Phenotypic Mutation 'Patently'

• Allele: Patently
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 3,209,475 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Insr
• Gene Name: insulin receptor
• Synonym(s): 4932439J01Rik, D630014A15Rik, IR, IR-B, IR-A, CD220
• Chromosomal Location: 3,200,922-3,329,649 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016] ; PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Phenylalanine changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000088837]
• AlphaFold: P15208
• PDB Structure: 1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000088837; Gene: ENSMUSG00000005534; AA Change: F1203L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Recep_L_domain	52	164	5e-28	PFAM
FU	231	274	1.66e-10	SMART
Pfam:Recep_L_domain	359	473	2.5e-30	PFAM
FN3	496	602	4.02e1	SMART
FN3	624	821	1.16e-6	SMART
FN3	841	924	3.17e-4	SMART
transmembrane domain	947	969	N/A	INTRINSIC
TyrKc	1013	1280	3.11e-134	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1327	1336	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000091291)
• Predicted Effect: unknown
• Meta Mutation Damage Score: 0.9285
• Is this an essential gene?: Probably essential (E-score: 0.879)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Last Updated: 2019-09-04 9:39 PM by Diantha La Vine
• Record Created: 2017-08-28 11:16 AM by Bruce Beutler
• Record Posted: 2018-10-25
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Zhao Zhang and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010568, NM_001330056; MGI:96575

Alleles Listed at MGI

All Mutations and Alleles(19) : Chemically induced (ENU)(3) Gene trapped(2) Targeted(8) Transgenic(6)

Phenotypic Description

Figure 1. Patently mice exhibited high insulin levels after a 30-minute glucose challenge . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Patently phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5073, some of which showed high insulin levels after a 30-minute glucose challenge (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hyperinsulinemia phenotype using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 113 mutations (X-axis) identified in the G1 male of pedigree R5073. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 113 mutations. The hyperinsulinemia phenotype was linked by continuous variable mapping to a mutation in Insr: a T to C transition at base pair 3,159,475 (v38) on chromosome 8, or base pair 120,175 in the GenBank genomic region NC_000074 encoding Insr. Linkage was found with a dominant model of inheritance, wherein 14 heterozygous mice departed phenotypically from 7 homozygous reference mice with a P value of 8.963 x 10^-11 (Figure 2); no homozygous variant mice were born to pedigree R5073.  

The mutation corresponds to residue 4,096 in the mRNA sequence NM_010568 within exon 19 of 21 total exons.

4081 CTGAAGGATGGAGTCTTTACTGCTTCTTCTGAT 1198 -L--K--D--G--V--F--T--A--S--S--D-

The mutated nucleotide is indicated in red. The mutation results in a phenylalanine to leucine substitution at position 1,203 (F1203L) in the INSR protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Domain organization of IR. The Patently mutation results in a phenylalanine to leucine substitution at position 1203. Domain information is from SMART and UniProt. This image is interactive. Click on each mutation for more information.

Insr encodes the ubiquitously expressed insulin receptor (IR), a member of the receptor tyrosine kinase family. The IR is either a dimer comprised of an extracellular α subunit and a membrane-spanning β subunit (αβ), or a heterotetramer of two α and two β  subunits (α₂β₂); the α and β subunits are both coded by Insr. The α and β subunits are joined by disulfide bonds, which are proteolytically processed at a precursor processing enzyme cleavage site to generate the individual subunits (1;2).

IR has a 27-amino acid signal sequence (Figure 3). The α subunit has two leucine-rich domains, a cysteine-rich domain, a fibronectin type III (FnIII) domain, a partial FnIII domain, and a long carboxy-terminal segment that has the furin cleavage site (3;4). The β subunit begins (after a short amino-terminal segment) with the completion of the partial FnIII domain of the α subunit, a third FnIII domain, a transmembrane domain, a juxtamembrane region, a tyrosine kinase domain, and a carboxy-terminal region. 

The Patently mutation results in a phenylalanine to leucine substitution at position 1,203 (F1203L), which is within the kinase domain of the β subunit.

Please see the record gummi_bear for more information about Insr.

Putative Mechanism

The insulin signaling pathway regulates glucose uptake and release as well as the synthesis and storage of carbohydrates and lipids. Binding of insulin to the IR activates IR intrinsic tyrosine kinase activity, which propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways (5).  Phosphorylation of the juxtamembrane region of the IR recruits downstream signaling proteins (e.g., insulin receptor substrate proteins [Irs1 (see the record for runt) and Irs2 (see the record for dum_dum)] and Shc [see the record for shrine (Sch2)]).

Mutations in INSR are associated with insulin-resistant diabetes mellitus with acanthosis nigricans [OMIM: #610549; (6-8)]. Acanthosis nigricans is a skin condition characterized by areas of discoloration in body folds and creases often in the armpits, groin, and neck. INSR mutations are also linked to familial hyperinsulinemic hypoglycemia 5 [HHF5; OMIM: #609968; (9)], leprechaunism [alternatively, Donohue syndrome; OMIM: #246200; (10-14)], and Rabson-Mendenhall syndrome [OMIM: #262190; (15;16)]. Patients with leprechaunism have growth delays, skin abnormalities, reduced muscle mass, phallic enlargement, and insulin resistance. Patients with Rabson-Mendenhall syndrome exhibit dental and skin abnormalities, abdominal distention, and phallic enlargement.

Insr-deficient (Insr^-/-) mice exhibited postnatal lethality within 72 hours after birth due to hyperglycemia, diabetic ketoacidosis, and hepatic steatosis (17;18). Insr^-/- mice exhibit reduced body weights compared to wild-type controls. Rescue of IR expression in brain, liver, and pancreatic beta cells rescued the Insr^-/- mice from neonatal death, prevented diabetes in most mice, and normalized adipose tissue content, lifespan, and reproductive function (19). Heterozygous Insr mice (Insr^+/-) mice exhibited increased circulating insulin levels and insulin resistance (20;21). Heterozygous mice for an ENU-induced Insr alleles exhibited hyperglycemia and increased circulating insulin levels (MGI).

The phenotype observed in the patently mice indicates loss of IR-associated function.

Primers

PCR Primer
Patently_pcr_F: TAGCCATCTAAGAGAACCCAGA
Patently_pcr_R: TCAAGAATCCTTTCCCTCTGAG

Sequencing Primer
Patently_seq_F: CCCAGACAGATAAACCTTCATTTC
Patently_seq_R: CTCAGCTCTAGTGGTGCTTCAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 8, - strand):

1   tcaagaatcc tttccctctg agtttgcctg ctaccctcag ctctagtggt gcttcaaggg
61  gtagagcact caagatggta ggaggatgac ctgaaaaacc tgtgcactgt ttgttgtcag
121 actttggaat gacaagggac atctacgaga cagattacta tcggaaaggg ggcaagggac
181 tgcttcctgt gaggtggatg tcacctgagt ccctgaagga tggagtcttt actgcttctt
241 ctgatatgtg gtgagttata catacatggg tggatattag tgctgggctt gaactcctga
301 aggtgtccca ctaatgtgct catcaggagg tgatagagga aagcccatct ttcacatata
361 gaaatgaagg tttatctgtc tgggttctct tagatggcta 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Ullrich, A., Bell, J. R., Chen, E. Y., Herrera, R., Petruzzelli, L. M., Dull, T. J., Gray, A., Coussens, L., Liao, Y. C., and Tsubokawa, M. (1985) Human Insulin Receptor and its Relationship to the Tyrosine Kinase Family of Oncogenes. Nature. 313, 756-761.

  2. Sparrow, L. G., McKern, N. M., Gorman, J. J., Strike, P. M., Robinson, C. P., Bentley, J. D., and Ward, C. W. (1997) The Disulfide Bonds in the C-Terminal Domains of the Human Insulin Receptor Ectodomain. J Biol Chem. 272, 29460-29467.

  3. Menting, J. G., Whittaker, J., Margetts, M. B., Whittaker, L. J., Kong, G. K., Smith, B. J., Watson, C. J., Zakova, L., Kletvikova, E., Jiracek, J., Chan, S. J., Steiner, D. F., Dodson, G. G., Brzozowski, A. M., Weiss, M. A., Ward, C. W., and Lawrence, M. C. (2013) How Insulin Engages its Primary Binding Site on the Insulin Receptor. Nature. 493, 241-245.

  4. Croll, T. I., Smith, B. J., Margetts, M. B., Whittaker, J., Weiss, M. A., Ward, C. W., and Lawrence, M. C. (2016) Higher-Resolution Structure of the Human Insulin Receptor Ectodomain: Multi-Modal Inclusion of the Insert Domain. Structure. 24, 469-476.

  5. Khan, A. H., and Pessin, J. E. (2002) Insulin Regulation of Glucose Uptake: A Complex Interplay of Intracellular Signalling Pathways. Diabetologia. 45, 1475-1483.

  6. Odawara, M., Kadowaki, T., Yamamoto, R., Shibasaki, Y., Tobe, K., Accili, D., Bevins, C., Mikami, Y., Matsuura, N., and Akanuma, Y. (1989) Human Diabetes Associated with a Mutation in the Tyrosine Kinase Domain of the Insulin Receptor. Science. 245, 66-68.

  7. Moller, D. E., Cohen, O., Yamaguchi, Y., Assiz, R., Grigorescu, F., Eberle, A., Morrow, L. A., Moses, A. C., and Flier, J. S. (1994) Prevalence of Mutations in the Insulin Receptor Gene in Subjects with Features of the Type A Syndrome of Insulin Resistance. Diabetes. 43, 247-255.

  8. Accili, D., Frapier, C., Mosthaf, L., McKeon, C., Elbein, S. C., Permutt, M. A., Ramos, E., Lander, E., Ullrich, A., and Taylor, S. I. (1989) A Mutation in the Insulin Receptor Gene that Impairs Transport of the Receptor to the Plasma Membrane and Causes Insulin-Resistant Diabetes. EMBO J. 8, 2509-2517.

  9. Hojlund, K., Hansen, T., Lajer, M., Henriksen, J. E., Levin, K., Lindholm, J., Pedersen, O., and Beck-Nielsen, H. (2004) A Novel Syndrome of Autosomal-Dominant Hyperinsulinemic Hypoglycemia Linked to a Mutation in the Human Insulin Receptor Gene. Diabetes. 53, 1592-1598.

  10. Psiachou, H., Mitton, S., Alaghband-Zadeh, J., Hone, J., Taylor, S. I., and Sinclair, L. (1993) Leprechaunism and Homozygous Nonsense Mutation in the Insulin Receptor Gene. Lancet. 342, 924.

  11. Hone, J., Accili, D., al-Gazali, L. I., Lestringant, G., Orban, T., and Taylor, S. I. (1994) Homozygosity for a New Mutation (Ile119-->Met) in the Insulin Receptor Gene in Five Sibs with Familial Insulin Resistance. J Med Genet. 31, 715-716.

  12. van der Vorm, E. R., Kuipers, A., Kielkopf-Renner, S., Krans, H. M., Moller, W., and Maassen, J. A. (1994) A Mutation in the Insulin Receptor that Impairs Proreceptor Processing but Not Insulin Binding. J Biol Chem. 269, 14297-14302.

  13. al-Gazali, L. I., Khalil, M., and Devadas, K. (1993) A Syndrome of Insulin Resistance Resembling Leprechaunism in Five Sibs of Consanguineous Parents. J Med Genet. 30, 470-475.

  14. Krook, A., Brueton, L., and O'Rahilly, S. (1993) Homozygous Nonsense Mutation in the Insulin Receptor Gene in Infant with Leprechaunism. Lancet. 342, 277-278.

  15. Moncada, V. Y., Hedo, J. A., Serrano-Rios, M., and Taylor, S. I. (1986) Insulin-Receptor Biosynthesis in Cultured Lymphocytes from an Insulin-Resistant Patient (Rabson-Mendenhall Syndrome). Evidence for Defect before Insertion of Receptor into Plasma Membrane. Diabetes. 35, 802-807.

  16. Takahashi, Y., Kadowaki, H., Ando, A., Quin, J. D., MacCuish, A. C., Yazaki, Y., Akanuma, Y., and Kadowaki, T. (1998) Two Aberrant Splicings Caused by Mutations in the Insulin Receptor Gene in Cultured Lymphocytes from a Patient with Rabson-Mendenhall's Syndrome. J Clin Invest. 101, 588-594.

  17. Accili, D., Drago, J., Lee, E. J., Johnson, M. D., Cool, M. H., Salvatore, P., Asico, L. D., Jose, P. A., Taylor, S. I., and Westphal, H. (1996) Early Neonatal Death in Mice Homozygous for a Null Allele of the Insulin Receptor Gene. Nat Genet. 12, 106-109.

  18. Joshi, R. L., Lamothe, B., Cordonnier, N., Mesbah, K., Monthioux, E., Jami, J., and Bucchini, D. (1996) Targeted Disruption of the Insulin Receptor Gene in the Mouse Results in Neonatal Lethality. EMBO J. 15, 1542-1547.

  19. Okamoto, H., Nakae, J., Kitamura, T., Park, B. C., Dragatsis, I., and Accili, D. (2004) Transgenic Rescue of Insulin Receptor-Deficient Mice. J Clin Invest. 114, 214-223.

  20. Tanabe, K., Liu, Z., Patel, S., Doble, B. W., Li, L., Cras-Meneur, C., Martinez, S. C., Welling, C. M., White, M. F., Bernal-Mizrachi, E., Woodgett, J. R., and Permutt, M. A. (2008) Genetic Deficiency of Glycogen Synthase Kinase-3beta Corrects Diabetes in Mouse Models of Insulin Resistance. PLoS Biol. 6, e37.

  21. Goldsworthy, M., Hugill, A., Freeman, H., Horner, E., Shimomura, K., Bogani, D., Pieles, G., Mijat, V., Arkell, R., Bhattacharya, S., Ashcroft, F. M., and Cox, R. D. (2008) Role of the Transcription Factor sox4 in Insulin Secretion and Impaired Glucose Tolerance. Diabetes. 57, 2234-2244.