Phenotypic Mutation 'Roomba'

• Allele: Roomba
• Mutation Type: critical splice donor site
• Chromosome: 3
• Coordinate: 135,318,173 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Nfkb1
• Gene Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
• Synonym(s): p50, p50/p105, NF-kappaB, nuclear factor kappaB p50, NF kappaB1, p50 subunit of NF kappaB, NF-kappaB p50
• Chromosomal Location: 135,290,416-135,397,308 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016] ; PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000029812 ^†] [ENSMUSP00000128345 ^†] [ENSMUSP00000143601 ^†] † probably from a misspliced transcript
• AlphaFold: P25799
• SMART Domains: Protein: ENSMUSP00000029812; Gene: ENSMUSG00000028163

Domain	Start	End	E-Value	Type
Pfam:RHD	42	240	2.9e-75	PFAM
IPT	247	348	1.14e-22	SMART
low complexity region	368	414	N/A	INTRINSIC
ANK	538	568	2.27e1	SMART
ANK	577	606	1.11e-2	SMART
ANK	610	640	2.47e0	SMART
ANK	646	675	5.53e-3	SMART
ANK	680	710	1.9e-1	SMART
ANK	714	743	2.18e-1	SMART
DEATH	801	888	1.9e-19	SMART
low complexity region	890	902	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000114798; Gene: ENSMUSG00000028163

Domain	Start	End	E-Value	Type
low complexity region	8	54	N/A	INTRINSIC
Blast:IPT	55	156	4e-22	BLAST
ANK	178	208	2.27e1	SMART
ANK	217	246	1.11e-2	SMART
ANK	250	280	2.47e0	SMART
ANK	286	315	5.53e-3	SMART
ANK	320	350	1.9e-1	SMART
ANK	354	383	2.18e-1	SMART
Blast:DEATH	441	505	1e-34	BLAST
PDB:2DBF|A	442	505	5e-32	PDB

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000128345; Gene: ENSMUSG00000028163

Domain	Start	End	E-Value	Type
Pfam:RHD_DNA_bind	42	240	2.9e-75	PFAM
IPT	247	348	1.14e-22	SMART
low complexity region	368	414	N/A	INTRINSIC
ANK	538	568	2.27e1	SMART
ANK	577	606	1.11e-2	SMART
ANK	610	640	2.47e0	SMART
ANK	646	675	5.53e-3	SMART
ANK	680	710	1.9e-1	SMART
ANK	714	743	2.18e-1	SMART
DEATH	801	888	1.9e-19	SMART
low complexity region	890	902	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000143601; Gene: ENSMUSG00000028163

Domain	Start	End	E-Value	Type
Pfam:RHD_DNA_bind	42	90	2.5e-19	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9486
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:39 PM by Diantha La Vine
• Record Created: 2017-07-06 2:21 PM by Bruce Beutler
• Record Posted: 2017-08-18
• Science Writers: Anne Murray
• Authors: Jin Huk Choi, Tao Yue, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008689; MGI:97312

Alleles Listed at MGI

All alleles(83) : Chemically induced (ENU)(1) Chemically induced (other)(1) Gene trapped(74) Radiation induced(1) Targeted(6)

Phenotypic Description

Figure 1. Roomba mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Roomba mice exhibited reduced total IgE levels in the serum. IgE levels were determined by ELISA. Normalized log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Roomba mice exhibit decreased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Roomba phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R5262, some of which exhibited a diminished T-dependent IgG response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 1). Some mice exhibited reduced total IgE levels in the serum (Figure 2) as well as reduced frequencies of central memory CD8 T cells in CD8 T cells in the peripheral blood (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced total IgE in the serum using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R5262. Log phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Nfkb1: T to A transversion at base pair 135,612,412 (v38) on chromosome 3, corresponding to base pair 79,571 in the GenBank genomic region NC_000069 within the donor splice site of intron 12. The strongest association was found with an additive model of inheritance to the total IgE phenotype (P = 5.979 x 10^-8), wherein two affected variant homozygotes departed phenotypically from 10 homozygous reference mice and 11 heterozygous mice (Figure 4).

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in skipping of the 139-nucleotide exon 12 (out of 25 total exons), resulting in a frame-shifted protein product beginning after amino acid 306 of the protein and premature termination after the inclusion of 80 aberrant amino acids.

<--exon 11      <--exon 12 intron 12-->       exon 13-->      <--exon 15 78321 ……GTTCATAGACAG ……CCTGAAATCAAAG gtacctgggtggttta…… ACAAAGAGGAAG…… ……GCACCATAA…… 86746 303   ……-V--H--R--Q- ……-P--E--I--K--                    -T--K--R--K-…… ……-A--P--*-          correct        deleted                               aberrant

Genomic sequence and numbering corresponds to NC_000069. The donor splice site of intron 12, which is destroyed by the Roomba mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 5. The NF-κB and IκB families. The nuclear-κB family consists of five members: REL (c-Rel), RelA (p65), RelB, p105/p50 (NF-κB1), and p100/p52 (NF-κB2; see the record for xander ). They share a conserved N-terminal Rel-homology domain (RHD), which contains the dimerization, nuclear translocation, and DNA binding motifs. c-Rel, RelA, and RelB also have non-homologous C-terminal transactivation domains, and RelB contains an additional leucine zipper (shown in orange). These factors dimerized in various combinations to form NF-κB transcription factor complexes. The inhibitor of NF-κB (IκB) family contains the classical IκBs (IκBα , IκBβ, and IκBε), the NF-κB precursors (p105 and p100), as well as B-cell lymphoma 3 (BCL-3), IκBζ, and IκB NS . These proteins are characterized by an ankyrin domain that contains five to seven ankyrin repeats and are able to bind to and inhibit the NF-κB RHDs. Exceptions are BCL-3 and IκBζ, which are able to bind p50 and p52 homodimers and induce transcription. Cleavage of p105 and p100 generates the p50 and p52 NF-κB, respectively. p105 also generates IκBγ (not shown).

Figure 6. Domain organization of NF-κB1. The p105 precursor and p50 are both shown. The protein has an N-terminal Rel homology domain (RHD), a glycine rich region (GRR), an ankyrin repeat domain (ARD), a death domain (DD), and a PEST motif. The location of the Roomba mutation is indicated in red. This image is interactive. Other mutations found in the protein are noted in red. Click on each mutation for more information.

NF-κB1 (alternatively, p50/p105) is a member of the NF-κB protein family that are characterized by an N-terminal Rel homology domain (RHD), a glycine rich region (GRR), an ankyrin repeat domain (ARD), a death domain (DD), and a PEST motif [Figure 5 & 6; reviewed in (1)]. The p105 precursor protein can be proteolytically processed to generate p50 (i.e., amino acids 1-430 of p105). The RHD (amino acids 42-240, SMART) is comprised of the N-terminal domain, the dimerization domain (DimD), and a nuclear localization sequence that mediate DNA binding, nuclear localization, and subunit dimerization [reviewed in (1)]. The p50 RHD mediates co-translational dimerization with p105 and this dimerization is necessary for efficient p50 production (2;3). The GRR (amino acids 400-475 (4); 370-392, UniProt) is essential for the constitutive processing of p105 to p50 as well as for stabilization of the p50 subunit (2;5;6). Cohen et al. described a processing inhibitory domain (PID; aa 474-544) downstream of the GRR and upstream of the ARD that functions to regulate the constitutive processing of p105 (7). The ARD is at the C-terminus of p105 (amino acids 507-743, SMART) and has seven ankyrin motifs [reviewed in (1)]. The DD of p105 (aa 801-888, UniProt) is essential for IKK1 and IKK2-mediated phosphorylation of the p105 PEST motif by acting as a docking site for IKK (8;9). The PEST motif contains a conserved motif (Asp-Ser927-Gly-Val-Gly-Thr-Ser932) homologous to the IKK target sequence in IκBα [reviewed in (10)]. The Roomba mutation results in skipping of exon 12, followed by a frame-shifted protein after amino acid 306 and premature termination after the inclusion of 80 aberrant amino acids.

For more information about Nfkb1, please see the record for Finlay.

Putative Mechanism

NF-κB1 (p50 and p105) can form homodimers or heterodimers with c-Rel, RelA (p65), NF-κB2 (p52 and its precursor p100; see the record for xander), or RelB (11). The p105 precursor can act as an inhibitor of NF-κB dimers through both a direct dimerization to the NF-κB polypeptides as well as through interactions with preformed dimers (12). After agonist stimulation, p105 is degraded, facilitating the release of associated Rel subunits (i.e., RelA, c-Rel, and p50) and the translocation of the Rel subunits from the cytoplasm into the nucleus; RelB is not retained in the cytoplasm by p105 (13-16). In addition, p105 and IκBγ can associate with NF-κB dimers and prevent them from translocating to the nucleus (17). The p50 homodimer can bind to both nucleosomal DNA as well as naked DNA, facilitating the regulation of genes at sites of transcriptionally repressed chromatin as well as genes found in transcriptionally active chromatin (18). Depending on the cell type, the p50 homodimer can act as either a transcriptional activator or a repressor [reviewed in (10)]. The p50 homodimer typically binds DNA in unstimulated cells to repress NF-κB-dependent gene transcription (19). After stimulation, p50 homodimers can also function as transcriptional activators by an association of the homodimer with transcriptional co-activators.

 A variety of stimuli (e.g., cytokines, ultraviolet irradiation, and viral products) activate NF-κB complexes and the translocation of the activated complexes to the nucleus. In the nucleus, NF-κB acts as a transcription factor that regulates the expression of genes encoding a variety of immune response genes including pro-inflammatory cytokines (e.g., TNFα (see the record for PanR1), IL-1, and IL-6), chemokines [e.g., MIP-1α (macrophage inflammatory protein-1α) and RANTES (regulated upon activation, normal T-cell expressed and secreted)], cell adhesion molecules [e.g., E-selectin and VCAM-1 (vascular cell adhesion molecule-1)], effector molecules [e.g., defensins], enzymes [e.g., inducible nitric oxide synthase], and growth factors to regulate the recruitment of immune cells to the site of infection [(20;21); reviewed in (10)]. Inhibition of NF-κB leads to apoptosis [through the misregulation of anti-apoptotic proteins (e.g., c-IAP-1/2, AI, Bcl-2 and Bcl-XL)], delayed cell growth, reduced cell proliferation [through negative regulation of cell cycle regulator cyclin D1 (22)] and incorrect immune cell development [reviewed in (23-25)]. Please see the record for xander for additional details about NF-κB signaling.

T-cell mediated activation of B cells is required for extra-follicular and follicular responses to alum-precipitated proteins that are often used in vaccine formulations (26). Alum-precipitated OVA (alumOVA) stimulates follicular helper T (TFh) cells in germinal centers as well as the subsequent induction of B cells to differentiate into plasma cells, memory B cells, or centroblasts (26).  OVA-specific CD4⁺ T cells develop into Th2 cells that can subsequently induce extrafollicular plasmablasts. NF-κB1-deficient CD4⁺ T cells primed with alum-precipitated protein were unable to upregulate Th2-cytokines IL-4 and IL-13 (26).  In addition, Nfkb1^-/- TFh cells have impaired CXCR5 expression, leading to reduced germinal center responses (26).  The loss of a T-dependent IgG response to rSFV-β-gal indicates that the Roomba mutation results in loss of functional p50/p105.

Primers

PCR Primer
Roomba_pcr_F: GTCTAAGTCTCATATAAGTTTGGCAGC
Roomba_pcr_R: CTGATGCTCACCGACACTAG

Sequencing Primer
Roomba_seq_F: CCTAACACTATGCAGCGT
Roomba_seq_R: CAAATGTCCTACACTAATGTTTGGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 409 nucleotides is amplified (chromosome 3, - strand):

1   ctgatgctca ccgacactag aaaacaaatg tcctacacta atgtttgggt cttttgcacc
61  ctgcagtttg ccattgtctt caaaacgcca aagtataagg atgtcaacat tacaaagcca
121 gcttccgtgt ttgttcagct tcggaggaaa tcagacctgg aaactagtga accgaaaccc
181 tttctctact accctgaaat caaaggtacc tgggtggttt agactcttgt gcttgctctg
241 aaagaccagt gggcccctcc tctactcagc ctcccagaag ctgctgcctg gatgcctgga
301 tgcacgctgc atagtgttag gggcaaggaa ggtcatatgc caaggtcatg gaattagccc
361 caggaattta tgttactata ttgctgccaa acttatatga gacttagac

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Pereira, S. G., and Oakley, F. (2008) Nuclear Factor-kappaB1: Regulation and Function. Int J Biochem Cell Biol. 40, 1425-1430.

  2. Lin, L., DeMartino, G. N., and Greene, W. C. (1998) Cotranslational Biogenesis of NF-kappaB p50 by the 26S Proteasome. Cell. 92, 819-828.

  3. Lin, L., DeMartino, G. N., and Greene, W. C. (2000) Cotranslational Dimerization of the Rel Homology Domain of NF-kappaB1 Generates p50-p105 Heterodimers and is Required for Effective p50 Production. EMBO J. 19, 4712-4722.

  4. Lin, L., and Kobayashi, M. (2003) Stability of the Rel Homology Domain is Critical for Generation of NF-Kappa B p50 Subunit. J Biol Chem. 278, 31479-31485.

  5. Moorthy, A. K., Savinova, O. V., Ho, J. Q., Wang, V. Y., Vu, D., and Ghosh, G. (2006) The 20S Proteasome Processes NF-kappaB1 p105 into p50 in a Translation-Independent Manner. EMBO J. 25, 1945-1956.

  6. Lee, C., Schwartz, M. P., Prakash, S., Iwakura, M., and Matouschek, A. (2001) ATP-Dependent Proteases Degrade their Substrates by Processively Unraveling them from the Degradation Signal. Mol Cell. 7, 627-637.

  7. Cohen, S., Lahav-Baratz, S., and Ciechanover, A. (2006) Two Distinct Ubiquitin-Dependent Mechanisms are Involved in NF-kappaB p105 Proteolysis. Biochem Biophys Res Commun. 345, 7-13.

  8. Beinke, S., Belich, M. P., and Ley, S. C. (2002) The Death Domain of NF-Kappa B1 p105 is Essential for Signal-Induced p105 Proteolysis. J Biol Chem. 277, 24162-24168.

  9. Heissmeyer, V., Krappmann, D., Wulczyn, F. G., and Scheidereit, C. (1999) NF-kappaB p105 is a Target of IkappaB Kinases and Controls Signal Induction of Bcl-3-p50 Complexes. EMBO J. 18, 4766-4778.

  10. Beinke, S., and Ley, S. C. (2004) Functions of NF-kappaB1 and NF-kappaB2 in Immune Cell Biology. Biochem J. 382, 393-409.

  11. Urban, M. B., Schreck, R., and Baeuerle, P. A. (1991) NF-Kappa B Contacts DNA by a Heterodimer of the p50 and p65 Subunit. EMBO J. 10, 1817-1825.

  12. Savinova, O. V., Hoffmann, A., and Ghosh, G. (2009) The Nfkb1 and Nfkb2 Proteins p105 and p100 Function as the Core of High-Molecular-Weight Heterogeneous Complexes. Mol Cell. 34, 591-602.

  13. Mercurio, F., DiDonato, J. A., Rosette, C., and Karin, M. (1993) P105 and p98 Precursor Proteins Play an Active Role in NF-Kappa B-Mediated Signal Transduction. Genes Dev. 7, 705-718.

  14. Solan, N. J., Miyoshi, H., Carmona, E. M., Bren, G. D., and Paya, C. V. (2002) RelB Cellular Regulation and Transcriptional Activity are Regulated by p100. J Biol Chem. 277, 1405-1418.

  15. Rice, N. R., MacKichan, M. L., and Israel, A. (1992) The Precursor of NF-Kappa B p50 has I Kappa B-Like Functions. Cell. 71, 243-253.

  16. Naumann, M., Wulczyn, F. G., and Scheidereit, C. (1993) The NF-Kappa B Precursor p105 and the Proto-Oncogene Product Bcl-3 are I Kappa B Molecules and Control Nuclear Translocation of NF-Kappa B. EMBO J. 12, 213-222.

  17. Perkins, N. D. (2007) Integrating Cell-Signalling Pathways with NF-kappaB and IKK Function. Nat Rev Mol Cell Biol. 8, 49-62.

  18. Angelov, D., Lenouvel, F., Hans, F., Muller, C. W., Bouvet, P., Bednar, J., Moudrianakis, E. N., Cadet, J., and Dimitrov, S. (2004) The Histone Octamer is Invisible when NF-kappaB Binds to the Nucleosome. J Biol Chem. 279, 42374-42382.

  19. Zhong, H., May, M. J., Jimi, E., and Ghosh, S. (2002) The Phosphorylation Status of Nuclear NF-Kappa B Determines its Association with CBP/p300 Or HDAC-1. Mol Cell. 9, 625-636.

  20. Chen, F., Castranova, V., Shi, X., and Demers, L. M. (1999) New Insights into the Role of Nuclear Factor-kappaB, a Ubiquitous Transcription Factor in the Initiation of Diseases. Clin Chem. 45, 7-17.

  21. Zhang, G., and Ghosh, S. (2001) Toll-Like Receptor-Mediated NF-kappaB Activation: A Phylogenetically Conserved Paradigm in Innate Immunity. J Clin Invest. 107, 13-19.

div>  22. Nakamura, Y., Grumont, R. J., and Gerondakis, S. (2002) NF-kappaB1 can Inhibit v-Abl-Induced Lymphoid Transformation by Functioning as a Negative Regulator of Cyclin D1 Expression. Mol Cell Biol. 22, 5563-5574.

  23. Karin, M., and Lin, A. (2002) NF-kappaB at the Crossroads of Life and Death. Nat Immunol. 3, 221-227.

  24. Barnes, P. J. (1997) Nuclear Factor-Kappa B. Int J Biochem Cell Biol. 29, 867-870.

  25. Barnes, P. J., and Karin, M. (1997) Nuclear Factor-kappaB: A Pivotal Transcription Factor in Chronic Inflammatory Diseases. N Engl J Med. 336, 1066-1071.

  26. Serre, K., Mohr, E., Benezech, C., Bird, R., Khan, M., Caamano, J. H., Cunningham, A. F., and Maclennan, I. C. (2011) Selective Effects of NF-kappaB1 Deficiency in CD4(+) T Cells on Th2 and TFh Induction by Alum-Precipitated Protein Vaccines. Eur J Immunol. 41, 1573-1582.