Phenotypic Mutation 'plateau' (pdf version)
Allele | plateau |
Mutation Type |
critical splice donor site
|
Chromosome | 11 |
Coordinate | 96,992,304 bp (GRCm39) |
Base Change | C ⇒ T (forward strand) |
Gene |
Tbx21
|
Gene Name | T-box 21 |
Synonym(s) | Tbet, Tblym, TBT1, T-bet |
Chromosomal Location |
96,988,897-97,006,157 bp (-) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human ortholog of mouse Tbx21/Tbet gene. Studies in mouse show that Tbx21 protein is a Th1 cell-specific transcription factor that controls the expression of the hallmark Th1 cytokine, interferon-gamma (IFNG). Expression of the human ortholog also correlates with IFNG expression in Th1 and natural killer cells, suggesting a role for this gene in initiating Th1 lineage development from naive Th precursor cells. [provided by RefSeq, Jul 2008] PHENOTYPE: Mice homozygous for disruptions in this gene display defects in the production of NK and NK-T cells. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_019507; MGI:1888984
|
Mapped | Yes |
Amino Acid Change |
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000001484 †]
† probably from a misspliced transcript
|
AlphaFold |
Q9JKD8 |
SMART Domains |
Protein: ENSMUSP00000001484 Gene: ENSMUSG00000001444
Domain | Start | End | E-Value | Type |
low complexity region
|
83 |
100 |
N/A |
INTRINSIC |
TBOX
|
135 |
330 |
4.82e-111 |
SMART |
low complexity region
|
498 |
515 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
Meta Mutation Damage Score |
0.9596 |
Is this an essential gene? |
Probably nonessential (E-score: 0.213) |
Phenotypic Category |
Autosomal Semidominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(13) : Chemically induced (ENU)(1) Gene trapped(1) Targeted(5) Transgenic(6)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00231:Tbx21
|
APN |
11 |
96989749 |
missense |
probably damaging |
0.97 |
IGL00957:Tbx21
|
APN |
11 |
96989920 |
missense |
probably benign |
0.00 |
IGL00975:Tbx21
|
APN |
11 |
96990908 |
missense |
possibly damaging |
0.54 |
IGL02015:Tbx21
|
APN |
11 |
96989740 |
missense |
probably benign |
|
IGL02930:Tbx21
|
APN |
11 |
96990865 |
missense |
probably damaging |
1.00 |
IGL03378:Tbx21
|
APN |
11 |
97005567 |
missense |
probably benign |
0.01 |
Chomolungma
|
UTSW |
11 |
96990782 |
missense |
possibly damaging |
0.54 |
Uncia
|
UTSW |
11 |
96990808 |
missense |
possibly damaging |
0.84 |
Yeti
|
UTSW |
11 |
96989923 |
missense |
probably benign |
0.10 |
R1923:Tbx21
|
UTSW |
11 |
96990863 |
missense |
probably damaging |
1.00 |
R4569:Tbx21
|
UTSW |
11 |
97005581 |
missense |
probably benign |
0.11 |
R4662:Tbx21
|
UTSW |
11 |
96992393 |
missense |
probably benign |
0.01 |
R4847:Tbx21
|
UTSW |
11 |
97005857 |
missense |
probably damaging |
0.99 |
R5049:Tbx21
|
UTSW |
11 |
97005536 |
missense |
probably benign |
0.08 |
R5364:Tbx21
|
UTSW |
11 |
96992304 |
critical splice donor site |
probably null |
|
R5873:Tbx21
|
UTSW |
11 |
97005474 |
critical splice donor site |
probably null |
|
R6064:Tbx21
|
UTSW |
11 |
97005737 |
missense |
probably damaging |
0.96 |
R6516:Tbx21
|
UTSW |
11 |
96990782 |
missense |
possibly damaging |
0.54 |
R6786:Tbx21
|
UTSW |
11 |
97005872 |
missense |
possibly damaging |
0.88 |
R7038:Tbx21
|
UTSW |
11 |
96990597 |
missense |
probably damaging |
1.00 |
R7050:Tbx21
|
UTSW |
11 |
97005596 |
missense |
probably benign |
0.03 |
R7062:Tbx21
|
UTSW |
11 |
96989719 |
missense |
probably damaging |
1.00 |
R7181:Tbx21
|
UTSW |
11 |
96989923 |
missense |
probably benign |
0.10 |
R8421:Tbx21
|
UTSW |
11 |
97005561 |
missense |
probably benign |
0.01 |
R8475:Tbx21
|
UTSW |
11 |
96990808 |
missense |
possibly damaging |
0.84 |
|
Mode of Inheritance |
Autosomal Semidominant |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:39 PM
by Anne Murray
|
Record Created |
2017-07-24 3:06 PM
by Bruce Beutler
|
Record Posted |
2018-09-13 |
Phenotypic Description |
The plateau phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5364, some of which showed a decrease in the CD4 to CD8 T cell ratio (Figure 1) due to increased frequencies of CD8+ T cells in CD3+ T cells (Figure 2) and effector memory CD8 T cells in CD8 T cells (Figure 3) in the peripheral blood. Expression of IgM on peripheral blood B cells was increased (Figure 4).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 98 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tbx21: a G to A transition at base pair 97,101,478 (v38) on chromosome 11, or base pair 13,854 in the GenBank genomic region NC_000077 within the donor splice site of intron 3. The strongest association was found with a dominant model of inheritance to the normalized frequency of CD8+ T cells in CD3+ T cells, wherein nine variant homozygotes and 18 heterozygous mice departed phenotypically from 19 homozygous reference mice with a P value of 3.699 x 10-6 (Figure 5). The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in skipping of the 122-nucleotide exon 3 (out of 6 total exons), resulting in a frame-shifted protein product beginning after amino acid 214 of the protein and premature termination after the inclusion of 20 aberrant amino acids.
<--exon 2 <--exon 3 intron 3--> <--exon 4-->
825 ……GGCAGCATGCCAG ……AATGTGACCCAG gtaggattgtcagac…… ATGATCGTCCT……GGAGGTGAATGA…… 1021
211 ……-G--S--M--P-- ……-N--V--T--Q- D--D--R--P-……-G--G--E--*-
correct deleted aberrant
|
The donor splice site of intron 3, which is destroyed by the Plateau mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Tbx21 encodes T-box expressed in T cells (T-bet; alternatively, T-box21 [TBX21]). T-bet is a member of the T-box transcription factor family. The T-box proteins have a highly conserved central DNA-binding T-box domain of approximately 180 amino acids (Figure 3) (1). The T-box proteins differ in sequence and length at the N- and C-termini (2). T-bet can interact with and recruit a H3K4me2 methyltransferase complex to the promoters of target genes (2). Non-DNA contact regions within the T-box, termed T-box domain 1 and 2, are required for interaction with the H3K4me2 methyltransferase complex. T-box domain 1 and 2 are both required for H3K4me2 modification, but only T-box domain 1 is necessary for interaction with the H3K4me2 methyltransferase complex. T-box domain 2 putatively mediates the removal of the repressive H3K27me3 modification before the addition of H3K4me2 modification. T-bet is phosphorylated on several residues. mTORC1 mediates phosphorylation at Ser52, Tyr76, Ser224, and Ser508, which regulates T helper type 1 (TH1) differentiation (3). c-Abl phosphorylates T-bet at Tyr219, Tyr265, and Tyr304, promoting the induction of TH1 cell development and the suppression of TH2 cell development (4). Phosphorylation of Thr302 promotes T-bet interaction with NFAT as well as suppression of IL-2 and TH2 cytokines (5). GSK3-mediated phosphorylation of Ser508 promotes T-bet interaction with NF-κB p65 as well as inhibition of IL-2 (6). ITK-induced phosphorylation of Tyr525 promotes the interaction between T-bet and GATA3 and suppression of TH2 cytokines (7). T-bet is also ubiquitinated. Ubiquitination of Lys313 promotes binding to DNA and controls protein stability (5). The Plateau mutation is predicted to result in a frame-shifted protein product beginning after amino acid 214 of the protein and premature termination after the inclusion of 20 aberrant amino acids. The affected region is with the T-box domain.
|
Expression/Localization | TBX21 is expressed in peripheral blood leukocytes as well as the lung, thymus, and spleen (1;8). T-cell receptor (TCR) and STAT1-associated signaling induces T-bet expression in TH cell precursors (9;10). T-bet expression is then driven by IL12-STAT4 signaling in a TCR-independent manner (9-11). T-bet expression is also induced by inflammatory cytokines.
|
Background | The T-box proteins function in the regulation of developmental processes. T-bet has several functions, including the effector differentiation and function of CD4, CD8, CD8αα+ intraepithelial T cells, natural killer (NK) cells, NK T cells, dendritic cells, innate lymphoid cells, and B cells (12). T-bet regulates the expression and function of several genes (Table 1). Table 1. T-bet regulates the expression and function of several proteins
Interacting protein
|
T-bet associated function
|
References
|
CXCR3
|
TH1 cell differentiation and migration
|
(20)
|
CCL3 and CCL4
|
TH1 cell migration
|
(20;21)
|
IFNγ
|
TH1 cell differentiation
|
(1)
|
IL-12Rβ2
|
Stimulation of IFNγ production in TH1 cell differentiation
|
(22)
|
Hobit
|
Transcription factor that (along with Blimp-1) shuts down lymphocyte egress from nonlymphoid tissue
|
(12)
|
IL-2Rβ (alternatively, CD122 or IL-15Rβ)
|
Proliferation and survival of NK cells and ILC1; development of NKT1 and CD8αα+ intraepithelial T cells
|
(23)
|
Hlx-1
|
TH1 cell differentiation
|
(22)
|
RUNX3
|
Ifng and Il4 activation or repression in TH1 cells, respectively
|
(24)
|
GATA3
|
T-bet suppresses GATA3 by sequestering GATA3 from the IL-5 and IL-3 promoters, subsequently antagonizing the development of TH2 lineages by suppressing the production of TH2 cytokines (e.g., IL-4, IL-5, and IL-13)
|
(7)
|
RUNX1
|
Blocks RORγt (see the record for chestnut) expression, subsequently antagonizing the development of TH17 lineages
|
(25)
|
BCL6
|
T-bet uses Bcl-6 to repress gene expression in TH1 cells, promoting TFH development
|
(26)
|
PD-1
|
T-bet represses Pdcd1 transcription in CD8+ T cells, sustaining virus-specific CD8+ T cell responses during chronic infection
|
(27)
|
NF-κB p65
|
T-bet inhibits NF-κB p65 activity, subsequently suppressing IL-2 production during TH1 and TH2 differentiation
|
(6)
|
Granzymes A, K, and M; perforin (see the record for prime)
|
Cytotoxic molecules regulated by T-bet in effector CD8+ T cell differentiation
|
(28)
|
T-bet also interacts with and recruits several chromatin remodeling complexes to its target genes (2;22;23). T-bet-associated chromatin accessibility allows for other transcriptional activators (e.g., NFAT, AP-1, STAT4, and NF-κB) to bind to T-bet target genes and promote gene transcription (24-26). T-bet can also promote the dissociation of corepressors (e.g., mSin3a) from promoters (27) as well as the removal of Sin3A-histone deacetylase complexes (28).
T-bet functions in the initiation of TH1 lineage development from naïve TH precursor cells (Figure 4). T-bet controls the expression of TH1 cytokine interferon (IFN)-γ in CD4+ cells (1;29). T-bet concomitantly regulates IL-2 and TH2 cytokines (i.e., IL-4, IL-5, and IL-13) in an IFN-γ-independent manner, resulting in an attenuation of TH2 cell development (7). T-bet also inhibits TH17 differentiation (18). T-bet is required for IFN-γ expression in CD8+ T cells as well as CD8+ T cell cytolytic activity (30). T-bet is required for the development of short-lived CD8 effector cells but has little effect on memory precursor cells (31). In addition, T-bet functions in the development of tissue-resident memory T cells, which are memory CD8 T cells that reside in nonlymphoid tissues (32). In dendritic cells, T-bet is required for IFN-γ production in response to IL-12 and IL-18 stimulation (33). T-bet in dendritic cells is required for the priming of antigen-specific CD4+ T cells (34). T-bet induces the expression of IL-15Rα during the maturation and differentiation of NK cells, other group 1 innate lymphoid cells (ILC1), and invariant T cells (e.g., NKT1 and CD8αα+ intraepithelial T cells). IL-15Rα is required for the proliferation and survival of NK cells and some ILC1 populations (35-37). T-bet is a regulator of the isotype switch to IgG2a in B cells (38), subsequently regulatory the formation of IgG2a+ memory B cells and IgG2a-producing plasma cells (39). Other factors are predicted to be able to compensate for T-bet in germinal center B cells or during the differentiation of IgG2a+ antibody-secreting cells (38;40). T-bet inhibits the switching to IgG1 and IgE during Th2 cell responses (41). T-bet regulates the expression of costimulatory molecules, activation-induced cytidine deaminase (AID), and CXCR3 during chronic LCMV infection (42). T-bet regulates mucosal homeostasis and the homeostatic response to intestinal microbiota (43;44). Innate immune system-specific T-bet knockout mice develop spontaneous colitis (44); however, mice bred in pathogen-free conditions do not develop colitis (45). The mice showed increased activation of CD11c+ MHCII+CD103- dendritic cells, which produce increased levels of TNF. Elevated TNF signaling caused epithelial cell apoptosis and aberrant epithelial membrane integrity. The CD11c+ MHCII+CD103- dendritic cells also produced IL-23, which (along with the TNF) activated type 3 RORγt+ innate lymphoid cells (ILCs). Type 3 ILCs produce inflammatory cytokines (e.g., IL-17 and IL-22) that cooperate with TNF to recruit neutrophils to the colonic lamina propria [reviewed in (46)]. Mutations in TBX21 are linked to asthma and nasal polyps as well as susceptibility to aspirin-induced asthma (OMIM: #208550) (47). T-bet dysregulation is associated with the development of several inflammatory and autoimmune diseases, including colitis (44;48), systemic lupus erythematosus (49), and type I diabetes (50). Homozygous mice expressing an ENU-induced mutant Tbx21 allele (Tbx21duane/duane) exhibited defects in NK cell differentiation as well as reduced NK cell number in the blood, spleen, and liver, but increased NK cell number in the peripheral lymph nodes and bone marrow. The Tbx21duane/duane mice exhibited loss of NK T cells. Tbx21-deficient (Tbx21-/-) mice exhibited defects in Th17 CD4+ T cell differentiation upon exposure to IL-12 (51). Tbx21-/- mice showed reduced numbers of CD4+ T cells and CD4+ memory T cells as well as reduced NK T cell number (52;53). Tbx21-/- mice showed reduced Th1 cell number with concomitant increased Th2 cell number (29). Tbx21-/- mice also exhibited increased susceptibility to dextran sodium sulfate (DSS)-induced colitis (54). Tbx21-/- mice showed increased weight gain and adiposity after high-fat diet; however the mice showed improved insulin sensitivity (55).
|
Putative Mechanism | The phenotypes observed in the plateau mice indicate loss of T-bet-associated function, namely in T cell differentiation and function.
|
Primers |
PCR Primer
plateau_pcr_F: GCTAGCACCTTTGTCTAGTCTG
plateau_pcr_R: AATCCCACATCTCCAGTGTCTG
Sequencing Primer
plateau_seq_F: ACATCAATCAGGCCTGGTG
plateau_seq_R: GTCTGGTCGATACTTGACAATAAGG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 425 nucleotides is amplified (chromosome 11, - strand):
1 aatcccacat ctccagtgtc tggtcgatac ttgacaataa ggttaactgt ccacagggaa 61 ccgcttatat gtccacccag actcccccaa caccggagcc cactggatgc gccaggaagt 121 ttcatttggg aagctaaagc tcaccaacaa caagggggct tccaacaatg tgacccaggt 181 aggattgtca gacccacctg cctatatgtc tgagatctac cccctgacat ttcctaagac 241 ccactttgta ctgttggagt ctcgtctcct ctcctctcct cttctcctct cttccctaca 301 tagccaagga taaccatgaa cttctgttcc atctgctcct gagggtgaga tcacaggcat 361 gcaccaccag gcctgattga tgtggttcaa tcagatattg caccagacta gacaaaggtg 421 ctagc
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Szabo, S. J., Kim, S. T., Costa, G. L., Zhang, X., Fathman, C. G., and Glimcher, L. H. (2000) A Novel Transcription Factor, T-Bet, Directs Th1 Lineage Commitment. Cell. 100, 655-669.
2. Lewis, M. D., Miller, S. A., Miazgowicz, M. M., Beima, K. M., and Weinmann, A. S. (2007) T-Bet's Ability to Regulate Individual Target Genes Requires the Conserved T-Box Domain to Recruit Histone Methyltransferase Activity and a Separate Family Member-Specific Transactivation Domain. Mol Cell Biol. 27, 8510-8521.
3. Chornoguz, O., Hagan, R. S., Haile, A., Arwood, M. L., Gamper, C. J., Banerjee, A., and Powell, J. D. (2017) MTORC1 Promotes T-Bet Phosphorylation to Regulate Th1 Differentiation. J Immunol. 198, 3939-3948.
4. Chen, A., Lee, S. M., Gao, B., Shannon, S., Zhu, Z., and Fang, D. (2011) C-Abl-Mediated Tyrosine Phosphorylation of the T-Bet DNA-Binding Domain Regulates CD4+ T-Cell Differentiation and Allergic Lung Inflammation. Mol Cell Biol. 31, 3445-3456.
5. Jang, E. J., Park, H. R., Hong, J. H., and Hwang, E. S. (2013) Lysine 313 of T-Box is Crucial for Modulation of Protein Stability, DNA Binding, and Threonine Phosphorylation of T-Bet. J Immunol. 190, 5764-5770.
9. Afkarian, M., Sedy, J. R., Yang, J., Jacobson, N. G., Cereb, N., Yang, S. Y., Murphy, T. L., and Murphy, K. M. (2002) T-Bet is a STAT1-Induced Regulator of IL-12R Expression in Naive CD4+ T Cells. Nat Immunol. 3, 549-557.
10. Mullen, A. C., High, F. A., Hutchins, A. S., Lee, H. W., Villarino, A. V., Livingston, D. M., Kung, A. L., Cereb, N., Yao, T. P., Yang, S. Y., and Reiner, S. L. (2001) Role of T-Bet in Commitment of TH1 Cells before IL-12-Dependent Selection. Science. 292, 1907-1910.
12. Mackay, L. K., Minnich, M., Kragten, N. A., Liao, Y., Nota, B., Seillet, C., Zaid, A., Man, K., Preston, S., Freestone, D., Braun, A., Wynne-Jones, E., Behr, F. M., Stark, R., Pellicci, D. G., Godfrey, D. I., Belz, G. T., Pellegrini, M., Gebhardt, T., Busslinger, M., Shi, W., Carbone, F. R., van Lier, R. A., Kallies, A., and van Gisbergen, K. P. (2016) Hobit and Blimp1 Instruct a Universal Transcriptional Program of Tissue Residency in Lymphocytes. Science. 352, 459-463.
13. Lord, G. M., Rao, R. M., Choe, H., Sullivan, B. M., Lichtman, A. H., Luscinskas, F. W., and Glimcher, L. H. (2005) T-Bet is Required for Optimal Proinflammatory CD4+ T-Cell Trafficking. Blood. 106, 3432-3439.
14. Jenner, R. G., Townsend, M. J., Jackson, I., Sun, K., Bouwman, R. D., Young, R. A., Glimcher, L. H., and Lord, G. M. (2009) The Transcription Factors T-Bet and GATA-3 Control Alternative Pathways of T-Cell Differentiation through a Shared Set of Target Genes. Proc Natl Acad Sci U S A. 106, 17876-17881.
17. Djuretic, I. M., Levanon, D., Negreanu, V., Groner, Y., Rao, A., and Ansel, K. M. (2007) Transcription Factors T-Bet and Runx3 Cooperate to Activate Ifng and Silence Il4 in T Helper Type 1 Cells. Nat Immunol. 8, 145-153.
18. Lazarevic, V., Chen, X., Shim, J. H., Hwang, E. S., Jang, E., Bolm, A. N., Oukka, M., Kuchroo, V. K., and Glimcher, L. H. (2011) T-Bet Represses T(H)17 Differentiation by Preventing Runx1-Mediated Activation of the Gene Encoding RORgammat. Nat Immunol. 12, 96-104.
20. Kao, C., Oestreich, K. J., Paley, M. A., Crawford, A., Angelosanto, J. M., Ali, M. A., Intlekofer, A. M., Boss, J. M., Reiner, S. L., Weinmann, A. S., and Wherry, E. J. (2011) Transcription Factor T-Bet Represses Expression of the Inhibitory Receptor PD-1 and Sustains Virus-Specific CD8+ T Cell Responses during Chronic Infection. Nat Immunol. 12, 663-671.
21. Xin, A., Masson, F., Liao, Y., Preston, S., Guan, T., Gloury, R., Olshansky, M., Lin, J. X., Li, P., Speed, T. P., Smyth, G. K., Ernst, M., Leonard, W. J., Pellegrini, M., Kaech, S. M., Nutt, S. L., Shi, W., Belz, G. T., and Kallies, A. (2016) A Molecular Threshold for Effector CD8(+) T Cell Differentiation Controlled by Transcription Factors Blimp-1 and T-Bet. Nat Immunol. 17, 422-432.
23. Miller, S. A., Huang, A. C., Miazgowicz, M. M., Brassil, M. M., and Weinmann, A. S. (2008) Coordinated but Physically Separable Interaction with H3K27-Demethylase and H3K4-Methyltransferase Activities are Required for T-Box Protein-Mediated Activation of Developmental Gene Expression. Genes Dev. 22, 2980-2993.
24. Park, W. R., Nakahira, M., Sugimoto, N., Bian, Y., Yashiro-Ohtani, Y., Zhou, X. Y., Yang, Y. F., Hamaoka, T., and Fujiwara, H. (2004) A Mechanism Underlying STAT4-Mediated Up-Regulation of IFN-Gamma Induction inTCR-Triggered T Cells. Int Immunol. 16, 295-302.
25. Sica, A., Dorman, L., Viggiano, V., Cippitelli, M., Ghosh, P., Rice, N., and Young, H. A. (1997) Interaction of NF-kappaB and NFAT with the Interferon-Gamma Promoter. J Biol Chem. 272, 30412-30420.
26. Wei, L., Vahedi, G., Sun, H. W., Watford, W. T., Takatori, H., Ramos, H. L., Takahashi, H., Liang, J., Gutierrez-Cruz, G., Zang, C., Peng, W., O'Shea, J. J., and Kanno, Y. (2010) Discrete Roles of STAT4 and STAT6 Transcription Factors in Tuning Epigenetic Modifications and Transcription during T Helper Cell Differentiation. Immunity. 32, 840-851.
29. Szabo, S. J., Sullivan, B. M., Stemmann, C., Satoskar, A. R., Sleckman, B. P., and Glimcher, L. H. (2002) Distinct Effects of T-Bet in TH1 Lineage Commitment and IFN-Gamma Production in CD4 and CD8 T Cells. Science. 295, 338-342.
30. Sullivan, B. M., Juedes, A., Szabo, S. J., von Herrath, M., and Glimcher, L. H. (2003) Antigen-Driven Effector CD8 T Cell Function Regulated by T-Bet. Proc Natl Acad Sci U S A. 100, 15818-15823.
31. Joshi, N. S., Cui, W., Chandele, A., Lee, H. K., Urso, D. R., Hagman, J., Gapin, L., and Kaech, S. M. (2007) Inflammation Directs Memory Precursor and Short-Lived Effector CD8(+) T Cell Fates Via the Graded Expression of T-Bet Transcription Factor. Immunity. 27, 281-295.
32. Mackay, L. K., Wynne-Jones, E., Freestone, D., Pellicci, D. G., Mielke, L. A., Newman, D. M., Braun, A., Masson, F., Kallies, A., Belz, G. T., and Carbone, F. R. (2015) T-Box Transcription Factors Combine with the Cytokines TGF-Beta and IL-15 to Control Tissue-Resident Memory T Cell Fate. Immunity. 43, 1101-1111.
33. Lugo-Villarino, G., Maldonado-Lopez, R., Possemato, R., Penaranda, C., and Glimcher, L. H. (2003) T-Bet is Required for Optimal Production of IFN-Gamma and Antigen-Specific T Cell Activation by Dendritic Cells. Proc Natl Acad Sci U S A. 100, 7749-7754.
34. Wang, J., Fathman, J. W., Lugo-Villarino, G., Scimone, L., von Andrian, U., Dorfman, D. M., and Glimcher, L. H. (2006) Transcription Factor T-Bet Regulates Inflammatory Arthritis through its Function in Dendritic Cells. J Clin Invest. 116, 414-421.
35. Klose, C. S. N., Flach, M., Mohle, L., Rogell, L., Hoyler, T., Ebert, K., Fabiunke, C., Pfeifer, D., Sexl, V., Fonseca-Pereira, D., Domingues, R. G., Veiga-Fernandes, H., Arnold, S. J., Busslinger, M., Dunay, I. R., Tanriver, Y., and Diefenbach, A. (2014) Differentiation of Type 1 ILCs from a Common Progenitor to all Helper-Like Innate Lymphoid Cell Lineages. Cell. 157, 340-356.
36. Daussy, C., Faure, F., Mayol, K., Viel, S., Gasteiger, G., Charrier, E., Bienvenu, J., Henry, T., Debien, E., Hasan, U. A., Marvel, J., Yoh, K., Takahashi, S., Prinz, I., de Bernard, S., Buffat, L., and Walzer, T. (2014) T-Bet and Eomes Instruct the Development of Two Distinct Natural Killer Cell Lineages in the Liver and in the Bone Marrow. J Exp Med. 211, 563-577.
37. Intlekofer, A. M., Takemoto, N., Wherry, E. J., Longworth, S. A., Northrup, J. T., Palanivel, V. R., Mullen, A. C., Gasink, C. R., Kaech, S. M., Miller, J. D., Gapin, L., Ryan, K., Russ, A. P., Lindsten, T., Orange, J. S., Goldrath, A. W., Ahmed, R., and Reiner, S. L. (2005) Effector and Memory CD8+ T Cell Fate Coupled by T-Bet and Eomesodermin. Nat Immunol. 6, 1236-1244.
39. Wang, N. S., McHeyzer-Williams, L. J., Okitsu, S. L., Burris, T. P., Reiner, S. L., and McHeyzer-Williams, M. G. (2012) Divergent Transcriptional Programming of Class-Specific B Cell Memory by T-Bet and RORalpha. Nat Immunol. 13, 604-611.
41. Liu, N., Ohnishi, N., Ni, L., Akira, S., and Bacon, K. B. (2003) CpG Directly Induces T-Bet Expression and Inhibits IgG1 and IgE Switching in B Cells. Nat Immunol. 4, 687-693.
42. Barnett, B. E., Staupe, R. P., Odorizzi, P. M., Palko, O., Tomov, V. T., Mahan, A. E., Gunn, B., Chen, D., Paley, M. A., Alter, G., Reiner, S. L., Lauer, G. M., Teijaro, J. R., and Wherry, E. J. (2016) Cutting Edge: B Cell-Intrinsic T-Bet Expression is Required to Control Chronic Viral Infection. J Immunol. 197, 1017-1022.
44. Garrett, W. S., Lord, G. M., Punit, S., Lugo-Villarino, G., Mazmanian, S. K., Ito, S., Glickman, J. N., and Glimcher, L. H. (2007) Communicable Ulcerative Colitis Induced by T-Bet Deficiency in the Innate Immune System. Cell. 131, 33-45.
45. Garrett, W. S., Gallini, C. A., Yatsunenko, T., Michaud, M., DuBois, A., Delaney, M. L., Punit, S., Karlsson, M., Bry, L., Glickman, J. N., Gordon, J. I., Onderdonk, A. B., and Glimcher, L. H. (2010) Enterobacteriaceae Act in Concert with the Gut Microbiota to Induce Spontaneous and Maternally Transmitted Colitis. Cell Host Microbe. 8, 292-300.
47. Akahoshi, M., Obara, K., Hirota, T., Matsuda, A., Hasegawa, K., Takahashi, N., Shimizu, M., Nakashima, K., Cheng, L., Doi, S., Fujiwara, H., Miyatake, A., Fujita, K., Higashi, N., Taniguchi, M., Enomoto, T., Mao, X. Q., Nakashima, H., Adra, C. N., Nakamura, Y., Tamari, M., and Shirakawa, T. (2005) Functional Promoter Polymorphism in the TBX21 Gene Associated with Aspirin-Induced Asthma. Hum Genet. 117, 16-26.
48. Garrett, W. S., Punit, S., Gallini, C. A., Michaud, M., Zhang, D., Sigrist, K. S., Lord, G. M., Glickman, J. N., and Glimcher, L. H. (2009) Colitis-Associated Colorectal Cancer Driven by T-Bet Deficiency in Dendritic Cells. Cancer Cell. 16, 208-219.
49. You, Y., Zhao, W., Chen, S., Tan, W., Dan, Y., Hao, F., and Deng, G. (2010) Association of TBX21 Gene Haplotypes in a Chinese Population with Systemic Lupus Erythematosus. Scand J Rheumatol. 39, 254-258.
50. Sasaki, Y., Ihara, K., Matsuura, N., Kohno, H., Nagafuchi, S., Kuromaru, R., Kusuhara, K., Takeya, R., Hoey, T., Sumimoto, H., and Hara, T. (2004) Identification of a Novel Type 1 Diabetes Susceptibility Gene, T-Bet. Hum Genet. 115, 177-184.
51. Lee, Y. K., Turner, H., Maynard, C. L., Oliver, J. R., Chen, D., Elson, C. O., and Weaver, C. T. (2009) Late Developmental Plasticity in the T Helper 17 Lineage. Immunity. 30, 92-107.
52. Zhu, Y., Ju, S., Chen, E., Dai, S., Li, C., Morel, P., Liu, L., Zhang, X., and Lu, B. (2010) T-Bet and Eomesodermin are Required for T Cell-Mediated Antitumor Immune Responses. J Immunol. 185, 3174-3183.
53. Intlekofer, A. M., Takemoto, N., Wherry, E. J., Longworth, S. A., Northrup, J. T., Palanivel, V. R., Mullen, A. C., Gasink, C. R., Kaech, S. M., Miller, J. D., Gapin, L., Ryan, K., Russ, A. P., Lindsten, T., Orange, J. S., Goldrath, A. W., Ahmed, R., and Reiner, S. L. (2005) Effector and Memory CD8+ T Cell Fate Coupled by T-Bet and Eomesodermin. Nat Immunol. 6, 1236-1244.
54. Garrett, W. S., Lord, G. M., Punit, S., Lugo-Villarino, G., Mazmanian, S. K., Ito, S., Glickman, J. N., and Glimcher, L. H. (2007) Communicable Ulcerative Colitis Induced by T-Bet Deficiency in the Innate Immune System. Cell. 131, 33-45.
55. Stolarczyk, E., Vong, C. T., Perucha, E., Jackson, I., Cawthorne, M. A., Wargent, E. T., Powell, N., Canavan, J. B., Lord, G. M., and Howard, J. K. (2013) Improved Insulin Sensitivity Despite Increased Visceral Adiposity in Mice Deficient for the Immune Cell Transcription Factor T-Bet. Cell Metab. 17, 520-533.
|
Science Writers | Anne Murray |
Authors | Xue Zhong, Jin Huk Choi, and Bruce Beutler |