Phenotypic Mutation 'koala'

• Allele: koala
• Mutation Type: unclassified (17 bp from exon)
• Chromosome: 1
• Coordinate: 90,861,022 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Mlph
• Gene Name: melanophilin
• Synonym(s): D1Wsu84e, Slac-2a
• Chromosomal Location: 90,842,807-90,878,864 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the exophilin subfamily of Rab effector proteins. The protein forms a ternary complex with the small Ras-related GTPase Rab27A in its GTP-bound form and the motor protein myosin Va. A similar protein complex in mouse functions to tether pigment-producing organelles called melanosomes to the actin cytoskeleton in melanocytes, and is required for visible pigmentation in the hair and skin. A mutation in this gene results in Griscelli syndrome type 3, which is characterized by a silver-gray hair color and abnormal pigment distribution in the hair shaft. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013] ; PHENOTYPE: Homozygous targeted null mutants affect viability and body size, and result in abnormal lungs, kidneys, immune system, hematopoiesis, myelopoiesis, and anomalies in cerebellar foliation and neuronal cell layer development. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000027528; Gene: ENSMUSG00000026303

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	8	125	2e-51	PFAM
low complexity region	147	160	N/A	INTRINSIC
PDB:4KP3|F	170	208	1e-18	PDB
low complexity region	379	406	N/A	INTRINSIC
Pfam:Rab_eff_C	437	501	1e-15	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000123314; Gene: ENSMUSG00000026303

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	10	98	1.3e-36	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.095)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 2016-05-13 3:09 PM by Anne Murray
• Record Created: unknown
• Record Posted: 2008-03-05
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Carrie N. Arnold, Bruce Beutler

Accession Number

NCBI RefSeq: NM_053015; MGI: 2176380

Alleles Listed at MGI

All alleles(5) : Targeted, other(1) Gene trapped(1) Spontaneous(1) Chemically induced(2)

Repository

none

Phenotypic Description

Koala was identified as a visible phenotype among ENU-induced G3 mutant mice.  Homozygous koala mice display a gray coat color and black eyes, as observed in concrete and new gray mutants.  Koala mice exhibit normal resistance to mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen) and to Listeria monocytogenes.

Nature of Mutation

The koala mutation mapped to Chromosome 1, and corresponds to an A to G transition at position 18194 in the genomic DNA sequence of the Mlph gene (Genbank genomic region NC_000067 for linear genomic DNA sequence of Mlph).  The mutation is located within intron 6, seventeen nucleotides upstream from the start of exon 7, and impairs the acceptor splice site of intron 6. Mlph cDNA from koala mice has not been sequenced; it is unknown how the mutation affects processing of the Mlph transcript.  Possibly, the acceptor splice site from intron 7 is utilized, resulting in skipping of exon 7 and causing a frame shift beginning with the first nucleotide of exon 8 (depicted below).  In this case, seventeen aberrant amino acids encoded by exon 8 (corresponding to positions 225-241) will be inserted before a premature stop codon.  However, it remains possible that an alternative sequence is used in place of the intron 6 acceptor splice site. Mlph contains 16 exons.

 

      <--exon 6          <--intron 6 exon 7-->  exon 8-->

16502 AGCCTGCAG……CTGACAGCATGTGTGCTCAGTCCCTCTCA……GAACAGACG……TGGCTGATGTAG 20260

222   -S--L--Q-                      -S--L--S-  -E--Q--T-……-W--L--M--*  241

       correct                        deleted         aberrant

 

The mutated nucleotide is indicated in red lettering; the acceptor splice site of intron 6 is indicated in blue lettering.  

Protein Prediction

Figure 1. Domain structure of melanophilin.  The Rab27-binding domain (R27BD) mediates binding to Rab27a and consists of two Slp homology domains (SHD) separated by a zinc finger motif.  The middle domain or myosin-binding domain (MBD) contains two regions that bind to the globular tail domain (GTBD) and the exon F-encoding region (EFBD) of myosin Va.  The actin-binding domain (ABD) binds to both F-actin and the microtubule plus end-binding protein EB1.  Two coiled coil domains (C1C2) are present in the ABD. This image is interactive; click to view other mutations in MLPH.

Mlph encodes three alternatively spliced transcripts that differ in their use of alternative poly(A) addition sites, and yield three transcripts of different sizes on Northern blots.  All three transcripts encode identical 590-amino acid proteins (Figure 1).  Melanophilin is a member of the Rab effector family that regulates the function of Rab proteins, GTPases that control multiple steps in the process of intracellular vesicular transport.  The melanophilin N terminus displays homology to the Rab effector domains of granuphilin-a and -b, synaptotagmin-like protein 3a (Slp3-a), and rabphilin-3A, proteins with putative roles in vesicle interactions with the cytoskeleton, vesicle docking, and fusion (1).  The Rab binding domain of melanophilin is approximately 146 amino acids in length and mediates specific binding to GTP-bound Rab27a (2-4).  The domain contains two zinc-binding CX₂CX_13,14CX₂C motifs with highly conserved cysteines flanked by two Slp homology domains (SHD1 and SHD2; also known as Rab27 binding domains, R27BD-1 and R27BD-2) (1).  In a crystal structure of the Rab27-binding domain (R27BD) of melanophilin in complex with Rab27b, the two SHDs form α-helical strutures that make specific contacts with Rab27a (38). Mutations disrupting zinc-binding are predicted to disrupt Rab-binding, as has been observed for rabphilin-3A (5).  The domain also contains a short aromatic acid-rich region (approximately six amino acids) at its C-terminus that mediates binding to Rab proteins (6).  The specific sequence of the six amino acid motif is thought to confer binding to distinct Rabs.  In melanophilin, this region consists of the sequence SLEWYY (residues 117-122) (1). 

 

Following the N-terminal Rab27-binding domain, melanophilin contains a middle domain with two distinct regions that interact with the globular tail (amino acids 147-240) and melanocyte-specific exon F region (amino acids 330-406) of myosin Va [Figure 1; (3;7-9)].  The entire middle domain (amino acids 147-406) is reported to exist in an intrinsically unstructured, unfolded state that lacks stable secondary structure and is therefore sensitive to proteolysis (10).  Finally, melanophilin contains a C-terminal F-actin (11;12) and endbinding protein 1 (EB1) interaction domain (13) (amino acids 401-590).  Melanophilin binds to the microtubule plus end-tracking protein EB1 and can link myosin Va to microtubule plus ends (13).

 

The koala mutation is predicted to impair the acceptor splice site of intron 6, but the consequence of such a mutation at the protein level is unknown.  Some use of an aberrant acceptor splice site may occur, yielding a transcript with inserted and/or deleted nucleotides.  If the acceptor splice site from intron 7 were utilized, skipping of exon 7 would occur, causing a frameshift, insertion of aberrant amino acids, and creation of a premature stop codon.  Exons 6 and 7 encode the C-terminal 21 amino acids of the myosin Va globular tail-binding region and most of the sequence between the two myosin Va binding regions.  The koala mutation would interrupt the normal protein sequence between the two myosin Va binding regions.

Expression/Localization

Mlph transcript is detected by Northern blot analysis in most adult tissues including brain, heart, kidney, liver, lung, skin, small intestine, spleen, stomach, testes and thymus (1).  The highest levels of expression appear to be in epithelial-enriched tissues such as kidney, lung, skin, small intestine and stomach.  During embryogenesis, Mlph mRNA is highly expressed at embryonic day 7 (E7), disappears by E11, and then is upregulated to low levels by E15 (1).

 

Melanophilin is localized on melanosome membranes through binding to Rab27a in its GTP-bound form (2;3).

Background

Melanins, the pigments for skin, hair and eyes, are synthesized in melanosomes.  Visible pigmentation in mammals requires the transfer of melanosomes from melanocytes where they are made, to keratinocytes.  For this transfer to occur, melanosomes must first be accumulated at the distal ends of melanocyte dendrites where exocytosis occurs.  Extensive study of three mouse coat color mutants (dilute, ashen and leaden) has greatly advanced the understanding of melanosome movement (Figure 2).  Melanosomes are transported in a bidirectional manner along microtubules, and their accumulation in the periphery depends on their capture and transfer, at the distal ends of dendrites, to actin filaments.

 

First identified in 1933, the leaden (ln) phenotype arose spontaneously in the C57BR strain and is characterized by a diluted coat color (14).  leaden is now known to be caused mutation of melanophilin (1).  The ashen (ash) and dilute (d) mice also have a light coat color, and exhibit exactly the same cellular phenotype as Mlph^ln mice (15;16).  In leaden, ashen and dilute melanocytes, melanosomes are synthesized normally, but cluster in the perinuclear region, resulting in uneven and impaired release of melanin (15-17).  The genes mutated in these three strains encode protein products that form a tripartite complex regulating the microtubule to actin filament transfer of melanosomes, a crucial step leading to melanosome exocytosis.  Ashen encodes the small GTPase Rab27a (18) (mutated in concrete) and dilute encodes myosin Va, the heavy chain of myosin V, a plus-end directed actin-based molecular motor (19) (mutated in new gray, nut, silver decerebrate, and silver decerebrate 2).  Melanophilin links melanosome-bound Rab27a to myosin Va by directly binding both proteins (2-4;7-9).  Rab27a is a melanosome-resident protein (17;20), and myosin Va fails to localize to melanosomes in either ashen (8;17) or leaden melanocytes (9;21).  The tripartite complex forms on melanosomes after activation of Rab27a to its GTP-bound form, and mediates the transfer of melanosomes from a microtubule-based kinesin motor to the actin-based motor myosin V (3;4;8).  When this capture mechanism is lacking due to mutations in any of these three proteins, melanosomes redistribute along microtubules, and appear clustered in regions with high microtubule density, which is greatest near the central cytoplasm (15;16;22).  Although microtubule movement continues in mutant melanocytes, their failure to be captured prevents peripheral accumulation (15).  Initial hypotheses about the function of the melanophilin-EB1 interaction suggested that it facilitated the transfer of melanosomes from microtubule plus ends to actin filaments (13).  However, its function remains unknown, as the melanophilin-EB1 interaction is not required for melanosome accumulation in the dendrite periphery, or for melanophilin targeting to melanosomes (23;24).

 

The diluted coat color phenotype of Rab27a^ash, Myo5a^d and Mlph^ln mice can be rescued by the semi-dominant dilute suppressor (dsu) locus (25;26), which bears a mutation in the gene encoding melanoregulin (Mreg) (27).  The dsu locus has been demonstrated to function cell-autonomously in melanocytes; its protein product is not diffusible (28).  Interestingly, Mreg^dsu modulates hair pigment through a myosin Va-independent pathway, as demonstrated by its inability to restore proper melanosome transport/localization in both Myo5a^d/d and Myo5a-null melanocytes (27).  Instead, Mreg^dsu alters the incorporation of pigment into hair, decreasing the normal spacing between bands of pigment in the hair.  Mreg is a 214 amino acid vertebrate protein with no similarity to known motor proteins or transcription factors, and lacks any known functional domains (27).  Thus, the mechanism by which it regulates pigment incorporation into hair is yet unknown.  Recently, Mreg was shown to interact with peripherin-2, a tetraspanin protein regulating the formation of disk membranes, specialized organelles of photoreceptor rod cells (29).

 

A mutation in human MLPH has been identified in a patient with Griscelli syndrome type 3 (30) (OMIM #609227), characterized by partial albinism of the skin and hair, but without either neurologic or immunologic impairment that also accompany Griscelli syndromes type 1 and 2, respectively.  Mutations in MYO5A result in Griscelli syndrome type 1 (31) (OMIM #214450), while mutations in RAB27A cause Griscelli syndrome type 2 (32) (OMIM #607624).  The underlying mechanisms resulting in pigmentary dilution in humans with MLPH, MYO5A or RAB27A mutations are the same as those in mice.  In the case of RAB27A mutations and Griscelli syndrome type 2, cytotoxic T lymphocytes and natural killer cells are unable to degranulate (33;34).  However, the normal immune function of patients with myosin Va and melanophilin mutations strongly supports the idea that the Rab27a/melanophilin/myosin Va complex is specific for melanosome transport and does not contribute to lytic granule transport in immune cells (35;36).

Putative Mechanism

The koala mutation likely disrupts the melanophilin protein sequence in between the two myosin Va binding regions.  As discussed in Protein Prediction, the first region (amino acids 147-204) binds to the globular tail domain of myosin Va, while the second region (amino acids 320-406) binds to the portion of myosin Va encoded by the alternatively spliced melanocyte-specific exon F.  The exon F-binding site on melanophilin is required to rescue the melanosome transport defects of leaden melanocytes, and is thought to be a stronger binding site than the globular tail-binding region (37).  Furthermore, a mutation deleting only exon F of myosin Va has been shown to cause Griscelli syndrome type 3 in humans (30).  Together, these findings emphasize the importance of the interaction between melanophilin and the myosin Va exon F region for proper melanosome transport and subsequent release.  The middle domain (amino acids 147-403), containing both myosin Va binding sites, is reported to exist in an intrinsically unstructured and unfolded state lacking stable secondary structure (10).  Such a structure may be less constrained in its ability to “absorb” mutational errors, and be more permissive for mutations like koala that exist within the region.  However, the phenotype of koala mice, which appears to be as severe as that of leaden mice, may suggest that Mlph^koala encodes a severely affected protein that is completely unable to bind myosin Va, either because of premature truncation or a frameshift that abrogates the binding domain.

Primers

Primers cannot be located by automatic search.

Genotyping

Koala genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Koala(F): 5’-TTGCTGGACTGAGCTGGAACAC-3’

Koala(R): 5’-TCTGCCCAATTTAACTGCTGAACCC-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Koala_seq(F): 5’- TTCAACCTGAATGAGCCTGG-3’

Koala_seq(R): 5’- TTCCCTATACCAGAGGCAGTGAG-3’

 

The following sequence of 1230 nucleotides (from Genbank genomic region NC_000067 for linear DNA sequence of Mlph) is amplified:

 

17660                     t tgctggactg agctggaaca cagaagtcag cccctaaggg

17701 aactgccctc caaccctccc tttcccaaaa gccatgtcac tcccccagct aagattaaac

17761 tgtaaagatg ctgcaacagt ggcctctggg agccctgaat accaagatcc catgaggatg

17821 gtggcaccat gcagaccccc tcagtctaag ggcaacctgc tcaggaaacc tcacctctac

17881 cctttgacct ctgaccatca aggattgcta aagtagacac agttaccatg tcctctccca

17941 agaagtaaaa atctccacaa gagtgttttc aaggcttcaa cctgaatgag cctgggcccc

18001 tggctgttca gaaatacatc tgtctcctgt atgatgcctg ggcacggtgt cccagggaac

18061 cccagtgtca cagacgtgaa gcagaagggt gttaagtgct cttggcagtg actgaagata

18121 gagaggaata gcacgctgcc agagcagatg gctgtctagt gttcagtcgg taaccctgga

18181 gcagccaaag ctgacagcat gtgtgctcag tccctctcag gtgagcccta ctctgaggac

18241 accacctctc tggagcccga gggcctagag gagactggtg caagggcttt gggatgtcat

18301 cccagtcctg aagtgcagcc atgtagccct ttaccctctg gggaggatgc tcacgctgaa

18361 ctggactcgc ctgcagcatc ctgcaagagt gcctttggga ccacagctat gcctggtagg

18421 tactccagcc gacctctttc tgagatatgg ggagggggca ttgaggaagg gaggcatccc

18481 taagaagcaa gcccctcccc tagtttacat aggcagatta attcttttag tgtaactggc

18541 ctccagcaaa cctcagagac cctttcttcc ctgggctcag tgcttccctg tgatacctgg

18601 aactatcagg aaaggggcta aactgtcccc agctcactgc ctctggtata gggaagagaa

18661 ctgtcattcc ctcaaaacaa ctacggtacc accaagtcta aagttccact ggaagatcag

18721 tagagcaggt cccacctagg agcctgtaag ctactcatca ggagacagag agcaagagaa

18781 ggaaactggt tccattagat tttatcagaa atttcagctt ccaaatgaaa tccccaaacc

18841 tgtgcccaag ggggctgatg ttctgggttc agcagttaaa ttgggcaga

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.

References

1.  Matesic, L. E., Yip, R., Reuss, A. E., Swing, D. A., O'Sullivan, T. N., Fletcher, C. F., Copeland, N. G., and Jenkins, N. A. (2001) Mutations in Mlph, encoding a member of the Rab effector family, cause the melanosome transport defects observed in leaden mice, Proc. Natl. Acad. Sci. U. S. A 98, 10238-10243.

2.  Kuroda, T. S., Fukuda, M., Ariga, H., and Mikoshiba, K. (2002) The Slp homology domain of synaptotagmin-like proteins 1-4 and Slac2 functions as a novel Rab27A binding domain, J. Biol. Chem. 277, 9212-9218.

3.  Strom, M., Hume, A. N., Tarafder, A. K., Barkagianni, E., and Seabra, M. C. (2002) A family of Rab27-binding proteins. Melanophilin links Rab27a and myosin Va function in melanosome transport, J Biol. Chem. 277, 25423-25430.

4.  Fukuda, M., Kuroda, T. S., and Mikoshiba, K. (2002) Slac2-a/melanophilin, the missing link between Rab27 and myosin Va: implications of a tripartite protein complex for melanosome transport, J Biol. Chem. 277, 12432-12436.

5.  Stahl, B., Chou, J. H., Li, C., Sudhof, T. C., and Jahn, R. (1996) Rab3 reversibly recruits rabphilin to synaptic vesicles by a mechanism analogous to raf recruitment by ras, EMBO J. 15, 1799-1809.

6.  Ostermeier, C. and Brunger, A. T. (1999) Structural basis of Rab effector specificity: crystal structure of the small G protein Rab3A complexed with the effector domain of rabphilin-3A, Cell 96, 363-374.

7.  Fukuda, M. and Kuroda, T. S. (2004) Missense mutations in the globular tail of myosin-Va in dilute mice partially impair binding of Slac2-a/melanophilin, J. Cell Sci. 117, 583-591.

8.  Wu, X., Wang, F., Rao, K., Sellers, J. R., and Hammer, J. A., III (2002) Rab27a is an essential component of melanosome receptor for myosin Va, Mol. Biol. Cell 13, 1735-1749.

9.  Wu, X. S., Rao, K., Zhang, H., Wang, F., Sellers, J. R., Matesic, L. E., Copeland, N. G., Jenkins, N. A., and Hammer, J. A., III (2002) Identification of an organelle receptor for myosin-Va, Nat. Cell Biol. 4, 271-278.

10.  Geething, N. C. and Spudich, J. A. (2007) Identification of a minimal myosin Va binding site within an intrinsically unstructured domain of melanophilin, J. Biol. Chem. 282, 21518-21528.

11.  Fukuda, M. and Kuroda, T. S. (2002) Slac2-c (synaptotagmin-like protein homologue lacking C2 domains-c), a novel linker protein that interacts with Rab27, myosin Va/VIIa, and actin, J. Biol. Chem. 277, 43096-43103.

12.  Kuroda, T. S., Ariga, H., and Fukuda, M. (2003) The actin-binding domain of Slac2-a/melanophilin is required for melanosome distribution in melanocytes, Mol. Cell Biol. 23, 5245-5255.

13.  Wu, X. S., Tsan, G. L., and Hammer, J. A., III (2005) Melanophilin and myosin Va track the microtubule plus end on EB1, J. Cell Biol. 171, 201-207.

14.  Murray, J. M. (1933) "Leaden", a recent coat color mutation in the house mouse, Am Naturalist 67, 278-283.

15.  Wu, X., Bowers, B., Rao, K., Wei, Q., and Hammer, J. A., III (1998) Visualization of melanosome dynamics within wild-type and dilute melanocytes suggests a paradigm for myosin V function In vivo, J Cell Biol. 143, 1899-1918.

16.  Provance, D. W., Jr., Wei, M., Ipe, V., and Mercer, J. A. (1996) Cultured melanocytes from dilute mutant mice exhibit dendritic morphology and altered melanosome distribution, Proc. Natl. Acad. Sci. U. S. A 93, 14554-14558.

17.  Hume, A. N., Collinson, L. M., Rapak, A., Gomes, A. Q., Hopkins, C. R., and Seabra, M. C. (2001) Rab27a regulates the peripheral distribution of melanosomes in melanocytes, J Cell Biol. 152, 795-808.

18.  Wilson, S. M., Yip, R., Swing, D. A., O'Sullivan, N., Zhang, Y., Novak, E. K., Swank, R. T., Russel, L. B., Copeland, N. G., and Jenkins, N. A. (2000) A mutation in Rab27a causes the vesicle transport defects observed in ashen mice, Proc. Natl. Acad. Sci. USA 97, 7933-7938.

19.  Mercer, J. A., Seperack, P. K., Strobel, M. C., Copeland, N. G., and Jenkins, N. A. (1991) Novel myosin heavy chain encoded by murine dilute coat colour locus, Nature 349, 709-713.

20.  Wu, X., Rao, K., Bowers, M. B., Copeland, N. G., Jenkins, N. A., and Hammer, J. A., III (2001) Rab27a enables myosin Va-dependent melanosome capture by recruiting the myosin to the organelle, J Cell Sci. 114, 1091-1100.

21.  Provance, D. W., James, T. L., and Mercer, J. A. (2002) Melanophilin, the product of the leaden locus, is required for targeting of myosin-Va to melanosomes, Traffic. 3, 124-132.

22.  Koyama, Y. I. and Takeuchi, T. (1981) Ultrastructural observations on melanosome aggregation in genetically defective melanocytes of the mouse, Anat. Rec. 201, 599-611.

23.  Hume, A. N., Ushakov, D. S., Tarafder, A. K., Ferenczi, M. A., and Seabra, M. C. (2007) Rab27a and MyoVa are the primary Mlph interactors regulating melanosome transport in melanocytes, J. Cell Sci. 120, 3111-3122.

24.  Wu, X., Sakamoto, T., Zhang, F., Sellers, J. R., and Hammer, J. A., III (2006) In vitro reconstitution of a transport complex containing Rab27a, melanophilin and myosin Va, FEBS Lett. 580, 5863-5868.

25.  Moore, K. J., Swing, D. A., Rinchik, E. M., Mucenski, M. L., Buchberg, A. M., Copeland, N. G., and Jenkins, N. A. (1988) The murine dilute suppressor gene dsu suppresses the coat-color phenotype of three pigment mutations that alter melanocyte morphology, d, ash and ln, Genetics 119, 933-941.

26.  Sweet, H. O. (1983) Dilute suppressor, a new suppressor gene in the house mouse, J Hered 74, 305-306.

27.  O'Sullivan, T. N., Wu, X. S., Rachel, R. A., Huang, J. D., Swing, D. A., Matesic, L. E., Hammer, J. A., III, Copeland, N. G., and Jenkins, N. A. (2004) dsu functions in a MYO5A-independent pathway to suppress the coat color of dilute mice, Proc. Natl. Acad. Sci. U. S. A 101, 16831-16836.

28.  Moore, K. J., Swing, D. A., Copeland, N. G., and Jenkins, N. A. (1994) The murine dilute suppressor gene encodes a cell autonomous suppressor, Genetics 138, 491-497.

29.  Boesze-Battaglia, K., Song, H., Sokolov, M., Lillo, C., Pankoski-Walker, L., Gretzula, C., Gallagher, B., Rachel, R. A., Jenkins, N. A., Copeland, N. G., Morris, F., Jacob, J., Yeagle, P., Williams, D. S., and mek-Poprawa, M. (2007) The tetraspanin protein peripherin-2 forms a complex with melanoregulin, a putative membrane fusion regulator, Biochemistry 46, 1256-1272.

30.  Menasche, G., Ho, C. H., Sanal, O., Feldmann, J., Tezcan, I., Ersoy, F., Houdusse, A., Fischer, A., and de Saint, B. G. (2003) Griscelli syndrome restricted to hypopigmentation results from a melanophilin defect (GS3) or a MYO5A F-exon deletion (GS1), J. Clin. Invest 112, 450-456.

31.  Pastural, E., Barrat, F. J., Dufourcq-Lagelouse, R., Certain, S., Sanal, O., Jabado, N., Seger, R., Griscelli, C., Fischer, A., and de Saint, B. G. (1997) Griscelli disease maps to chromosome 15q21 and is associated with mutations in the myosin-Va gene, Nat. Genet. 16, 289-292.

32.  Menasche, G., Pastural, E., Feldmann, J., Certain, S., Ersoy, F., Dupuis, S., Wulffraat, N., Bianchi, D., Fischer, A., Le, D. F., and de Saint, B. G. (2000) Mutations in RAB27A cause Griscelli syndrome associated with haemophagocytic syndrome, Nat. Genet. 25, 173-176.

33.  Stinchcombe, J. C., Barral, D. C., Mules, E. H., Booth, S., Hume, A. N., Machesky, L. M., Seabra, M. C., and Griffiths, G. M. (2001) Rab27a is required for regulated secretion in cytotoxic T lymphocytes, J Cell Biol. 152, 825-834.

34.  Haddad, E. K., Wu, X., Hammer, J. A., III, and Henkart, P. A. (2001) Defective granule exocytosis in Rab27a-deficient lymphocytes from Ashen mice, J Cell Biol. 152, 835-842.

35.  Menasche, G., Ho, C. H., Sanal, O., Feldmann, J., Tezcan, I., Ersoy, F., Houdusse, A., Fischer, A., and de Saint, B. G. (2003) Griscelli syndrome restricted to hypopigmentation results from a melanophilin defect (GS3) or a MYO5A F-exon deletion (GS1), J Clin. Invest 112, 450-456.

36.  Anikster, Y., Huizing, M., Anderson, P. D., Fitzpatrick, D. L., Klar, A., Gross-Kieselstein, E., Berkun, Y., Shazberg, G., Gahl, W. A., and Hurvitz, H. (2002) Evidence that Griscelli syndrome with neurological involvement is caused by mutations in RAB27A, not MYO5A, Am. J Hum. Genet. 71, 407-414.

37.  Hume, A. N., Tarafder, A. K., Ramalho, J. S., Sviderskaya, E. V., and Seabra, M. C. (2006) A coiled-coil domain of melanophilin is essential for Myosin Va recruitment and melanosome transport in melanocytes, Mol. Biol. Cell 17, 4720-4735.

38.  Kukimoto-Niino, M., Sakamoto, A., Kanno, E., Hanawa-Suetsugu, K., Terada, T., Shirouzu, M., Fukuda, M., and Yokoyama, S. (2008) Structural Basis for the Exclusive Specificity of Slac2-a/melanophilin for the Rab27 GTPases. Structure. 16, 1478-1490.