Phenotypic Mutation 'stamper-coat'

• Allele: stamper-coat
• Mutation Type: missense
• Chromosome: 19
• Coordinate: 45,992,275 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Hps6
• Gene Name: HPS6, biogenesis of lysosomal organelles complex 2 subunit 3
• Synonym(s): BLOC-2, ruby eye, 5330434M19Rik, Hermansky-Pudlak syndrome 6, ru
• Chromosomal Location: 45,991,947-45,994,612 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 5 protein. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 6. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutations in this gene result in hypopigmented hair and eyes, and increased clotting time due to a platelet dense granule defect. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tryptophan changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q8BLY7
• SMART Domains: Protein: ENSMUSP00000096991; Gene: ENSMUSG00000074811; AA Change: W71R

Domain	Start	End	E-Value	Type
Pfam:HPS6	1	772	1e-281	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000099393)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 036767-MU
• Last Updated: 2019-04-01 11:19 AM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2008-08-11
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Celine Eidenschenk, Bruce Beutler

Accession Number

NCBI RefSeq: NM_176785; MGI: 2181763

Alleles Listed at MGI

All alleles(9) : Spontaneous(8) Chemically induced(1)

Phenotypic Description

Stamper-coat was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals as an extremely subtle hypopigmentation mutant in the stamper stock, which was originally flagged for mild susceptibility to mouse cytomegalovirus (MCMV; stamper-immunologic).  From the same stock, other phenotypes have also segregated including a hyperactivity phenotype most often seen in females (stamper-neurologic), and the zigzag phenotype (identified as a mutation in Lfng).  Stamper-coat mice display normal MCMV resistance (see MCMV Susceptibility and Resistance Screen) and natural killer (NK) cell degranulation (see NK Cytotoxicity Protocol).  Stamper-coat mice are allelic to ruby-eye mice (1).

Nature of Mutation

The stamper-coat mutation was mapped to Chromosome 19, and corresponds to a T to A transversion at position 329 of the Hps6/ru transcript in the single exon.

 

314 CCGCTGGAGCGTGCCTGGCCGGAGGGCGACCCC

66  -P--L--E--R--A--W--P--E--G--D--P-

 

The mutated nucleotide is indicated in red lettering, and results in a tryptophan to arginine change at amino acid 71 in the HPS6 protein.

Protein Prediction

Figure 1. Components of the biogenesis of lysosomal-related organelle complex 2 (BLOC-2). All three proteins have been shown to co-immunoprecipitate, but only HPS5 and HPS6 bind together in two-hybrid studies suggesting the presence of unknown components of the complex (?). Figure is adapted from (39).

Mouse Hps6/ru encodes an 88.8-kDa protein of 805 amino acids.  The translated protein products of mouse Hps6 and its human homolog are 80% identical.  The human protein is 775 amino acids long.  The main difference between rodent and human species occurs at the C-terminus, where the rodent proteins have an extension of 31 residues (1). HPS6 forms part of the biogenesis of lysosome-related organelle complex 2 (BLOC-2; see Figure 1 and Background).

 

HPS6 homologues are not found in lower eukaryotes such as yeast, and do not contain known domains or motifs (1).

 

The stamper-coat mutation results in a tryptophan to arginine change at amino acid 71 of the HPS6 protein.  It is unknown whether this protein is expressed and localized normally.

Expression/Localization

Northern blot analysis in normal mice reveals Hps6 transcript in all tissues examined, including heart, brain, spleen, lung, liver, and kidney.  Levels were reduced in skeletal muscle (1).  HPS6 protein is present in brain, lung, spleen and heart extracts, and is probably ubiquitously expressed (2).

 

HPS6 can be immunoprecipitated from both membrane-associated and soluble fractions of cell lysates, suggesting that the BLOC-2 complex may be both cytosolic and membrane-associated (3).

Background

Hermansky-Pudlak syndrome (HPS; OMIM #203300) is a disorder with an array of clinical symptoms that are caused by alterations at numerous independent loci.  HPS is commonly characterized by oculocutaneous albinism (OCA), prolonged bleeding, and lysosomal hyposecretion.  In addition, subsets of patients exhibit pulmonary fibrosis, immunodeficiency, and inner-ear abnormalities.  Most of these conditions are known to arise from defects in the biogenesis and/or function of lysosome-related organelles, such as melanosomes and platelet dense granules (4).  These organelles are cell-type specific modifications of the post-Golgi endomembrane system, and may share various characteristics with lysosomes, such as integral membrane proteins and an acidic intralumenal pH (5).  At least eight types of human HPS have been described, and mutations affecting at least 15 loci in mice create HPS-like disease.  The human HPS loci and their mouse equivalents are as follows: HPS1/pale ear (6); HPS2/pearl (7);  HPS3/cocoa (8); HPS4/light ear (9); HPS5/ruby-eye 2 (1); HPS6/ruby-eye (1); HPS7/sandy (10); and HPS8/reduced pigmentation (11).

 

Figure 2. The HPS proteins form several protein complexes (AP-3, BLOC-1, BLOC-2, and BLOC-3) that are involved in trafficking of proteins to lysosomal-related organelles (LROs) from the TGN and affect the synthesis of these organelles.  Particular HPS complexes may affect only a subset of LROs (see text).  It is thought that BLOC-1 and AP-3 mediate early steps of vesicle trafficking from the early endosome, while BLOC-2 and BLOC-3 are likely involved at later stages.  Studies have shown physical interactions between BLOC-1 and AP-3, and BLOC-1 and BLOC-2. For simplicity, only the major cargo proteins affected by each HPS complex are shown (ATP7A, tyrosinase, Tyrp1, LAMP1).  The presence of ATP7A in maturing melanosomes allows the influx of copper and activates tyrosinase.  BLOC-1 is known to bind to the vesicle fusion protein syntaxin 13, which is localized to the stage I melanosome/coated endosome.  BLOC-2 and AP-3 may interact with clathrin.  Melanosomal maturation is shown separately, along with the stages affected by mutations in each HPS complex.  Mutations in the d subunit of the AP-3 complex affect melanosomal maturation between stages III and IV, but, as mentioned above, the AP-3 complex likely mediates early vesicle trafficking.

Most of the genes associated with HPS encode subunits of protein complexes involved in intracellular trafficking, and are important for the trafficking of lysosomes, lysosomal-related organelles or components of these organelles.  Based on biochemical studies, it has been proposed that HPS proteins assemble into four stable complexes, BLOCs (biogenesis of lysosome-related organelle complex) 1, 2, and 3, and the adaptor protein 3 (AP-3) complex (Figure 2).  Mutation of the β3A subunit of the AP-3 complex causes HPS2 (12-15) (mutated in bullet gray).  The following components make up the 200-230 kD BLOC-1 complex: pallidin, dysbindin (HPS7; mutated in salt and pepper), BLOC subunit 1 (BLOS1), BLOS2, BLOS3 (HPS8), cappuccino, muted (mutated in minnie), and snapin.  The proteins HPS3 (mutated in pam gray), HPS5 (mutated in toffee and dorian gray), and HPS6 comprise BLOC-2 (350 kD) (1-3).  BLOC-3 (175 kD) is composed of HPS1 and HPS4 (16;17).

 

All of the BLOC-2 components cause HPS in humans and HPS-like disease in mice.  While all HPS patients suffer from OCA and prolonged bleeding, different subtypes of HPS are now recognized by their distinct clinical features.  Only one HPS6 (OMIM *607522) patient has been identified, exhibiting oculocutaneous albinism and prolonged bleeding but no other symptoms (1).  Mild forms of HPS also occur in HPS5 and HPS3 patients (1;8;18;19).  Similarly, ruby-eye (ru), ruby-eye 2 (ru2), and cocoa mice, with mutations in Hps6, Hps5, and Hps3 respectively, all have very similar to identical phenotypes (1;2;20;21).  Ru mice are characterized by a diluted coat color that darkens with age, light eyes that darken with age to a ruby or maroon color, and platelet storage pool deficiency that causes prolonged bleeding time (22;23).  Although platelet numbers are normal, platelets are unable to accumulate dense granule contents resulting in decreased serotonin (24).  Melanosomes are decreased in number, and some have aberrant morphology in ru eye and skin cells (1;25).  In addition, mutant melanosomes are generally more spherical than oval in shape, probably indicating a block at more immature stages of melanosome maturation (25;26).  Ru mice have abnormally high concentrations of kidney lysosomal enzymes due to a decreased rate of lysosomal enzyme secretion from kidney to urine, despite normal kidney lysosome morphology (27).  In contrast, lysosomal secretion from ru skin fibroblasts is normal (3).  Both ru and ru2 mice exhibit reduced susceptibility to atherosclerosis compared to control mice after 14 weeks of maintenance on an atherogenic diet (28), an interesting finding in light of the increased serum cholesterol levels in human HPS5 patients (19).

 

Several lines of evidence suggest that HPS6, HPS5 and HPS3 are components of the BLOC-2 complex.  All three proteins coimmunoprecipitate, while in yeast two-hybrid experiments, HPS6 was found to bind HPS5 (1-3).  Similar interactions were not found for HPS3 in these studies, suggesting the presence of additional, unknown components of the complex (1;2).  Double homozygous combinations of Hps6, Hps5, and Hps3 animals exhibited identical phenotypes to each other and to single homozygotes.  Furthermore, HPS6 and HPS5 proteins are destabilized in protein extracts derived from mice mutated in Hps6, Hps5, and Hps3, but are not destabilized in protein extracts derived from other HPS mouse models (2).

Putative Mechanism

The precise molecular function of the BLOC-2 complex remains unknown.  In addition to a yet undefined role in regulating lysosome-related organelle secretion, recent studies suggest that both HPS3 and HPS5 may also regulate protein trafficking during the maturation of melanosomes (29-31).  Both tyrosinase (mutated in ghost) and Tyrp1 (tyrosinase-related protein 1) are reduced in HPS5 mutant melanocyte dendrites as measured by immunofluorescence and immunoelectron microscopy (31).  In HPS3 mutant melanocytes, tyrosinase, Tyrp1, and Tyrp2 (tyrosinase-related protein 2) were mislocalized, as were the lysosome associated membrane proteins, LAMP1 and LAMP3 (29;30).  In addition, HPS3, HPS5, and HPS6 mutant melanosomes are predominantly in the early stages of maturation, suggesting that improper trafficking of melanosome proteins impairs the normal maturation of this organelle (1;29;31;32).  In agreement with this hypothesis, BLOC-1 has been shown to physically interact with BLOC-2 to facilitate Tyrp1 trafficking (33).  Another study demonstrates that BLOC-1 regulates Tyrp1 exit from early endosomes toward melanosomes, but interestingly, BLOC-2 affects Tyrp1 trafficking to melanosomes from an endosomal compartment distinct and downstream from that regulated by BLOC-1 (34).  Furthermore, HPS3 is able to bind to clathrin, the main component of protein coats that assist in the formation of vesicles budding from the trans-Golgi network (TGN), plasma membrane, and endosomes (35).  Thus, accumulating evidence suggests a role for BLOC-2 in regulating selective cargo trafficking from endosomes to melanosomes.  The step(s) at which BLOC-2 functions and the compartments between which cargo is transferred remain to be more precisely defined. 

 

Mutations in some HPS proteins cause immunodeficiency.  For example, in HPS2, mutation of the β3A subunit of the AP-3 complex results in immunodeficiency because of defects in natural killer (NK) cells, cytotoxic T lymphocytes (CTLs) and neutrophils (see bullet gray) (12-15).  However, BLOC-1 complex mutant mice pallid, muted and sandy have normal CTL function, as measured by ability to kill targets (36), and patients with HPS7 and HPS8 do not display any immunological defects (10;11).  These results contrast with the MCMV susceptibility and impaired NK cell cytotoxicity of the salt and pepper mutation, which is allelic to sandy. A similar NK cell defect has been reported for pallid mice (37).  These results are similar to mixed immunological phenotypes seen in mice and patients mutant in BLOC-2 components.  HPS3/5/6 patients do not exhibit immunological defects and ru mice display normal CTL activity (1;8;18;19;36), consistent with the normal MCMV resistance seen in stamper-coat and pam gray  mice.  However, toffee mice defective in HPS5 are susceptible to infection by MCMV or Listeria monocytogenes, and ru mice are reported to have an increase in transient fusion events at the plasma membrane of mast cells, resulting in a depletion of secretory products (38).  It is likely this defect also causes the decreased quantities of intragranular components of platelet dense granules seen in Hps3, Hps5, and Hps6 mutants (21;24).

 

The subtle loss of pigmentation in stamper-coat animals suggests that the aberrant HPS6 protein retains some or most of its function.  Mouse mutants of BLOC-2 components typically have milder pigmentation defects than other HPS mouse models, consistent with the milder phenotypes seen in patients with HPS3, HPS5 and HPS6 (1;2;8;18;19).  It is unknown if the amino acid altered in stamper-coat animals is critical for HPS6 function.  The ru mutation results in loss of histidine, cysteine and proline at positions 187-189, and prevents the defective HPS6 protein from binding to HPS5 (2).  When each residue in this binding sequence was singly mutated to an alanine, binding between HPS5 and HPS6 remained intact, suggesting that the sequence only indirectly mediates the protein–protein interaction, perhaps by influencing secondary structural features.  The effect of substitutions at other residues on HPS6 function has not yet been analyzed.  

Primers

Primers cannot be located by automatic search.

Genotyping

Stamper-coat genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  

Primers for PCR amplification

Stampc(F): 5’- ATTCACCAGGGACGGAAGTGTCAG -3’

Stampc(R): 5’- GTGCCCGAAACATGCTGTTGTG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Stampc_seq(F): 5’- GGATCTGAGCAACTTCACCG -3’

Stampc_seq(R): 5’- GCCGTTGAAAGCTGCTCTG -3’

 

The following sequence of 1416 nucleotides (from Genbank genomic region NC_000085 for linear DNA sequence of Hps6) is amplified:

 

      6      attca ccagggacgg aagtgtcagc cctgcactcc cccgggtacc aggactagca
  61 gtccggcctc gccccactgg gcgatcaggc cttggctagc tcctgcggca gaggcgtcat
 121 gaagcgtgca ggaactctgc gcctgctttc ggatctgagc aacttcaccg gcgcggcccg
 181 gctccgcgag ttgttggcgg gggacccagc tgtcctagtc cgctgcagcc ctgacggccg
 241 ccacttgctg ctattaagac cccccggatc gcccgcccca cagcttctag tggctgtgcg
 301 tgggcccggc ctgccgctgg agcgtgcctg gccggagggc gacccctcgc cgctggacgt
 361 ctttttcgtg ccgtggctgg cgcgacccgc gctgatcttg gtatgggaga gtggcctagc
 421 agaggtttgg ggcgtgggga tggagcctgg atggaagcta cttcagagca ctgagctgtg
 481 tccggatggt ggagcccgcg tgatggccgt ggccgcaacc cgaggccgcc tagtttggtg
 541 cgaggagcgt cagccgggtg ttaaggacca accagagcag ctttcaacgg ccttcagcca
 601 ccgtgtgtgc ttcaagaccc tggaaaccag cggggaggct ggcaccaaac taggctgcac
 661 ccacatcctg ctacaccatt gccccctttt tggactgata gcctcccgca aggacctctt
 721 cctggtgcct actaccaaca cttggtctgg tgtggcccac cttctgctca tctggagccc
 781 aagcaagggg aaggtaatag ttgctgctcc atctcttggt ctttcacaca gtaaaagcct
 841 gaatcccaaa caaggggaca cttgggactt ccggaccctg ctgcgaggcc ttcctggatt
 901 cctgtccccc agggagccac tggctgtaca cacttgggcc ccatcttcgc agggcttgtt
 961 gttgcttgac ttgaaaggga aggtgagcct agtgcagtgc catggtggta ctcgaaccgt
1021 gggaatcctg caggaggccc ctgtaagcct aaaagggtct gcagccctgg ggacatttca
1081 cggcacttta gcctgtgtcc tgggctccac cttggaacta ctggacatga gcagtgggcg
1141 gctgttggaa aaaaaggttc tcagtacaga cagagtacat ttgctggagc ctccagcccc
1201 gggcatgaag aacgaggaag agctggagac ccgaggagcc ctacgattgc tttcagcctt
1261 gggtctcttt tgtgtgtgtt gggaaactcc ccaaggcctt gagctgcctt cagacaagga
1321 cctggtgttt gaggaggcct gtgggtacta ccagcgtcgg agccttcgag gtacccagct
1381 taccccagaa gaactgagac acaacagcat gtttcgggca c                                             

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1. Zhang, Q., Zhao, B., Li, W., Oiso, N., Novak, E. K., Rusiniak, M. E., Gautam, R., Chintala, S., O'Brien, E. P., Zhang, Y., Roe, B. A., Elliott, R. W., Eicher, E. M., Liang, P., Kratz, C., Legius, E., Spritz, R. A., O'Sullivan, T. N., Copeland, N. G., Jenkins, N. A., and Swank, R. T. (2003) Ru2 and Ru encode mouse orthologs of the genes mutated in human Hermansky-Pudlak syndrome types 5 and 6, Nat. Genet. 33, 145-153.

   2.  Gautam, R., Chintala, S., Li, W., Zhang, Q., Tan, J., Novak, E. K., Di Pietro, S. M., Dell'angelica, E. C., and Swank, R. T. (2004) The Hermansky-Pudlak syndrome 3 (cocoa) protein is a component of the biogenesis of lysosome-related organelles complex-2 (BLOC-2), J Biol. Chem. 279, 12935-12942.

   3.  Di Pietro, S. M., Falcon-Perez, J. M., and Dell'angelica, E. C. (2004) Characterization of BLOC-2, a complex containing the Hermansky-Pudlak syndrome proteins HPS3, HPS5 and HPS6, Traffic. 5, 276-283.

   4.  Di Pietro, S. M. and Dell'angelica, E. C. (2005) The cell biology of Hermansky-Pudlak syndrome: recent advances, Traffic. 6, 525-533.

   5.  Cutler, D. F. (2002) Introduction: lysosome-related organelles, Semin. Cell Dev. Biol. 13, 261-262.

   6.  Oh, J., Bailin, T., Fukai, K., Feng, G. H., Ho, L., Mao, J. I., Frenk, E., Tamura, N., and Spritz, R. A. (1996) Positional cloning of a gene for Hermansky-Pudlak syndrome, a disorder of cytoplasmic organelles, Nat. Genet. 14, 300-306.

   7.  Dell'angelica, E. C., Shotelersuk, V., Aguilar, R. C., Gahl, W. A., and Bonifacino, J. S. (1999) Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor, Mol. Cell 3, 11-21.

   8.  Anikster, Y., Huizing, M., White, J., Shevchenko, Y. O., Fitzpatrick, D. L., Touchman, J. W., Compton, J. G., Bale, S. J., Swank, R. T., Gahl, W. A., and Toro, J. R. (2001) Mutation of a new gene causes a unique form of Hermansky-Pudlak syndrome in a genetic isolate of central Puerto Rico, Nat. Genet. 28, 376-380.

   9.  Suzuki, T., Li, W., Zhang, Q., Karim, A., Novak, E. K., Sviderskaya, E. V., Hill, S. P., Bennett, D. C., Levin, A. V., Nieuwenhuis, H. K., Fong, C. T., Castellan, C., Miterski, B., Swank, R. T., and Spritz, R. A. (2002) Hermansky-Pudlak syndrome is caused by mutations in HPS4, the human homolog of the mouse light-ear gene, Nat. Genet. 30, 321-324.

 10.  Li, W., Zhang, Q., Oiso, N., Novak, E. K., Gautam, R., O'Brien, E. P., Tinsley, C. L., Blake, D. J., Spritz, R. A., Copeland, N. G., Jenkins, N. A., Amato, D., Roe, B. A., Starcevic, M., Dell'angelica, E. C., Elliott, R. W., Mishra, V., Kingsmore, S. F., Paylor, R. E., and Swank, R. T. (2003) Hermansky-Pudlak syndrome type 7 (HPS-7) results from mutant dysbindin, a member of the biogenesis of lysosome-related organelles complex 1 (BLOC-1), Nat. Genet. 35, 84-89.

 11.  Morgan, N. V., Pasha, S., Johnson, C. A., Ainsworth, J. R., Eady, R. A., Dawood, B., McKeown, C., Trembath, R. C., Wilde, J., Watson, S. P., and Maher, E. R. (2006) A germline mutation in BLOC1S3/reduced pigmentation causes a novel variant of Hermansky-Pudlak syndrome (HPS8), Am. J Hum. Genet. 78, 160-166.

 12.  Kotzot, D., Richter, K., and Gierth-Fiebig, K. (1994) Oculocutaneous albinism, immunodeficiency, hematological disorders, and minor anomalies: a new autosomal recessive syndrome?, Am. J. Med. Genet. 50, 224-227.

 13.  Jung, J., Bohn, G., Allroth, A., Boztug, K., Brandes, G., Sandrock, I., Schaffer, A. A., Rathinam, C., Kollner, I., Beger, C., Schilke, R., Welte, K., Grimbacher, B., and Klein, C. (2006) Identification of a homozygous deletion in the AP3B1 gene causing Hermansky-Pudlak syndrome, type 2, Blood 108, 362-369.

 14.  Huizing, M., Scher, C. D., Strovel, E., Fitzpatrick, D. L., Hartnell, L. M., Anikster, Y., and Gahl, W. A. (2002) Nonsense mutations in ADTB3A cause complete deficiency of the beta3A subunit of adaptor complex-3 and severe Hermansky-Pudlak syndrome type 2, Pediatr. Res. 51, 150-158.

 15.  Enders, A., Zieger, B., Schwarz, K., Yoshimi, A., Speckmann, C., Knoepfle, E. M., Kontny, U., Muller, C., Nurden, A., Rohr, J., Henschen, M., Pannicke, U., Niemeyer, C., Nurden, P., and Ehl, S. (2006) Lethal hemophagocytic lymphohistiocytosis in Hermansky-Pudlak syndrome type II, Blood 108, 81-87.

 16.  McNew, J. A. and Goodman, J. M. (1996) The targeting and assembly of peroxisomal proteins: some old rules do not apply, Trends Biochem. Sci. 21, 54-58.

 17.  Martina, J. A., Moriyama, K., and Bonifacino, J. S. (2003) BLOC-3, a protein complex containing the Hermansky-Pudlak syndrome gene products HPS1 and HPS4, J Biol. Chem. 278, 29376-29384.

 18.  Huizing, M., Anikster, Y., Fitzpatrick, D. L., Jeong, A. B., D'Souza, M., Rausche, M., Toro, J. R., Kaiser-Kupfer, M. I., White, J. G., and Gahl, W. A. (2001) Hermansky-Pudlak syndrome type 3 in Ashkenazi Jews and other non-Puerto Rican patients with hypopigmentation and platelet storage-pool deficiency, Am. J Hum. Genet 69, 1022-1032.

 19.  Huizing, M., Hess, R., Dorward, H., Claassen, D. A., Helip-Wooley, A., Kleta, R., Kaiser-Kupfer, M. I., White, J. G., and Gahl, W. A. (2004) Cellular, molecular and clinical characterization of patients with Hermansky-Pudlak syndrome type 5, Traffic. 5, 711-722.

 20.  Silvers, W. K. (1979) The Coat Colors of Mice.

 21.  Novak, E. K., Sweet, H. O., Prochazka, M., Parentis, M., Soble, R., Reddington, M., Cairo, A., and Swank, R. T. (1988) Cocoa: a new mouse model for platelet storage pool deficiency, Br. J Haematol. 69, 371-378.

 22.  Dunn, L. C. (1945) A New Eye Color Mutant in the Mouse with Asymmetrical Expression, Proc. Natl. Acad. Sci. U. S. A 31, 343-346.

 23.  Novak, E. K., Hui, S. W., and Swank, R. T. (1984) Platelet storage pool deficiency in mouse pigment mutations associated with seven distinct genetic loci, Blood 63, 536-544.

 24.  Reddington, M., Novak, E. K., Hurley, E., Medda, C., McGarry, M. P., and Swank, R. T. (1987) Immature dense granules in platelets from mice with platelet storage pool disease, Blood 69, 1300-1306.

 25.  Markert, C. L. and Silvers, W. K. (1956) The Effects of Genotype and Cell Environment on Melanoblast Differentiation in the House Mouse, Genetics 41, 429-450.

 26.  Nguyen, T., Novak, E. K., Kermani, M., Fluhr, J., Peters, L. L., Swank, R. T., and Wei, M. L. (2002) Melanosome morphologies in murine models of hermansky-pudlak syndrome reflect blocks in organelle development, J Invest Dermatol. 119, 1156-1164.

 27.  Novak, E. K., Wieland, F., Jahreis, G. P., and Swank, R. T. (1980) Altered secretion of kidney lysosomal enzymes in the mouse pigment mutants ruby-eye, ruby-eye-2-J, and maroon, Biochem. Genet. 18, 549-561.

 28.  Paigen, B., Holmes, P. A., Novak, E. K., and Swank, R. T. (1990) Analysis of atherosclerosis susceptibility in mice with genetic defects in platelet function, Arteriosclerosis 10, 648-652.

 29.  Boissy, R. E., Richmond, B., Huizing, M., Helip-Wooley, A., Zhao, Y., Koshoffer, A., and Gahl, W. A. (2005) Melanocyte-specific proteins are aberrantly trafficked in melanocytes of Hermansky-Pudlak syndrome-type 3, Am. J Pathol. 166, 231-240.

 30.  Richmond, B., Huizing, M., Knapp, J., Koshoffer, A., Zhao, Y., Gahl, W. A., and Boissy, R. E. (2005) Melanocytes derived from patients with Hermansky-Pudlak Syndrome types 1, 2, and 3 have distinct defects in cargo trafficking, J Invest Dermatol. 124, 420-427.

 31.  Helip-Wooley, A., Westbroek, W., Dorward, H. M., Koshoffer, A., Huizing, M., Boissy, R. E., and Gahl, W. A. (2007) Improper trafficking of melanocyte-specific proteins in Hermansky-Pudlak syndrome type-5, J Invest Dermatol. 127, 1471-1478.

 32.  Suzuki, T., Li, W., Zhang, Q., Novak, E. K., Sviderskaya, E. V., Wilson, A., Bennett, D. C., Roe, B. A., Swank, R. T., and Spritz, R. A. (2001) The gene mutated in cocoa mice, carrying a defect of organelle biogenesis, is a homologue of the human Hermansky-Pudlak syndrome-3 gene, Genom. 78, 30-37.

 33.  Di Pietro, S. M., Falcon-Perez, J. M., Tenza, D., Setty, S. R., Marks, M. S., Raposo, G., and Dell'angelica, E. C. (2006) BLOC-1 interacts with BLOC-2 and the AP-3 complex to facilitate protein trafficking on endosomes, Mol. Biol. Cell 17, 4027-4038.

 34.  Setty, S. R., Tenza, D., Truschel, S. T., Chou, E., Sviderskaya, E. V., Theos, A. C., Lamoreux, M. L., Di Pietro, S. M., Starcevic, M., Bennett, D. C., Dell'angelica, E. C., Raposo, G., and Marks, M. S. (2007) BLOC-1 is required for cargo-specific sorting from vacuolar early endosomes toward lysosome-related organelles, Mol. Biol. Cell 18, 768-780.

 35.  Helip-Wooley, A., Westbroek, W., Dorward, H., Mommaas, M., Boissy, R. E., Gahl, W. A., and Huizing, M. (2005) Association of the Hermansky-Pudlak syndrome type-3 protein with clathrin, BMC. Cell Biol. 6, 33.

 36.  Bossi, G., Booth, S., Clark, R., Davis, E. G., Liesner, R., Richards, K., Starcevic, M., Stinchcombe, J., Trambas, C., Dell'angelica, E. C., and Griffiths, G. M. (2005) Normal lytic granule secretion by cytotoxic T lymphocytes deficient in BLOC-1, -2 and -3 and myosins Va, VIIa and XV, Traffic. 6, 243-251.

 37.  Orn, A., Hakansson, E. M., Gidlund, M., Ramstedt, U., Axberg, I., Wigzell, H., and Lundin, L. G. (1982) Pigment mutations in the mouse which also affect lysosomal functions lead to suppressed natural killer cell activity, Scand. J Immunol. 15, 305-310.

 38.  Oberhauser, A. F. and Fernandez, J. M. (1996) A fusion pore phenotype in mast cells of the ruby-eye mouse, Proc. Natl. Acad. Sci. U. S A 93, 14349-14354.

 39.  Wei, M. L. (2006) Hermansky-Pudlak syndrome: a disease of protein trafficking and organelle function, Pigment Cell Res. 19, 19-42.