Phenotypic Mutation 'elementary'

• Allele: elementary
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 24,598,687 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Cd79a
• Gene Name: CD79A antigen (immunoglobulin-associated alpha)
• Synonym(s): Ly-54, Ig-alpha, Ig alpha, mb-1, Iga, Cd79a, Ly54, Igalpha
• Chromosomal Location: 24,596,922-24,601,283 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-alpha protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glycine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000003469]
• AlphaFold: P11911
• SMART Domains: Protein: ENSMUSP00000003469; Gene: ENSMUSG00000003379; AA Change: G79C

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
IG	35	120	9.18e-12	SMART
transmembrane domain	138	160	N/A	INTRINSIC
ITAM	179	199	4.19e-4	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000003469)
• Meta Mutation Damage Score: 0.4854
• Is this an essential gene?: Probably nonessential (E-score: 0.091)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Anne Murray
• Record Created: 2017-08-18 9:40 AM by Bruce Beutler
• Record Posted: 2017-09-15
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007655; MGI: 101774

Alleles Listed at MGI

All Mutations and Alleles(21) : Chemically induced (ENU)(2) Gene trapped(1) Targeted(17) Transgenic(1)

Phenotypic Description

Figure 1. Elementary mice exhibit decreased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous elementary mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The elementary phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5450, some of which showed reduced frequencies of B1b cells in the peripheral blood (Figure 1). The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was diminished (Figure 2). 

Nature of Mutation

Figure 3. Linkage mapping of the reduced T-independent antibody response to NP-Ficoll using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 74 mutations (X-axis) identified in the G1 male of pedigree R5450. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 74 mutations. Both of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 7: Ceacam20 and Cd79a. The mutation in Cd79a was presumed causative as the immune phenotypes in elementary mimicked that of other Cd79a alleles (see crab and MGI). The mutation in Cd79a is a G to T transversion at base pair 24,899,262 (v38) on chromosome 7, or base pair 1,752 in the GenBank genomic region NC_000073 encoding Cd79a.  The strongest association was found with a recessive model of inheritance to the normalized antibody response to NP-Ficoll, wherein four variant homozygotes departed phenotypically from 10 homozygous reference mice and 13 heterozygous mice with a P value of 5.468 x 10^-7 (Figure 3).  A substantial semidominant effect was observed in the B1 cell assay, but the mutation is preponderantly recessive.

The mutation corresponds to residue 246 in the mRNA sequence NM_007655 within exon 2 of 5 total exons.

231 GTGCCACTGGGTCCTGGCCAGGGTACCACAGGC 74  -V--P--L--G--P--G--Q--G--T--T--G-

The mutated nucleotide is indicated in red.  The mutation results in a glycine to cysteine substitution at position 79 (G79C) in the Igα protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Protein Prediction

Figure 4. Domain structure of Igα. The elementary mutation is a glycine to cysteine substitution at position 79. This image is interactive; click to view additional mutations in Cd79a.

Cd79a encodes Igα, a type I transmembrane glycoprotein (Figure 4). The cytoplasmic tail of Igα is 61 amino acids in length and contains a single immunoreceptor tyrosine-based activation motif (ITAM) (1), a conserved domain containing two tyrosines that upon phosphorylation act as a binding site for SH2 domain-containing effectors (D/ExxxxxxxD/ExxYxxL/IxxxxxxxYxxL/I). The extracellular N-terminus of Igα (aa 29 to 137 in mice) is predicted to form a C2-set Ig-like fold (2). Igα contains an additional extracellular cysteine residue (Cys113), which forms an interchain disulfide bond that mediates heterodimerization of Igα and Igβ (3;4). The function of the extracellular domains of Igα/Igβ in BCR signaling is not well understood. The elementary mutation is a glycine to cysteine substitution at position 79 (G79C); residue 79 is within the Ig-like domain.

Please see the record for crab for more information about Cd79a.

Putative Mechanism

A heterodimer of Igα and Igβ constitutes the signaling component of the BCR (5-7). BCR signaling depends on the interactions of the cytoplasmic domains of Igα and Igβ with downstream signaling molecules. The Igα/Igβ heterodimer associates noncovalently with all mIg isotypes (IgM, IgD, IgG, IgA, and IgE) (8). BCR signaling is essential for progression through the early stages of B cell development. In mature B cells, signaling through Igα/Igβ is required for cell survival. The phenotype of the elementary mice is consistent with a loss of function of Igα.

Primers

PCR Primer
elementary_pcr_F: AGCAATCATCTCCATCTCCAGG
elementary_pcr_R: AGCTCTGCTCCTAATGTTTTGG

Sequencing Primer
elementary_seq_F: CCAGGCTCTGACCCATCTG
elementary_seq_R: CTGCTCCTAATGTTTTGGAAGAAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 423 nucleotides is amplified (chromosome 7, + strand):

1   agcaatcatc tccatctcca ggctctgacc catctgtctc ctctcctctc tccacaggtc
61  ccggatgcca ggccctgcgg gtagaagggg gtccaccatc cctgacggtg aacttgggcg
121 aggaggcccg cctcacctgt gaaaacaatg gcaggaaccc taatatcaca tggtggttca
181 gccttcagtc taacatcaca tggcccccag tgccactggg tcctggccag ggtaccacag
241 gccagctgtt cttccccgaa gtaaacaaga accacagggg cttgtactgg tgccaagtga
301 tagaaaacaa catattaaaa cgctcctgtg gtacttacct ccgcgtgcgc agtgagtagg
361 gagggcgctg gcctccttgc gttccctgct ccctctttct tccaaaacat taggagcaga
421 gct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Flaswinkel, H., and Reth, M. (1994) Dual Role of the Tyrosine Activation Motif of the Ig-Alpha Protein during Signal Transduction Via the B Cell Antigen Receptor. EMBO J.. 13, 83-89.

  2. Kashiwamura, S., Koyama, T., Matsuo, T., Steinmetz, M., Kimoto, M., and Sakaguchi, N. (1990) Structure of the Murine Mb-1 Gene Encoding a Putative sIgM-Associated Molecule. J. Immunol.. 145, 337-343.

  3. Radaev, S., Zou, Z., Tolar, P., Nguyen, K., Nguyen, A., Krueger, P. D., Stutzman, N., Pierce, S., and Sun, P. D. (2010) Structural and Functional Studies of Igalphabeta and its Assembly with the B Cell Antigen Receptor. Structure. 18, 934-943.

  4. Siegers, G. M., Yang, J., Duerr, C. U., Nielsen, P. J., Reth, M., and Schamel, W. W. (2006) Identification of Disulfide Bonds in the Ig-alpha/Ig-Beta Component of the B Cell Antigen Receptor using the Drosophila S2 Cell Reconstitution System. Int. Immunol.. 18, 1385-1396.

  5. Campbell, K. S., Hager, E. J., Friedrich, R. J., and Cambier, J. C. (1991) IgM Antigen Receptor Complex Contains Phosphoprotein Products of B29 and Mb-1 Genes. Proc. Natl. Acad. Sci. U. S. A.. 88, 3982-3986.

  6. Hombach, J., Tsubata, T., Leclercq, L., Stappert, H., and Reth, M. (1990) Molecular Components of the B-Cell Antigen Receptor Complex of the IgM Class. Nature. 343, 760-762.

  7. Campbell, K. S., and Cambier, J. C. (1990) B Lymphocyte Antigen Receptors (mIg) are Non-Covalently Associated with a Disulfide Linked, Inducibly Phosphorylated Glycoprotein Complex. EMBO J.. 9, 441-448.

  8. Venkitaraman, A. R., Williams, G. T., Dariavach, P., and Neuberger, M. S. (1991) The B-Cell Antigen Receptor of the Five Immunoglobulin Classes. Nature. 352, 777-781.