at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(2) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Stat1 APN 1 52122595 missense probably damaging 1.00
IGL01111:Stat1 APN 1 52142961 critical splice donor site probably null 0.00
IGL01451:Stat1 APN 1 52139343 missense probably damaging 1.00
IGL01469:Stat1 APN 1 52147370 missense possibly damaging 0.44
IGL01758:Stat1 APN 1 52136921 missense probably damaging 1.00
IGL01818:Stat1 APN 1 52151278 missense probably damaging 0.97
IGL01913:Stat1 APN 1 52126557 missense possibly damaging 0.93
IGL01914:Stat1 APN 1 52126557 missense possibly damaging 0.93
IGL02304:Stat1 APN 1 52132544 missense probably benign 0.00
IGL02428:Stat1 APN 1 52142966 splice site 0.00
domino UTSW 1 52140588 missense probably damaging 1.00
roccoco UTSW 1 52123209 missense probably damaging 1.00
rollo UTSW 1 52153923 nonsense
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0039:Stat1 UTSW 1 52140660 missense probably damaging 0.97
R0458:Stat1 UTSW 1 52149052 splice donor site probably benign
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1824:Stat1 UTSW 1 52126515 splice acceptor site probably benign
R2202:Stat1 UTSW 1 52151226 splice acceptor site probably benign
R2998:Stat1 UTSW 1 52151249 missense probably benign 0.01
R4464:Stat1 UTSW 1 52137416 missense possibly damaging 0.52
R4709:Stat1 UTSW 1 52126521 unclassified probably damaging 0.97
R4934:Stat1 UTSW 1 52153923 nonsense probably null
R5038:Stat1 UTSW 1 52123209 missense probably damaging 1.00
R5075:Stat1 UTSW 1 52122712 missense possibly damaging 0.73
R5223:Stat1 UTSW 1 52144242 missense probably damaging 1.00
R5600:Stat1 UTSW 1 52148942 missense probably benign 0.06
R5702:Stat1 UTSW 1 52150221 missense noncoding transcript
R5866:Stat1 UTSW 1 52139264 missense probably damaging 1.00
X0027:Stat1 UTSW 1 52139271 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
MMRRC Submission 030439-UCD
Last Updated 08/28/2017 11:03 AM by Anne Murray
Record Created unknown
Record Posted 04/29/2008
Phenotypic Description
The poison phenotype was identified among ENU-induced G3 mutant mice by screening for defects in natural killer (NK) cell function using an in vivo NK cytotoxicity assay (In vivo NK cell and CD8+ T cell cytotoxicity screen). Briefly, mice were injected with fluorescently labeled splenocytes isolated from C57BL/6J, allogeneic C3H/HeN, and TAP-deficent mice, and NK cell-specific killing was measured 48 hours later.  Homozygous poison mice exhibit a reduced ability to kill TAP-deficient target cells lacking MHC class I molecules, but normal killing of C3H/HeN target cells displaying allogeneic MHC molecules. In vitro, NK cells from poison homozygotes produce normal levels of interferon (IFN)-γ and degranulate normally after stimulation with antibodies against Ly49D, NK1.1, and NKp46 receptors, or after treatment with interleukin (IL)-12, IL-2 or IL-18. However, neither IFN-γ production nor degranulation was observed when poison NK cells were exposed to YAC-1 tumor cells.
 
Poison homozygotes display increased susceptibility to infection by mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen). 100% of infected mice succumb by day 5 post-infection with 105 pfu, a normally sublethal inoculum, making poison mice as susceptible to MCMV infection as BALB/c mice lacking the NK cell activating receptor Ly49H. Like poison mutants, homozygous domino mice also display MCMV susceptibility and low cytotoxic activity of NK cells, and harbor a mutation in Stat1 (1).
Nature of Mutation
The poison mutation was mapped to Chromosome 1, and corresponds to a T to A transversion at position 31788 in the genomic DNA sequence of the Stat1 gene (Genbank genomic region NC_000067 for linear genomic DNA sequence of Stat1). The mutation is located within intron 19, thirteen nucleotides upstream from the start of exon 20, and impairs the acceptor splice site of intron 19. cDNA sequencing demonstrates the presence of several abnormal transcripts.  In one case, a sequence in the middle of exon 20 (TCCTAG, position 31850-31855) is used as an acceptor splice site, causing a deletion of 55 nucleotides from the 5’ end of exon 20 and destroying the reading frame thereafter (depicted below).  A premature stop is predicted to truncate the protein after amino acid 561 (Figure 1). Other abnormal transcripts were not sequenced.
     <--exon 19      <--intron 19 exon 20--> 
31223 TTTTGTAAG……ATTTGTATACTTGCAG GAAAATATT……ACCATCCTAGAGCTCATTAAGAAGCACCTGCTGTGCCTCTGGAATGATGGGTAAGCGTCCCTGA 31909
542   -F--C--K-                   -E--N--I-……-T--I--L- -S--S--L--R--S--T--C--C--A--S--G--M--M--G--K--R--P--*  561
       correct                          deleted                              aberrant
Figure 1. 3D and domain structure of the STAT1 protein. A) 3D representation of STAT1 based on crystalized structures of human STAT1 residues 1-683 (PDB 1YVL). The residue affected by the domino mutation is shown in red. 3D image was created using UCSF Chimera. B) Domain structure of STAT1. CC=Coiled Coil domain; DBD = DNA binding domain; LD = Linker domain; SH2=Src Homology 2 domain; TAD = Transcriptional activation domain. The critical tyrosine phosphorylation site is found at amino acid 701. The poison mutation impairs the acceptor splice site of intron 19. A premature stop is predicted to truncate the protein after amino acid 561. This image is interactive. Click on the image to view other mutations found in STAT1 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.
The mutated nucleotide is indicated in red lettering; the acceptor splice site of intron 19 is indicated in blue lettering; the new splice site is highlighted in gray.
 
Please see the record for domino for information about Stat1.
Putative Mechanism
STAT1 is required for IFN signaling.  NK cell function is enhanced by IFNs, and Stat1-/- NK cells have impaired cytotoxicity relative to wild type NK cells (2). Stat1-/- mice are highly sensitive to bacterial and viral infections, and cells from these mice are unresponsive to type I IFN and IFN-γ (3;4).  Stat1poison/poison mice exhibit a phenotype similar to that of knockout mice, and consistent with this, no Stat1 protein expression is detected by immunoblot in extracts of peritoneal macrophages from homozygous mutants (Figure 2).
Primers Primers cannot be located by automatic search.
Genotyping
Poison genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Poison(F): 5’-GGAAGCACCTGCCTGAGTGATAAC-3’
Poison(R): 5’-CACTGCTGGTCAACTGACAGGAAC-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Poison_seq(F): 5’- TCCAGTCATCTGGGAAGTCAC-3’
Poison_seq(R): 5’- AGACTGAGTCTCACTGTCAGC-3’
 
The following sequence of 1084 nucleotides (from Genbank genomic region NC_000067 for linear DNA sequence of Stat1) is amplified:
 
31367                                                   ggaa gcacctgcct
31381 gagtgataac actctcccac atccctcgcc ccagcctctt aatcagcagg gctctggcta
31441 aggccgtggg aaccgtgcac ggagcagttg tgcagagcta ccccagctcg agggcacctg
31501 cacagggtgg tgagaccctg cacggttcgc cagcaggagc tgagctgctc atgctggctt
31561 ctgctacagt gagcacactc ttgttttcca gtcatctggg aagtcacctt tgccgggtgc
31621 tgctcttggg aaagggagcc aaggagggag aagctctagc aagtcagaaa gaggcagggg
31681 gagccagcca ggcatttcca ctcaggaacg actgcccctc ttgcttgatc tggggtctct
31741 ttggaggggc agggcaaagc agtgctttgg ttaaccaatt gtgcatttgt atacttgcag
31801 gaaaatatta atgataaaaa tttctccttc tggccttgga ttgacaccat cctagagctc
31861 attaagaagc acctgctgtg cctctggaat gatgggtaag cgtccctgag cgctccgaag
31921 gctgggacag agtgccggcc ggccttcagg atttggcagg ggttttgctc agagatgcac
31981 acttacctgg tataaggctc cttgaaagga caccctcagg agattaagca tgtcttagga
32041 tatctatatt tagatctatc tatttaaaag ctaaattaaa aacaaaaacc tcttagtgtc
32101 attaatgtat ttattcattc tcacaaacat tgtcagtatt tactgtactg ccctaataaa
32161 gaatcagaaa ccaccagatg gggcagtgca gatctttaac ttcagctgag gctgaggctg
32221 aggcaggctg atctctgctc gtagcacagc aagctccagg cagccacggc tgacagtgag
32281 actcagtctt ttttgttaaa aggaaggaag gaaggagaga aggagaggga agggaagaga
32341 agggaagaag gaaggagaca gaaggaaaga gagaaagaga aaagtgttta gctcattcag
32401 tccagggatc aactgatatc tccggggttc ctgtcagttg accagcagtg
 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References
   1.  Crozat, K., Georgel, P., Rutschmann, S., Mann, N., Du, X., Hoebe, K., and Beutler, B. (2006) Analysis of the MCMV resistome by ENU mutagenesis, Mamm. Genome 17, 398-406.    4.  Durbin, J. E., Hackenmiller, R., Simon, M. C., and Levy, D. E. (1996) Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease, Cell 84, 443-450.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine, Peter Jurek, Katherine Timer
AuthorsKaren Whitley, Kasper Hoebe, Bruce Beutler
Edit History
01/07/2011 9:31 AM (current)
07/22/2010 8:22 AM
04/22/2010 12:00 PM
04/22/2010 11:58 AM
04/22/2010 11:55 AM
02/25/2010 3:09 PM