Phenotypic Mutation 'wobble' (pdf version)
Allelewobble
Mutation Type missense
Chromosome13
Coordinate59,474,550 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Agtpbp1
Gene Name ATP/GTP binding protein 1
Synonym(s) 2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik
Chromosomal Location 59,445,742-59,585,227 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_023328 (isoform 1), NM_001048008 (isoform 2), NM_001284218 (isoform 3), NM_001284219 (isoform 4), NM_001284221 (isoform 5); MGI: 2159437

Mapped Yes 
Amino Acid Change Aspartic acid changed to Valine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022040] [ENSMUSP00000130939] [ENSMUSP00000127600] [ENSMUSP00000132854] [ENSMUSP00000128589] [ENSMUSP00000153569]
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: D954V

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000022040)
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: D954V

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000164215)
Predicted Effect probably benign
Predicted Effect probably benign
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect probably benign
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000224397)
Meta Mutation Damage Score 0.0328 question?
Is this an essential gene? Probably essential (E-score: 0.756) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased
Body Weight (DSS Male) - decreased
Candidate Explorer Status CE: excellent candidate; human score: 0.5; ML prob: 0.492
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(21) : Chemically induced (ENU)(5) Chemically induced (other)(1) Gene trapped(7) Spontaneous(7) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59450172 missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59462094 missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59504226 missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59508063 splice site probably benign
IGL01921:Agtpbp1 APN 13 59512483 missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59500461 missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59500489 missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59528419 missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59482601 missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59474589 missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59532080 splice site probably benign
IGL03218:Agtpbp1 APN 13 59500207 missense possibly damaging 0.94
drunk UTSW 13 59512323 critical splice donor site probably benign
gru UTSW 13 59473746 missense probably damaging 1.00
rio UTSW 13 59525241 critical splice acceptor site probably benign
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59462031 missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59514152 missense probably benign 0.24
R0559:Agtpbp1 UTSW 13 59497000 missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59533939 intron probably benign
R0943:Agtpbp1 UTSW 13 59500602 missense probably benign
R1196:Agtpbp1 UTSW 13 59450318 unclassified probably benign
R1421:Agtpbp1 UTSW 13 59495575 missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59500634 synonymous probably null
R1833:Agtpbp1 UTSW 13 59465983 critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59450202 missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59475803 frame shift probably null
R2006:Agtpbp1 UTSW 13 59500321 missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59474569 missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59497015 missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59460596 missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59500407 missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59528399 missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59500072 missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59500572 missense probably benign
R4969:Agtpbp1 UTSW 13 59500578 missense probably benign
R5066:Agtpbp1 UTSW 13 59474550 missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59500213 missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59500639 missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59473743 missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59482580 missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59500515 missense probably benign
R5824:Agtpbp1 UTSW 13 59466099 missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59534046 nonsense probably null
R6109:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59450300 missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59500020 missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59477040 missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59544353 intron probably null
R6950:Agtpbp1 UTSW 13 59450266 missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59504294 missense probably damaging 1.00
R7180:Agtpbp1 UTSW 13 59466038 missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59533180 missense possibly damaging 0.83
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:39 PM by Anne Murray
Record Created 2017-06-29 11:38 AM
Record Posted 2018-04-20
Phenotypic Description

Figure 1. Wobble mice exhibited reduced body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Wobble mice exhibited reduced times on a rotarod. Normalized data from gene-based superpedigree analysis of mutations in Agtpbp1 in pedigrees R5066 and R5352 are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The wobble phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5066, some of which showed smaller body weights than wild-type littermates (Figure 1). Some mice also exhibited reduced times on a rotarod (Figure 2; gene-based superpedigree analysis of mutations in Agtpbp1 in pedigrees R5066 and R5352).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R5066. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. Both of the above anomalies were linked to mutations in two genes on chromosome 13: Syk and Agtbp1The mutation in Agtpbp1 was presumed to be causative as the wobble neurological and body weight phenotypes mimic other known alleles of Agtpbp1 (see MGI for a list of Agtpbp1 alleles as well as the entries for drunk and rio). The mutation in Agtpbp1 is an A to T transversion at base pair 59,474,550 (v38) on chromosome 13, or base pair 82,817 in the GenBank genomic region NC_000079 encoding Agtpbp1. Linkage was found with a recessive model of inheritance (P = 0.000106; body weight phenotype), wherein one variant homozygote departed phenotypically from nine homozygous reference mice and 16 heterozygous mice (Figure 2).

 

The mutation corresponds to residue 3,019 in the NM_023328 mRNA sequence in exon 21 of 26 total exons.


 
3003 CCCATGCTAAATCCAGATGGTGTCATCAATGGA
949  -P--M--L--N--P--D--G--V--I--N--G-

 

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to valine substitution at position 954 (D954V) in the Nna1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction


Figure 3. Domain structure of NNA1. The wobble mutation results in an aspartic acid to valine substitution at position 954 of the Nna1 protein. Click on each mututation in red for more specific information.

The Agtpbp1 gene encodes Nna1, which has a number of predicted protein domains and motifs (1). The most prominent feature of Nna1 is the presence of a zinc carboxypeptidase-like sequence located within a highly conserved 300-amino acid region towards the C-terminus. This 300-amino acid region is 96% identical in mice and humans. The carboxypeptidase domain of Nna1 contains a zinc-binding motif, which is characterized by two conserved histidines and a catalytic glutamate residue, at positions H912, E915 and H1009 in Nna1. In this region, there are also consensus sequences for a tyrosine phosphorylation site, nuclear localization signal, and an ATP/GTP binding motif of the P-loop type. In the rest of the protein, there are several more predicted tyrosine phosphorylation sites, one nuclear localization signal, and consensus phosphorylation sites for protein kinase C, casein kinase II and cGMP/cAMP-dependent kinases. The N-terminal 450 amino acids of Nna1 are leucine-rich and possess weak homology to armadillo repeat proteins. The mutation results in an aspartic acid to valine substitution at position 954 (D954V) in the Nna1 protein; residue 954 is within the conserved region.

 

Please see the record drunk for more information about the Agtpbp1 gene.

Putative Mechanism

Agtpbp1 is also mutated in the spontaneously occurring pcd (Purkinje cell degeneration) mutants. There are currently eight known phenotypic alleles of pcd, out of which four have identified genetic lesions. The hallmark feature of pcd mice is development of an ataxic gait between three and four weeks of age, which correlates with the onset of cerebellar Purkinje cell degeneration (2). Purkinje cells proceed to deteriorate rapidly and die over the subsequent two week period. Distinct areas of the cerebellum display different rates of Purkinje cell degeneration, but all eventually die. In addition to Purkinje cells, cerebellar granule cells also display progressive death, with near normal numbers at three months declining to 5% by 20 months of age. 

Primers PCR Primer
wobble(F):5'- AGTCTGACGCATTACCCACC -3'
wobble(R):5'- GAGTTCTAGAACCCCAAAGTGAAG -3'

Sequencing Primer
wobble_seq(F):5'- TGACGCATTACCCACCAAAAACTTG -3'
wobble_seq(R):5'- GCACAAGTCAATTTTTGTAGCTG -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 419 nucleotides is amplified (chromosome 13, - strand):


1   gagttctaga accccaaagt gaagcacaag tcaatttttg tagctgttca ttttaattga
61  gcttttgtgt gcgctttagg aactcgccct tatattttct tgtctgctcg ggtccatcct
121 ggagaaacca atgcaagctg ggtaatgaaa ggaacactgg agtacctcat gagcaatagc
181 ccgactgccc agagcctacg ggagtcttac atttttaaaa ttgtccccat gctaaatcca
241 gatggtgtca tcaatggaaa gtaagttaag cagtggctgc cggagtgcca taggttggga
301 tagttggctg catttaattt gttcatctaa tagtgttcaa gttaattcaa ataatgggtt
361 tgatgatttt ttttctagga aaaaaactcc caagtttttg gtgggtaatg cgtcagact


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer, Sohini Mukherjee, and Bruce Beutler