Phenotypic Mutation 'Tannin'

• Allele: Tannin
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 82,108,408 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Tnfrsf13c
• Gene Name: tumor necrosis factor receptor superfamily, member 13c
• Synonym(s): BAFF-R, 2010006P15Rik, Bcmd-1, Baffr, Lvis22, Bcmd1
• Chromosomal Location: 82,105,944-82,108,570 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B cell-activating factor (BAFF) enhances B-cell survival in vitro and is a regulator of the peripheral B-cell population. Overexpression of Baff in mice results in mature B-cell hyperplasia and symptoms of systemic lupus erythematosus (SLE). Also, some SLE patients have increased levels of BAFF in serum. Therefore, it has been proposed that abnormally high levels of BAFF may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells. The protein encoded by this gene is a receptor for BAFF and is a type III transmembrane protein containing a single extracellular cysteine-rich domain. It is thought that this receptor is the principal receptor required for BAFF-mediated mature B-cell survival. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous inactivation of this gene results in defective splenic B-cell maturation, reduced marginal zone B-cell numbers, and impaired T-cell-dependent antibody formation. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Methionine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000086564] [ENSMUSP00000105161] [ENSMUSP00000154899]
• AlphaFold: Q9D8D0
• SMART Domains: Protein: ENSMUSP00000086564; Gene: ENSMUSG00000068105; AA Change: V36M

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
Pfam:BaffR-Tall_bind	19	49	2.4e-25	PFAM
transmembrane domain	73	95	N/A	INTRINSIC
PDB:2GKW|B	152	175	1e-7	PDB

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
  (Using ENSMUST00000089161)
• SMART Domains: Protein: ENSMUSP00000105161; Gene: ENSMUSG00000068105; AA Change: V36M

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
Pfam:BaffR-Tall_bind	19	49	5.4e-26	PFAM
transmembrane domain	109	131	N/A	INTRINSIC
PDB:2GKW|B	177	200	2e-7	PDB

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000109535)
• Predicted Effect: probably benign
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000231049)
• Meta Mutation Damage Score: 0.6648
• Is this an essential gene?: Probably nonessential (E-score: 0.194)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Last Updated: 2019-09-04 9:39 PM by Anne Murray
• Record Created: 2017-08-28 11:27 AM by Bruce Beutler
• Record Posted: 2018-08-20
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_028075, NM_001357758; MGI:1919299

Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (other)(1) QTL(2) Radiation induced(2) Targeted(5)

Phenotypic Description

Figure 1. Tannin mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Tannin mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Tannin mice exhibit decreased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Tannin mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The tannin phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5058, some of which showed a reduced B to T cell ratio (Figure 1) due to reduced frequencies of peripheral blood B cells (Figure 2), IgD+ B cells (Figure 3), and IgM+ B cells (Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of the reduced frequencies of IgD+ B cells using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 74 mutations (X-axis) identified in the G1 male of pedigree R5058. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 74 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tnfrsf13c:  a G to A transition at base pair 82,224,207 (v38) on chromosome 15, or base pair 174 in the GenBank genomic region NC_000081 encoding Tnfrsf13c. The strongest association was found with a dominant model of inheritance to the IgD+ B cell phenotype, wherein 30 heterozygous mice departed phenotypically from 18 homozygous reference mice with a P value of 0.000168 (Figure 5); no homozygous variant mice were born to pedigree R5058.  

The mutation corresponds to residue 174 in the mRNA sequence NM_028075 within exon 1 of 3 total exons.

159 CTGGTGAGAAACTGCGTGTCCTGTGAGCTCTTC 31  -L--V--R--N--C--V--S--C--E--L--F-

The mutated nucleotide is indicated in red.  The mutation results in a valine to methionine substitution at residue 36 (V36M) in the BAFF-R protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.979).

Protein Prediction

Figure 6. Domain structure of the BAFFR protein. The tannin mutation results in a valine to methionine substitution at residue 36. Other mutations found in the BAFF protein are noted in red. Click on each mutation for more information. Abbreviations: LBD, ligand-binding domain; TM, transmembrane domain; TRAF, TRAF-binding motif

Tnfrsf13c encodes B cell activating factor receptor (BAFFR; alternatively, BR3, CD268, or TNFRSF17), a type III membrane protein. BAFFR has an extracellular ligand-binding domain, a single transmembrane domain, and an intracellular domain that binds the downstream signaling molecule, TRAF3 (see the record for hulk) (Figure 6) (1;2). For more information about the BAFFR ligand BAFF, please the record for Frozen.

BAFFR undergoes proteolytic shedding, resulting in reduced cell surface expression and ligand-mediated cell survival (3). BAFFR is cleaved by ADAM10 or ADAM17. BAFF trimers promote BAFFR cleavage by ADAM10, while BAFF oligomers (60-mer formed of 20 trimers) promote ADAM17-mediated cleavage of BAFFR. BAFFR cleavage is dependent on BAFF binding to functional BAFFR and TACI (TACI is another BAFF receptor). Binding of BAFF to BAFFR and TACI brings ADAM10 in close proximity to BAFFR, subsequently promoting BAFFR cleavage. After BAFFR cleavage, the extracellular domain of BAFFR is released and the C-terminal fragment is processed in lysosomes (4). The function of the shed BAFFR ectodomain is unknown; the ectodomains of other BAF receptors acts as decoys for BAFF and another ligand APRIL (5-7). BAFFR shedding on germinal center B cells promotes B cell maturation, and shedding of the BAFF receptors BCMA, TACI, and BAFFR regulates B cell survival (3).

Alternative splice donor sites in exon 1 and alternative acceptor sites in exon 3 generate several mouse BAFFR isoforms. Each isoform shares the same ligand binding and TRAF binding sites. The functional significance of these isoforms is unknown.

The tannin mutation results in a valine to methionine substitution at residue 36 (V36M) in the BAFFR protein; Val36 is within the LBD.

Expression/Localization

BAFFR is expressed on mature follicular and marginal zone B cells as well as on T2 and T3 transitional B cells, plasma cells, a subset of circulating T cells, and plasmablasts (2;8-10).

BAFFR expression is observed in most B cell lymphoproliferative disorders, including follicular lymphoma, mantle cell lymphoma, a subset of diffuse large B-cell lymphomas, marginal zone lymphoma, hairy cell leukemia, and chronic lymphocytic leukemia/small lymphocytic lymphoma (9). BAFFR is not expressed in Pre–B acute lymphoblastic lymphoma, Burkitt lymphoma, and nodular lymphocyte-predominant Hodgkin lymphoma (9).

Background

Figure 7. BAFFR signaling pathway. BAFFR can activate the non-canonical NF-κB signaling pathway. BAFFR binds to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

BAFF/BAFFR signaling is essential for B cell homeostasis, differentiation, proliferation, survival, and function (Figure 7) (3-8). BAFF/BAFFR activates the alternative NF-κB (NF-κB2) signaling pathway (see the record for xander) to mediate splenic B cell survival and maturation (9;10). The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52 through IKK-1 and NIK, and results in the activation of p52/RelB heterodimers (11;12). TRAF2 and TRAF5 positively regulate NIK activity under certain conditions (13), but in other contexts, TRAF2 and TRAF3 form a complex with NIK to mediate NIK degradation (14-17). After stimulation with BAFFR, the complex is destabilized by TRAF2/3 degradation, permitting the release of NIK from the complex (15-17). After NIK is activated, it is able to bind to and phosphorylate several substrates including IKK-1 and p100, and serves as a docking molecule between IKK-1 and p100 (18-20). Phosphorylation of p100 by IKK-1 results in polyubiquitination and processing to p52 (19). BAFF/BAFFR-induced NF-κB2 signaling promotes B cell survival by upregulating integrins that retains autoreactive B cells in the splenic marginal zone (21). In addition, ERK activation is sustained and there is an increased turnover of Bim, a proapoptotic protein (9;10;22). BAFF also activates the classical NF-κB (NF-κB1) signaling pathway (see the record for Finlay) to regulate immunoglobulin class switching (to IgG and IgE) through an induction of activation induced deaminase (AID) and to generate antibodies (21).

During T cell activation, there are two required signals transmitted by the antigen presenting cell (APC): signal 1 and signal 2. Signal 1 occurs upon recognition of the antigenic peptide MHC complex by the T cell receptor, and signal 2 occurs upon recognition of molecules expressed constitutively by professional APCs. BAFF binds to BAFFR expressed on naïve and primed/memory CD4 and CD8 T cells. In the presence of signal 1, BAFF/BAFFR promotes T cell activation, proliferation, and cytokine production (8;11;12).

The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis. BAFF binding to the BAFFR activates phosphoinositide 3-kinase (PI3K), an upstream activator of mTOR, which subsequently activates Akt (23). BAFF-stimulated activation of mTOR leads to subsequent phosphorylation of mTOR targets p70 S6 kinase and the translational inhibitor 4E-BP1 as well as the activation of Akt targets forkhead transcription factors FOXO3a and FOXO1 [reviewed in (24)].

Mutations in TNFRSF13C are associated with common variable immunodeficiency-4 (OMIM: #613494) (13).  Patients with common variable immunodeficiency-4 have recurrent infections, persistent B-cell lymphopenia, reduced numbers of class-switched memory B cells, low levels of serum IgG and IgM, and defective T cell-independent humoral responses (13).

Putative Mechanism

The BAFFR-associated signaling is required for expression of the B cell co-receptor complex components CD21 and CD23 (14;15). Tnfrsf13c-deficient (Tnfrsf13c^-/-) mice showed reduce surface expression of CD21 and CD23 on mature B cells (15). Tnfrsf13c^-/- mice exhibited defects in B cell development and survival (16;17). Tnfrsf13c^-/- mice showed reduced numbers of late transitional B cells, follicular B cells, and marginal zone B cells (15). The Tnfrsf13c^-/- mice exhibited reduced antigen-specific antibody responses, but formed spontaneous germinal centers in mesenteric lymph nodes (15). The Tnfrsf13c^-/- mice also showed reduced B cell proliferation after LPS, anti-CD40, anti-IgM, and IL4 stimulation as well as reduced anti-NP IgG levels, reduced CD4+ T cell proliferation, and reduced interferon-gamma secretion in a mixed lymphocyte response (18;19). A/WySnj mice have a transposon insertion that replaces the last eight amino acids of BAFFR (16;20). The mutant BAFFR is expressed on the surface of B cells and binds BAFF, but it shows aberrant signaling (10). The A/WySnj mice have CD21- and CD23-expressing follicular and CD21^highCD23^low marginal zone B cells as well as normal IgM serum levels (17;20;21). The A/WySnj mice show normal IgM antibody responses to T-dependent and T-independent antigens, but the IgG responses are diminished (17).

The phenotype of the tannin mice indicates loss of BAFFR function and diminished BAFF/BAFFR-associated signaling.

Primers

PCR Primer
Tannin_pcr_F: CTCCTTCTGAAGTGTCTGGG
Tannin_pcr_R: TCATTCTAGACTACAGGGCACAC

Sequencing Primer
Tannin_seq_F: AGTATCAGTCCCAGGAGTGC
Tannin_seq_R: CAGCCCAGACTCGGAACTGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 649 nucleotides is amplified (chromosome 15, - strand):

1   tcattctaga ctacagggca cacagcccag actcggaact gtcccagctg catgaggcgg
61  cgacatgggc gccaggagac tccgggtccg aagccagagg agccgggaca gctcggtgcc
121 cacccagtgc aatcagaccg agtgcttcga ccctctggtg agaaactgcg tgtcctgtga
181 gctcttccac acgccggaca ctggacatag taagcaaagg catggggata ggcgcgacct
241 gcctgaggta tccagcctac cagcgccgca tgctcctctg ctgaccctgg agccaatggt
301 ctcccacatc cctcactgtt agtctctccc tcccccctcc ccatctctct ttccctcctc
361 ctccccctcc ccctcccccg tccctctccg tctccccctc ccccatccct ttatccccct
421 catccccaca tccccttatc cgctctgcca acagcaagca gcctggagcc tgggacagct
481 ctgcagcctc aggagggctc cgcgctgaga cccgacgtgg cgctgctcgt cggtgccccc
541 gcactcctgg gactgatact ggcgctgacc ctggtgggtc tagtgagtct ggtgagctgg
601 aggtggcgtc aacagctcag gacggcctcc ccagacactt cagaaggag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Thompson, J. S., Bixler, S. A., Qian, F., Vora, K., Scott, M. L., Cachero, T. G., Hession, C., Schneider, P., Sizing, I. D., Mullen, C., Strauch, K., Zafari, M., Benjamin, C. D., Tschopp, J., Browning, J. L., and Ambrose, C. (2001) BAFF-R, a Newly Identified TNF Receptor that Specifically Interacts with BAFF. Science. 293, 2108-2111.

  2. Shulga-Morskaya, S., Dobles, M., Walsh, M. E., Ng, L. G., MacKay, F., Rao, S. P., Kalled, S. L., and Scott, M. L. (2004) B Cell-Activating Factor Belonging to the TNF Family Acts through Separate Receptors to Support B Cell Survival and T Cell-Independent Antibody Formation. J Immunol. 173, 2331-2341.

  3. Schneider, P., MacKay, F., Steiner, V., Hofmann, K., Bodmer, J. L., Holler, N., Ambrose, C., Lawton, P., Bixler, S., Acha-Orbea, H., Valmori, D., Romero, P., Werner-Favre, C., Zubler, R. H., Browning, J. L., and Tschopp, J. (1999) BAFF, a Novel Ligand of the Tumor Necrosis Factor Family, Stimulates B Cell Growth. J Exp Med. 189, 1747-1756.

  4. Moore, P. A., Belvedere, O., Orr, A., Pieri, K., LaFleur, D. W., Feng, P., Soppet, D., Charters, M., Gentz, R., Parmelee, D., Li, Y., Galperina, O., Giri, J., Roschke, V., Nardelli, B., Carrell, J., Sosnovtseva, S., Greenfield, W., Ruben, S. M., Olsen, H. S., Fikes, J., and Hilbert, D. M. (1999) BLyS: Member of the Tumor Necrosis Factor Family and B Lymphocyte Stimulator. Science. 285, 260-263.

  5. Chu, V. T., Enghard, P., Riemekasten, G., and Berek, C. (2007) In Vitro and in Vivo Activation Induces BAFF and APRIL Expression in B Cells. J Immunol. 179, 5947-5957.

  6. Hsu, B. L., Harless, S. M., Lindsley, R. C., Hilbert, D. M., and Cancro, M. P. (2002) Cutting Edge: BLyS Enables Survival of Transitional and Mature B Cells through Distinct Mediators. J Immunol. 168, 5993-5996.

  7. Batten, M., Groom, J., Cachero, T. G., Qian, F., Schneider, P., Tschopp, J., Browning, J. L., and Mackay, F. (2000) BAFF Mediates Survival of Peripheral Immature B Lymphocytes. J Exp Med. 192, 1453-1466.

  8. Yang, M., Sun, L., Wang, S., Ko, K. H., Xu, H., Zheng, B. J., Cao, X., and Lu, L. (2010) Novel Function of B Cell-Activating Factor in the Induction of IL-10-Producing Regulatory B Cells. J Immunol. 184, 3321-3325.

  9. Claudio, E., Brown, K., Park, S., Wang, H., and Siebenlist, U. (2002) BAFF-Induced NEMO-Independent Processing of NF-Kappa B2 in Maturing B Cells. Nat Immunol. 3, 958-965.

  10. Kayagaki, N., Yan, M., Seshasayee, D., Wang, H., Lee, W., French, D. M., Grewal, I. S., Cochran, A. G., Gordon, N. C., Yin, J., Starovasnik, M. A., and Dixit, V. M. (2002) BAFF/BLyS Receptor 3 Binds the B Cell Survival Factor BAFF Ligand through a Discrete Surface Loop and Promotes Processing of NF-kappaB2. Immunity. 17, 515-524.

  11. Vallabhapurapu, S., and Karin, M. (2009) Regulation and Function of NF-kappaB Transcription Factors in the Immune System. Annu Rev Immunol. 27, 693-733.

  12. Senftleben, U., Cao, Y., Xiao, G., Greten, F. R., Krahn, G., Bonizzi, G., Chen, Y., Hu, Y., Fong, A., Sun, S. C., and Karin, M. (2001) Activation by IKKalpha of a Second, Evolutionary Conserved, NF-Kappa B Signaling Pathway. Science. 293, 1495-1499.

  13. Song, H. Y., Regnier, C. H., Kirschning, C. J., Goeddel, D. V., and Rothe, M. (1997) Tumor Necrosis Factor (TNF)-Mediated Kinase Cascades: Bifurcation of Nuclear Factor-kappaB and c-Jun N-Terminal Kinase (JNK/SAPK) Pathways at TNF Receptor-Associated Factor 2. Proc Natl Acad Sci U S A. 94, 9792-9796.

  14. Liao, G., Zhang, M., Harhaj, E. W., and Sun, S. C. (2004) Regulation of the NF-kappaB-Inducing Kinase by Tumor Necrosis Factor Receptor-Associated Factor 3-Induced Degradation. J Biol Chem. 279, 26243-26250.

  15. Vallabhapurapu, S., Matsuzawa, A., Zhang, W., Tseng, P. H., Keats, J. J., Wang, H., Vignali, D. A., Bergsagel, P. L., and Karin, M. (2008) Nonredundant and Complementary Functions of TRAF2 and TRAF3 in a Ubiquitination Cascade that Activates NIK-Dependent Alternative NF-kappaB Signaling. Nat Immunol. 9, 1364-1370.

  16. Zarnegar, B. J., Wang, Y., Mahoney, D. J., Dempsey, P. W., Cheung, H. H., He, J., Shiba, T., Yang, X., Yeh, W. C., Mak, T. W., Korneluk, R. G., and Cheng, G. (2008) Noncanonical NF-kappaB Activation Requires Coordinated Assembly of a Regulatory Complex of the Adaptors cIAP1, cIAP2, TRAF2 and TRAF3 and the Kinase NIK. Nat Immunol. 9, 1371-1378.

  17. Gardam, S., Sierro, F., Basten, A., Mackay, F., and Brink, R. (2008) TRAF2 and TRAF3 Signal Adapters Act Cooperatively to Control the Maturation and Survival Signals Delivered to B Cells by the BAFF Receptor. Immunity. 28, 391-401.

  18. Xiao, G., Harhaj, E. W., and Sun, S. C. (2001) NF-kappaB-Inducing Kinase Regulates the Processing of NF-kappaB2 p100. Mol Cell. 7, 401-409.

  19. Xiao, G., Fong, A., and Sun, S. C. (2004) Induction of p100 Processing by NF-kappaB-Inducing Kinase Involves Docking IkappaB Kinase Alpha (IKKalpha) to p100 and IKKalpha-Mediated Phosphorylation. J Biol Chem. 279, 30099-30105.

  20. Qing, G., and Xiao, G. (2005) Essential Role of IkappaB Kinase Alpha in the Constitutive Processing of NF-kappaB2 p100. J Biol Chem. 280, 9765-9768.

  21. Enzler, T., Bonizzi, G., Silverman, G. J., Otero, D. C., Widhopf, G. F., Anzelon-Mills, A., Rickert, R. C., and Karin, M. (2006) Alternative and Classical NF-Kappa B Signaling Retain Autoreactive B Cells in the Splenic Marginal Zone and Result in Lupus-Like Disease. Immunity. 25, 403-415.

  22. Otipoby, K. L., Sasaki, Y., Schmidt-Supprian, M., Patke, A., Gareus, R., Pasparakis, M., Tarakhovsky, A., and Rajewsky, K. (2008) BAFF Activates Akt and Erk through BAFF-R in an IKK1-Dependent Manner in Primary Mouse B Cells. Proc Natl Acad Sci U S A. 105, 12435-12438.

  23. Gibbons, J. J., Abraham, R. T., and Yu, K. (2009) Mammalian Target of Rapamycin: Discovery of Rapamycin Reveals a Signaling Pathway Important for Normal and Cancer Cell Growth. Semin Oncol. 36 Suppl 3, S3-S17.

  24. Woodland, R. T., Schmidt, M. R., and Thompson, C. B. (2006) BLyS and B Cell Homeostasis. Semin Immunol. 18, 318-326.