Phenotypic Mutation 'damselfly'

• Allele: damselfly
• Mutation Type: nonsense
• Chromosome: 18
• Coordinate: 38,030,603 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Diaph1
• Gene Name: diaphanous related formin 1
• Synonym(s): p140mDia, Dia1, mDia1, D18Wsu154e, Diap1, Drf1
• Chromosomal Location: 37,976,654-38,068,529 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016] ; PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000025337] [ENSMUSP00000078942] [ENSMUSP00000111292] [ENSMUSP00000111294] [ENSMUSP00000111297]
• AlphaFold: O08808
• SMART Domains: Protein: ENSMUSP00000025337; Gene: ENSMUSG00000024456; AA Change: E293*

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Drf_GBD	84	268	1.07e-57	SMART
Drf_FH3	274	466	2.06e-68	SMART
coiled coil region	471	571	N/A	INTRINSIC
Pfam:Drf_FH1	609	756	6.1e-43	PFAM
FH2	761	1206	2.46e-182	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000078942; Gene: ENSMUSG00000024456; AA Change: E284*

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Drf_GBD	75	259	1.07e-57	SMART
Drf_FH3	265	457	2.06e-68	SMART
coiled coil region	462	562	N/A	INTRINSIC
Pfam:Drf_FH1	589	747	7.9e-52	PFAM
FH2	752	1197	3.73e-182	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000111292; Gene: ENSMUSG00000024456; AA Change: E249*

Domain	Start	End	E-Value	Type
Drf_GBD	40	224	1.07e-57	SMART
Drf_FH3	230	422	2.06e-68	SMART
coiled coil region	427	527	N/A	INTRINSIC
Pfam:Drf_FH1	554	712	7.6e-52	PFAM
FH2	717	1162	3.73e-182	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000111294; Gene: ENSMUSG00000024456; AA Change: E249*

Domain	Start	End	E-Value	Type
Drf_GBD	40	224	1.07e-57	SMART
Drf_FH3	230	422	2.06e-68	SMART
coiled coil region	427	527	N/A	INTRINSIC
Pfam:Drf_FH1	554	712	1.1e-51	PFAM
FH2	717	1162	2.46e-182	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000111297; Gene: ENSMUSG00000024456; AA Change: E284*

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Drf_GBD	75	259	1.07e-57	SMART
Drf_FH3	265	457	2.06e-68	SMART
coiled coil region	462	562	N/A	INTRINSIC
Pfam:Drf_FH1	589	747	9.4e-52	PFAM
FH2	752	1197	2.46e-182	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Anne Murray
• Record Created: 2017-07-01 1:13 PM by Bruce Beutler
• Record Posted: 2017-08-11
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001305980 (variant 1), NM_007858 (variant 2), NM_001305981 (variant 3); MGI:1194490

Alleles Listed at MGI

All Mutations and Alleles(112) : Gene trapped(107) Targeted(5)

Phenotypic Description

Figure 1. Damselfly mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Damselfly mice exhibit decreased frequencies of peripheral naive CD4+ T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Damselfly mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Damselfly mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Damselfly mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Damselfly mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Damselfly mice exhibit increased frequencies of peripheral effector memory CD4+ T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Damselfly mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Damselfly mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Damselfly mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Damselfly mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Damselfly mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Damselfly mice exhibit increased expression of CD44 on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The damselfly phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5294, some of which showed reduced frequencies of CD4+ T cells (Figure 1), naive CD4 T cells in CD4 T cells (Figure 2), and naive CD8 T cells in CD8 T cells (Figure 3) with concomitant increased frequencies of CD44+ T cells (Figure 4), CD44+ CD4 T cells (Figure 5), central memory CD4 T cells in CD4 T cells (Figure 6), effector memory CD4 T cells in CD4 T cells (Figure 7), CD44+ CD8 T cells (Figure 8), central memory CD8 T cells in CD8 T cells (Figure 9), and effector memory CD8 T cells in CD8 T cells (Figure 10). Some mice showed increased CD44 expression on peripheral blood T cells (Figure 11), CD4 T cells (Figure 12), and CD8 T cells (Figure 13).

Nature of Mutation

Figure 14. Linkage mapping of the naive CD8 T cells in CD8 T cells phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 75 mutations (X-axis) identified in the G1 male of pedigree R5294. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 75 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations in Diaph1 on chromosome 18: a G to T transversion at base pair 37,897,550 (c.1035G>T; p.E293*) and an A to G transition at base pair 37,897,580 (c.1005A>G; p.M283V) that are likely mutations in cis. The nonsense mutation was presumed causative and corresponds to base pair 38,085 in the GenBank genomic region NC_000084 encoding Diaph1. The strongest association was found with a recessive model of inheritance to the normalized naïve CD8 T cells in CD8 T cells phenotype, wherein six variant homozygotes and 14 heterozygous mice departed phenotypically from 22 homozygous reference mice with a P value of 2.204 x 10^-20 (Figure 14).

The mutation corresponds to residue 1,035 in the mRNA sequence NM_001305980 within exon 9 of 28 total exons.

1020 GAAATGGATGAGGTCGAACGCTTCCAGCCACTT 288  -E--M--D--E--V--E--R--F--Q--P--L-

The mutated nucleotide is indicated in red.  The mutation results in a substitution of glutamic acid 293 to a premature stop codon (E293*) in the mDia1 protein.

Protein Prediction

Figure 15. Domain and crystal structure of mDia1. (A) Dia consists of the formin homology domains 1 and 2 (FH1, FH2), Rho-binding domain (RBD), a Dia inhibitory domain (DID), dimerization domain (DD), a predicted coiled-coil region (CC) and a dia autoregulatory domain (DAD). The DID, DD, and CC are also referred to as FH3. The location of the damselfly mutation is indicated. This image is interactive; click to view other mutations in Diaph1. (B) Crystal structure of the tetrameric N+C mDia1 complex. Selected domains and subdomains are labeled. The crystal structure was generated by UCSF Chimera and is modeled after PDB:3O4X and Nezami et al (2010). Click to rotate the crystal structure.

Diaph1 encodes mammalian diaphanous-related formin 1 (mDia1; alternatively, mDia or Drf1), a member of the mDia family of formins that is ubiquitously expressed. mDia1 has several domains, including a GTPase-binding domain (GBD), a formin homology 3 (FH3; alternatively, diaphanous inhibitory domain [DID]) domain, a dimerization domain (DD), a coiled-coil, a FH1 domain, a FH2 domain and a diaphanous autoregulatory domain (DAD) (Figure 15). The damselfly mutation results in a substitution of glutamic acid 293 to a premature stop codon (E293*); residue 293 is witin the FH3 domain. The GBD and FH3 domains bind to the DAD domain to keep mDia1 in an inactive conformation (1;2).

For more information about Diaph1, please see the record for Guangzhou.

Putative Mechanism

The formins are Rho effectors that direct actin assembly in several processes, such as cytokinesis, cell migration, and establishment and maintenance of cell polarity. mDia1 specifically functions in actin assembly, stress fiber and filopodia formation, phagocytosis, activation of serum response factor, and formation of adherens juctions. mDia1 has several functions in actin assembly, including regulating de novo nucleation, the rate of filament elongation, and filament growth duration before capping (3).

Segregation of T and B cells in the spleen and lymph nodes were normal in the Diaph1^-/- mice, but the frequencies of both CD4 and CD8 T cells in the spleen and lymph nodes were reduced compared to wild-type mice. The frequencies of B cells, CD11c+ dendritic cells, and CD11b+ dendritic cells were not changed. The number of T cells was reduced in the peripheral blood; however, the numbers of CD4⁻CD8⁻, CD4⁺CD8⁺, CD4⁺CD8⁻, and CD4⁻CD8⁺ T cells in the thymus were similar to that in wild-type mice. The numbers of CD69^loCD62L^hi CD4 or CD8 single-positive T cells was higher indicating that there was an impaired egression of mature T cells from the thymus in the Diaph1^-/- mice. With age (greater than postnatal day 300), the Diaph1^-/ mice often developed dermatoses and/or alopecia (4). In addition, the Diaph1^-/- mice developed splenomegaly, fibrotic and hypercellular bone marrow, extramedullary hematopoiesis in both spleen and liver. Also, the Diaph1^-/ mice had immature myeloid progenitor cells with high nucleus-to-cytoplasm ratios. The immune phenotypes observed in the damselfly mice indicate that mDia1^damselfly exhibits loss of function. It is unclear which mDia mutation observed in pedigree R5294 is causing the phenotypes observed in damselfly or if the mutations are acting in cis.

Primers

PCR Primer
damselfly_pcr_F: AGCAAAGCCCTACATTTATTTCCC
damselfly_pcr_R: ACCGCATGTCATGTGCATTG

Sequencing Primer
damselfly_seq_F: TTTCCCATACCACAGAGAAATGAAGG
damselfly_seq_R: TCAGATGGTCCTTAAAAAGTCAGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 554 nucleotides is amplified (chromosome 18, - strand):

1   accgcatgtc atgtgcattg gatattgatg gtgctattaa tatcagatgg tccttaaaaa
61  gtcagagtaa cttatatttc atagctcaaa gattttaact ttgtattcat gagtaggagt
121 ctaggaatga gttttaggaa attattctct caaaagatag tcagttgctt ttatcagatt
181 ctggtatcag ttgggggtta agaaaataat ttgagaaatc tgaagcactg gtgatgtctt
241 gtttcctagt tggtttgttc cctgtcttat ctctcatgtc tgtgtcagtg cacctgggca
301 attctctttc tgttttcttg ggcaggaatg aacgagttct agaggcaatg acagagagag
361 ctgaaatgga tgaggtcgaa cgcttccagc cacttctgga cggattaaaa agtgggacct
421 ctattgccct caaagtatgt atatgccctt aaatctgctc caacaggaaa atagagtaga
481 attgaaacgg aaagcccaga gttcacctgt ccttcatttc tctgtggtat gggaaataaa
541 tgtagggctt tgct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Rose, R., Weyand, M., Lammers, M., Ishizaki, T., Ahmadian, M. R., and Wittinghofer, A. (2005) Structural and Mechanistic Insights into the Interaction between Rho and Mammalian Dia. Nature. 435, 513-518.

  2. Li, F., and Higgs, H. N. (2003) The Mouse Formin mDia1 is a Potent Actin Nucleation Factor Regulated by Autoinhibition. Curr Biol. 13, 1335-1340.

  3. Bugyi, B., Papp, G., Hild, G., Lorinczy, D., Nevalainen, E. M., Lappalainen, P., Somogyi, B., and Nyitrai, M. (2006) Formins Regulate Actin Filament Flexibility through Long Range Allosteric Interactions. J Biol Chem. 281, 10727-10736.

  4. Peng, J., Kitchen, S. M., West, R. A., Sigler, R., Eisenmann, K. M., and Alberts, A. S. (2007) Myeloproliferative Defects Following Targeting of the Drf1 Gene Encoding the Mammalian Diaphanous Related Formin mDia1. Cancer Res. 67, 7565-7571.