Phenotypic Mutation 'wanna3' (pdf version)
Allelewanna3
Mutation Type missense
Chromosome1
Coordinate36,778,218 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Zap70
Gene Name zeta-chain (TCR) associated protein kinase
Synonym(s) ZAP-70, TZK, Srk
Chromosomal Location 36,761,798-36,782,818 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009539 (variant 1), NM_001289612 (variant 2), NM_001289765 (variant 3), NM_001289766 (variant 4); MGI: 99613

 

Mapped Yes 
Amino Acid Change Histidine changed to Leucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000027291]
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: H210L

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
(Using ENSMUST00000027291)
Phenotypic Category
Phenotypequestion? Literature verified References
CD8 response - decreased
CTL killing - decreased
CTL killing dominant epitope - decreased
FACS B cells - increased 14647385
FACS B:T cells - increased
FACS B1 cells - increased
FACS CD4:CD8 - increased
FACS CD4+ T cells - decreased 17767948
FACS CD4+ T cells in CD3+ T cells - decreased 17767948
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - decreased 17767948
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - decreased 17767948
FACS CD44+ T cells - decreased 17767948
FACS CD8+ T cells - decreased 17767948
FACS CD8+ T cells in CD3+ T cells - decreased 17767948
FACS central memory CD4 T cells in CD4 T cells - increased 19841086
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased 19841086
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD+ B cell percentage - increased 14647385
FACS IgM+ B cells - increased 14647385
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased 17767948
OVA-specific IgE - decreased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(27) : Chemically induced (ENU)(7) Chemically induced (other)(1) Gene trapped(1) Spontaneous (2) Targeted(11) Transgenic(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense possibly damaging 0.95
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 unclassified probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna4 UTSW 1 36781365 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-08-29 1:19 PM by Anne Murray
Record Created 2017-07-01 8:56 AM by Jin Huk Choi
Record Posted 2017-08-09
Phenotypic Description

Figure 1. Wanna3 mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Wanna3 mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Wanna3 mice exhibit decreased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Wanna3 mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Wanna3 mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Wanna3 mice exhibit decreased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Wanna3 mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Wanna3 mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Wanna3 mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Wanna3 mice exhibit decreased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Wanna3 mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Wanna3 mice exhibit increased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Wanna3 mice exhibit increased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Wanna3 mice exhibit increased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Wanna3 mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Wanna3 mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Wanna3 mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Wanna3 mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 19. Wanna3 mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 20. Wanna3 mice exhibit increased expression of CD44 on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 21. Wanna3 mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The wanna3 phenotype was identified by position-based superpedigree analysis of pedigrees R3689 and R5304. Homozygous mice in these pedigrees exhibited an increase in the B to T cell ratio (Figure 1) due to reduced frequencies of T cells (Figure 2), CD44+ T cells (Figure 3), CD4+ T cells (Figure 4), CD4+ T cells in CD3+ T cells (Figure 5), CD44+ CD4 T cells (Figure 6), naïve CD4 T cells in CD4 T cells (Figure 7), CD8+ T cells (Figure 8), CD8+ T cells in CD3+ T cells (Figure 9), CD44+ CD8 T cells (Figure 10), and naïve CD8 T cells in CD8 T cells (Figure 11) with concomitant increased frequencies of B cells (Figure 12), IgD+ B cells (Figure 13), IgM+ B cells (Figure 14), central memory CD4 T cells in CD4 T cells (Figure 15), effector memory CD4 T cells in CD4 T cells (Figure 16), central memory CD8 T cells in CD8 T cells (Figure 17), all in the peripheral blood. Some mice showed an increase in the CD4 to CD8 T cell ratio (Figure 18) and increased expression of CD44 on peripheral blood CD4 T cells (Figure 19) and CD8 T cells (Figure 20). The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was diminished (Figure 21).

Nature of Mutation

Figure 22. Linkage mapping of the B to T cell ratio phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 86 mutations (X-axis) identified in the G1 male of pedigree R5304. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 86 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Zap70:  an A to T transversion at base pair 36,778,218 (v38) on chromosome 1, or base pair 16,421 in the GenBank genomic region NC_000067 encoding Zap70. The strongest association was found with a recessive model of linkage to the normalized B to T cell ratio phenotype, wherein seven variant homozygotes departed phenotypically from 12 homozygous reference mice and 27 heterozygous mice with a P value of 1.17 x 10-28 (Figure 22).  A substantial semidominant effect was observed in some of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 791 in the mRNA sequence NM_001289766 within exon 4 of 13 total exons.


 
775 GGGAAAACTGTATACCACTATCTCATCAGCCAG
205 -G--K--T--V--Y--H--Y--L--I--S--Q-

 

The mutated nucleotide is indicated in red.  The mutation results in a histidine to leucine substitution at position 210 (H210L) in the ZAP70 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.994).

Protein Prediction
Figure 23. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The wanna3 mutation causes a histidine to leucine substitution at position 210 (H210L). The 3D structure is human ZAP70. UCSF Chimera structure based on PDB 2OZO. This image is interactive. Click on the image to view other mutations found in ZAP-70 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

The ζ-associated protein of 70 kDa (ZAP-70) is a protein tyrosine kinase (PTK) that binds to the doubly phosphorylated immunoreceptor tyrosine-based activation motifs (ITAMS) of ζ and CD3ε chains of the T cell receptor (TCR; see the record for tumormouse). ZAP70 consists of two N-terminal Src-homology 2 (SH2) domains at amino acids and a C-terminal kinase domain (Figure 23). The SH2 domains are connected by a linker known as interdomain A, while the region between the second SH2 and catalytic domains is known as interdomain B (2). The two SH2 domains of mouse ZAP-70 occur at amino acids 10-102 and 163-254, and work cooperatively to bind to the phosphorylated tyrosines of an ITAM sequence [(D/E)xxYxxI/Lx(6-8)YxxI/L]. The wanna3 mutation results in a histidine to leucine substitution at position 210 (H210L); residue 210 is within the second SH2 domain domain.

 

Please see the record for murdock for more information about Zap70.

Putative Mechanism

Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (3;4)]. Syk and ZAP-70 function as critical mediators of pre-TCR and TCR signaling, with ZAP-70 having a predominant role in mature T cells (4;5). Once activated, ZAP-70 and Syk interact with and phosphorylate a number of substrates important for TCR signaling including the adaptor proteins the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (6;7). Once phosphorylated, these two adaptors serve as docking sites and organize a number of effector molecules into the correct spatiotemporal manner to allow the activation of multiple signaling pathways. Zap70 knockout mice display an arrest of T cell development at the DP stage, the second critical checkpoint important during αβ T cell development due to defective TCR-mediated selection and signaling at this stage (5;8). Although ZAP-70 has a critical role in T cell development and function, it also plays a role downstream of the BCR and in NK cells. Zap70 knockout mice display normal B cell development, mount normal antibody responses and also proliferate appropriately to various stimuli (9).  The phenotype of the wanna3 mice is similar to loss-of-function alleles of Zap70.

Primers PCR Primer
wanna3(F):5'- AGGAGATTCTGGGTATGGAGCC -3'
wanna3(R):5'- TGGGACAGACCTCCTTCAAG -3'

Sequencing Primer
wanna3_seq(F):5'- GCCCATAGCATGTGTGTTAGTACC -3'
wanna3_seq(R):5'- GCGGTAAATTAGTCCATCCGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, Bruce Beutler