Allele | elementary | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 24,598,687 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | G ⇒ T (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Cd79a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | CD79A antigen (immunoglobulin-associated alpha) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Ly-54, Ig-alpha, Ig alpha, mb-1, Iga, Cd79a, Ly54, Igalpha | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 24,596,922-24,601,283 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-alpha protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Glycine changed to Cysteine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000003469] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P11911 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000003469 Gene: ENSMUSG00000003379 AA Change: G79C
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.4854 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.100) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(21) : Chemically induced (ENU)(2) Gene trapped(1) Targeted(17) Transgenic(1) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:39 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2017-08-18 9:40 AM by Bruce Beutler | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2017-09-15 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The elementary phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5450, some of which showed reduced frequencies of B1b cells in the peripheral blood (Figure 1). The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was diminished (Figure 2). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 74 mutations. Both of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 7: Ceacam20 and Cd79a. The mutation in Cd79a was presumed causative as the immune phenotypes in elementary mimicked that of other Cd79a alleles (see crab and MGI). The mutation in Cd79a is a G to T transversion at base pair 24,899,262 (v38) on chromosome 7, or base pair 1,752 in the GenBank genomic region NC_000073 encoding Cd79a. The strongest association was found with a recessive model of inheritance to the normalized antibody response to NP-Ficoll, wherein four variant homozygotes departed phenotypically from 10 homozygous reference mice and 13 heterozygous mice with a P value of 5.468 x 10-7 (Figure 3). A substantial semidominant effect was observed in the B1 cell assay, but the mutation is preponderantly recessive. The mutation corresponds to residue 246 in the mRNA sequence NM_007655 within exon 2 of 5 total exons.
The mutated nucleotide is indicated in red. The mutation results in a glycine to cysteine substitution at position 79 (G79C) in the Igα protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Cd79a encodes Igα, a type I transmembrane glycoprotein (Figure 4). The cytoplasmic tail of Igα is 61 amino acids in length and contains a single immunoreceptor tyrosine-based activation motif (ITAM) (1), a conserved domain containing two tyrosines that upon phosphorylation act as a binding site for SH2 domain-containing effectors (D/ExxxxxxxD/ExxYxxL/IxxxxxxxYxxL/I). The extracellular N-terminus of Igα (aa 29 to 137 in mice) is predicted to form a C2-set Ig-like fold (2). Igα contains an additional extracellular cysteine residue (Cys113), which forms an interchain disulfide bond that mediates heterodimerization of Igα and Igβ (3;4). The function of the extracellular domains of Igα/Igβ in BCR signaling is not well understood. The elementary mutation is a glycine to cysteine substitution at position 79 (G79C); residue 79 is within the Ig-like domain. Please see the record for crab for more information about Cd79a. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | A heterodimer of Igα and Igβ constitutes the signaling component of the BCR (5-7). BCR signaling depends on the interactions of the cytoplasmic domains of Igα and Igβ with downstream signaling molecules. The Igα/Igβ heterodimer associates noncovalently with all mIg isotypes (IgM, IgD, IgG, IgA, and IgE) (8). BCR signaling is essential for progression through the early stages of B cell development. In mature B cells, signaling through Igα/Igβ is required for cell survival. The phenotype of the elementary mice is consistent with a loss of function of Igα. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer elementary_pcr_F: AGCAATCATCTCCATCTCCAGG elementary_pcr_R: AGCTCTGCTCCTAATGTTTTGG Sequencing Primer elementary_seq_F: CCAGGCTCTGACCCATCTG elementary_seq_R: CTGCTCCTAATGTTTTGGAAGAAAG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 423 nucleotides is amplified (chromosome 7, + strand): 1 agcaatcatc tccatctcca ggctctgacc catctgtctc ctctcctctc tccacaggtc Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Xue Zhong and Bruce Beutler |