Phenotypic Mutation 'Plain_sight'

• Allele: Plain_sight
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 57,604,122 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Vav1
• Gene Name: vav 1 oncogene
• Chromosomal Location: 57,586,100-57,635,031 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012] ; PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000005889] [ENSMUSP00000108491] [ENSMUSP00000126694]
• AlphaFold: P27870
• PDB Structure: NMR STRUCTURE OF THE Y174 AUTOINHIBITED DBL HOMOLOGY DOMAIN [SOLUTION NMR] ; CRYSTAL STRUCTURE OF VAV SH3 DOMAIN [X-RAY DIFFRACTION] ; CRYSTAL STRUCTURE OF VAV AND GRB2 SH3 DOMAINS [X-RAY DIFFRACTION] ; Solution structure of N-terminal SH3 domain mutant(P33G) of murine Vav [SOLUTION NMR] ; Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method [SOLUTION NMR] ; CRITICAL STRUCTURAL ROLE FOR THE PH AND C1 DOMAINS OF THE VAV1 EXCHANGE FACTOR [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000005889; Gene: ENSMUSG00000034116; AA Change: E175K

Domain	Start	End	E-Value	Type
CH	3	115	5.69e-15	SMART
RhoGEF	198	372	7.89e-62	SMART
PH	403	506	8.45e-12	SMART
C1	516	564	3.67e-9	SMART
SH3	595	659	1.65e-8	SMART
SH2	669	751	8.88e-25	SMART
SH3	785	841	1.44e-22	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000005889)
• SMART Domains: Protein: ENSMUSP00000108491; Gene: ENSMUSG00000034116; AA Change: E175K

Domain	Start	End	E-Value	Type
CH	3	115	5.69e-15	SMART
RhoGEF	198	372	7.89e-62	SMART
PH	403	506	8.45e-12	SMART
C1	516	564	3.67e-9	SMART
SH3	595	659	1.65e-8	SMART
SH2	633	712	3.93e-2	SMART
SH3	746	802	1.44e-22	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000112870)
• SMART Domains: Protein: ENSMUSP00000126694; Gene: ENSMUSG00000034116; AA Change: E151K

Domain	Start	End	E-Value	Type
Pfam:CAMSAP_CH	27	79	6.2e-11	PFAM
RhoGEF	174	348	7.89e-62	SMART
PH	379	482	8.45e-12	SMART
C1	492	540	3.67e-9	SMART
SH3	571	635	1.65e-8	SMART
SH2	645	727	8.88e-25	SMART
SH3	761	817	1.44e-22	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000169220)
• Meta Mutation Damage Score: 0.3360
• Is this an essential gene?: Possibly nonessential (E-score: 0.257)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:39 PM by Diantha La Vine
• Record Created: 2017-08-21 8:21 AM by Bruce Beutler
• Record Posted: 2018-06-13
• Science Writers: Anne Murray
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011691, NM_001163815, NM_001163816; MGI:98923

Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU)(1) Targeted(9)

Phenotypic Description

Figure 1. Plain_sight mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Plain_sight phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5240, some of which showed reduced frequencies of B1 cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced B1 cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 67 mutations (X-axis) identified in the G1 male of pedigree R5240. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 67 mutations. The B1 cell phenotype was linked by continuous variable mapping to a mutation in Vav1:  a G to A transition at base pair 57,297,122 (v38) on chromosome 17, or base pair 18,044 in the GenBank genomic region NC_000083. Linkage was found with an additive model of inheritance, wherein nine variant homozygotes and 35 heterozygous mice departed phenotypically from 16 homozygous reference mice with a P value of 1.71 x 10^-5 (Figure 2). 

The mutation corresponds to residue 621 in the mRNA sequence NM_011691 within exon 5 of 27 total exons.

606 GGGGACGAGATCTACGAGGACCTAATGCGCTTG 170 -G--D--E--I--Y--E--D--L--M--R--L-

The mutated nucleotide is indicated in red. The mutation results in a glutamic acid to lysine substitution at amino acid 175 (E175K) in the VAV1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Domain structure of VAV1. The Plain_sight mutation results in a glutamic acid to lysine substitution at amino acid 175 in the VAV1 protein. Other mutations in VAV1 are noted. Click on each mutation to view more information.

Vav1 has several domains, including a calponin-homology (CH) domain, an acidic (Ac) motif, a DBL homology (DH) domain, a pleckstrin homology (PH) domain, a phorbol-ester/DAG-type zinc finger (alternatively, C1 domain), a proline-rich region, a Src homology 2 (SH2) domain, and two Src homology 3 (SH3) domains [PDB: 3KY9; (1;2); reviewed in (3)]. Vav1 also has two nuclear localization sequences.

The Plain_sight mutation results in a glutamic acid to lysine substitution at amino acid 175 (E175K). Amino acid 175 is within the Ac motif. The Ac motif contains three regulatory tyrosines: Tyr142, Tyr160, and Tyr174 (in mouse). Tyr174 binds the GTPase interaction pocket of the DH domain to control the guanine exchange factor (GEF) activity of Vav1 towards the Rho family GTPases Rac1, Rac2 (see the record for bingo), Cdc42, and RhoA . Phosphorylation of Tyr174 after receptor stimulation releases it from the binding pocket and alleviates the autoinhibition (2;4).

Please see the record tardive for more information about Vav1.

Putative Mechanism

Vav1 is a guanine nucleotide exchange factor (GEF) for Rho family GTPases. Vav1 is essential for hematopoiesis, including T- and B-cell development and activation (5-7). Vav1 also functions in the adhesion, migration, and phagocytosis of mature hematopoietic cells by regulating cytoskeletal rearrangement [reviewed in (8)]. In NK cells, the Vav1 GEF activity is required for activation of NK-associated killing (9). Vav1 has several functions in macrophages, including Rac-dependent complement-mediated phagocytosis (10), cell migration (11), and chemotaxis to CSF-1 (12).

Vav1 functions downstream of several immune receptors, including the T-cell receptor (TCR) (13), B-cell receptor (BCR) (14), natural killer (NK) receptors (15), FcRI (16), cytokine receptors (17), chemokine receptors (18), and integrins (19). 

Vav1 is a binding partner of Nef proteins from HIV-1 (20). Binding of VAV1 and Nef results in morphological changes, cytoskeletal rearrangements, and activation of the JNK/SAPK signaling cascade, subsequently leading to increased viral transcription and replication.

Vav1-deficient (Vav1^-/-) mice exhibited embryonic lethality between embryonic day (E) 3.5 and E7.5 (21). A second Vav1^-/- mouse model was viable, and exhibited impaired negative T cell selection (22). Single-positive (namely CD4+ T cells), double-positive, and double-negative T cell numbers as well as the number of mature B cells and B1 cells were reduced in the Vav1^-/- mice (23-28). T cells from the Vav1^-/- mice showed reduced proliferative responses to anti-CD3 stimulation as well as reduced T cell receptor-induced calcium fluxes (22;24;25). The T-dependent IgG response to VSV infection and to NIP-OVA was reduced (28). Homozygous mice expressing an ENU-induced Vav1 allele (F203S) exhibited increased numbers of T cells after immunization (MGI; accessed September 14, 2017).

Primers

PCR Primer
Plain_sight_pcr_F: GTTTAAGGTGACACATTGCAAGAC
Plain_sight_pcr_R: GGAGCCCAGTGTGTCTGTATAC

Sequencing Primer
Plain_sight_seq_F: TGACACATTGCAAGACGTGGG
Plain_sight_seq_R: GAGCCCAGTGTGTCTGTATACTTCTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 17, + strand):

1   gtttaaggtg acacattgca agacgtgggg ggaggggtgg cattgtgcat ttattcttca
61  ttctgaaagt ttctgatggg tccctggctt gggacatggc ctgaatctgt cccctagtga
121 caccgcagag gaagacgagg acctttatga ctgcgtggaa aatgaggagg cagaggggga
181 cgagatctac gaggacctaa tgcgcttgga gtcggtgcct acgccagtga gtgggcctgg
241 gaagggcggg gcaggtggga agggtagaga tggctgcagg gagcttcacc agcctctatg
301 gtctctgctc acagcccaag atgacagagt atgataagcg ctgctgctgc ctgcgggaga
361 tccagcagac ggaggagaag tatacagaca cactgggctc c

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Katzav, S., Martin-Zanca, D., and Barbacid, M. (1989) Vav, a Novel Human Oncogene Derived from a Locus Ubiquitously Expressed in Hematopoietic Cells. EMBO J. 8, 2283-2290.

  2. Yu, B., Martins, I. R., Li, P., Amarasinghe, G. K., Umetani, J., Fernandez-Zapico, M. E., Billadeau, D. D., Machius, M., Tomchick, D. R., and Rosen, M. K. (2010) Structural and Energetic Mechanisms of Cooperative Autoinhibition and Activation of Vav1. Cell. 140, 246-256.

  3. Katzav, S. (2009) Vav1: A Hematopoietic Signal Transduction Molecule Involved in Human Malignancies. Int J Biochem Cell Biol. 41, 1245-1248.

  4. Aghazadeh, B., Lowry, W. E., Huang, X. Y., and Rosen, M. K. (2000) Structural Basis for Relief of Autoinhibition of the Dbl Homology Domain of Proto-Oncogene Vav by Tyrosine Phosphorylation. Cell. 102, 625-633.

  5. Turner, M., Mee, P. J., Walters, A. E., Quinn, M. E., Mellor, A. L., Zamoyska, R., and Tybulewicz, V. L. (1997) A Requirement for the Rho-Family GTP Exchange Factor Vav in Positive and Negative Selection of Thymocytes. Immunity. 7, 451-460.

  6. Arana, E., Vehlow, A., Harwood, N. E., Vigorito, E., Henderson, R., Turner, M., Tybulewicz, V. L., and Batista, F. D. (2008) Activation of the Small GTPase Rac2 Via the B Cell Receptor Regulates B Cell Adhesion and Immunological-Synapse Formation. Immunity. 28, 88-99.

  7. Krawczyk, C., Oliveira-dos-Santos, A., Sasaki, T., Griffiths, E., Ohashi, P. S., Snapper, S., Alt, F., and Penninger, J. M. (2002) Vav1 Controls Integrin Clustering and MHC/peptide-Specific Cell Adhesion to Antigen-Presenting Cells. Immunity. 16, 331-343.

  8. Bertagnolo, V., Brugnoli, F., Grassilli, S., Nika, E., and Capitani, S. (2012) Vav1 in Differentiation of Tumoral Promyelocytes. Cell Signal. 24, 612-620.

  9. Billadeau, D. D., Brumbaugh, K. M., Dick, C. J., Schoon, R. A., Bustelo, X. R., and Leibson, P. J. (1998) The Vav-Rac1 Pathway in Cytotoxic Lymphocytes Regulates the Generation of Cell-Mediated Killing. J Exp Med. 188, 549-559.

  10. Hall, A. B., Gakidis, M. A., Glogauer, M., Wilsbacher, J. L., Gao, S., Swat, W., and Brugge, J. S. (2006) Requirements for Vav Guanine Nucleotide Exchange Factors and Rho GTPases in FcgammaR- and Complement-Mediated Phagocytosis. Immunity. 24, 305-316.

  11. Wells, C. M., Bhavsar, P. J., Evans, I. R., Vigorito, E., Turner, M., Tybulewicz, V., and Ridley, A. J. (2005) Vav1 and Vav2 Play Different Roles in Macrophage Migration and Cytoskeletal Organization. Exp Cell Res. 310, 303-310.

  12. Vedham, V., Phee, H., and Coggeshall, K. M. (2005) Vav Activation and Function as a Rac Guanine Nucleotide Exchange Factor in Macrophage Colony-Stimulating Factor-Induced Macrophage Chemotaxis. Mol Cell Biol. 25, 4211-4220.

  13. Bustelo, X. R., Ledbetter, J. A., and Barbacid, M. (1992) Product of Vav Proto-Oncogene Defines a New Class of Tyrosine Protein Kinase Substrates. Nature. 356, 68-71.

  14. Bustelo, X. R., and Barbacid, M. (1992) Tyrosine Phosphorylation of the Vav Proto-Oncogene Product in Activated B Cells. Science. 256, 1196-1199.

  15. Galandrini, R., Palmieri, G., Piccoli, M., Frati, L., and Santoni, A. (1999) Role for the Rac1 Exchange Factor Vav in the Signaling Pathways Leading to NK Cell Cytotoxicity. J Immunol. 162, 3148-3152.

  16. Manetz, T. S., Gonzalez-Espinosa, C., Arudchandran, R., Xirasagar, S., Tybulewicz, V., and Rivera, J. (2001) Vav1 Regulates Phospholipase Cgamma Activation and Calcium Responses in Mast Cells. Mol Cell Biol. 21, 3763-3774.

  17. Evans, G. A., Howard, O. M., Erwin, R., and Farrar, W. L. (1993) Interleukin-2 Induces Tyrosine Phosphorylation of the Vav Proto-Oncogene Product in Human T Cells: Lack of Requirement for the Tyrosine Kinase Lck. Biochem J. 294 ( Pt 2), 339-342.

  18. Garcia-Bernal, D., Wright, N., Sotillo-Mallo, E., Nombela-Arrieta, C., Stein, J. V., Bustelo, X. R., and Teixido, J. (2005) Vav1 and Rac Control Chemokine-Promoted T Lymphocyte Adhesion Mediated by the Integrin alpha4beta1. Mol Biol Cell. 16, 3223-3235.

  19. Zheng, L., Sjolander, A., Eckerdal, J., and Andersson, T. (1996) Antibody-Induced Engagement of Beta 2 Integrins on Adherent Human Neutrophils Triggers Activation of p21ras through Tyrosine Phosphorylation of the Protooncogene Product Vav. Proc Natl Acad Sci U S A. 93, 8431-8436.

  20. Fackler, O. T., Luo, W., Geyer, M., Alberts, A. S., and Peterlin, B. M. (1999) Activation of Vav by Nef Induces Cytoskeletal Rearrangements and Downstream Effector Functions. Mol Cell. 3, 729-739.

  21. Zmuidzinas, A., Fischer, K. D., Lira, S. A., Forrester, L., Bryant, S., Bernstein, A., and Barbacid, M. (1995) The Vav Proto-Oncogene is Required Early in Embryogenesis but Not for Hematopoietic Development in Vitro. EMBO J. 14, 1-11.

  22. Turner, M., Mee, P. J., Walters, A. E., Quinn, M. E., Mellor, A. L., Zamoyska, R., and Tybulewicz, V. L. (1997) A Requirement for the Rho-Family GTP Exchange Factor Vav in Positive and Negative Selection of Thymocytes. Immunity. 7, 451-460.

  23. Saveliev, A., Vanes, L., Ksionda, O., Rapley, J., Smerdon, S. J., Rittinger, K., and Tybulewicz, V. L. (2009) Function of the Nucleotide Exchange Activity of vav1 in T Cell Development and Activation. Sci Signal. 2, ra83.

  24. Fujikawa, K., Miletic, A. V., Alt, F. W., Faccio, R., Brown, T., Hoog, J., Fredericks, J., Nishi, S., Mildiner, S., Moores, S. L., Brugge, J., Rosen, F. S., and Swat, W. (2003) Vav1/2/3-Null Mice Define an Essential Role for Vav Family Proteins in Lymphocyte Development and Activation but a Differential Requirement in MAPK Signaling in T and B Cells. J Exp Med. 198, 1595-1608.

  25. Prisco, A., Vanes, L., Ruf, S., Trigueros, C., and Tybulewicz, V. L. (2005) Lineage-Specific Requirement for the PH Domain of Vav1 in the Activation of CD4+ but Not CD8+ T Cells. Immunity. 23, 263-274.

  26. Raberger, J., Boucheron, N., Sakaguchi, S., Penninger, J. M., and Ellmeier, W. (2008) Impaired T-Cell Development in the Absence of Vav1 and Itk. Eur J Immunol. 38, 3530-3542.

  27. Fischer, K. D., Kong, Y. Y., Nishina, H., Tedford, K., Marengere, L. E., Kozieradzki, I., Sasaki, T., Starr, M., Chan, G., Gardener, S., Nghiem, M. P., Bouchard, D., Barbacid, M., Bernstein, A., and Penninger, J. M. (1998) Vav is a Regulator of Cytoskeletal Reorganization Mediated by the T-Cell Receptor. Curr Biol. 8, 554-562.

  28. Bachmann, M. F., Nitschke, L., Krawczyk, C., Tedford, K., Ohashi, P. S., Fischer, K. D., and Penninger, J. M. (1999) The Guanine-Nucleotide Exchange Factor Vav is a Crucial Regulator of B Cell Receptor Activation and B Cell Responses to Nonrepetitive Antigens. J Immunol. 163, 137-142.