Allele | Tannin | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 15 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 82,108,408 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | C ⇒ T (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Tnfrsf13c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | tumor necrosis factor receptor superfamily, member 13c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | BAFF-R, 2010006P15Rik, Bcmd-1, Baffr, Lvis22, Bcmd1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 82,105,944-82,108,570 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B cell-activating factor (BAFF) enhances B-cell survival in vitro and is a regulator of the peripheral B-cell population. Overexpression of Baff in mice results in mature B-cell hyperplasia and symptoms of systemic lupus erythematosus (SLE). Also, some SLE patients have increased levels of BAFF in serum. Therefore, it has been proposed that abnormally high levels of BAFF may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells. The protein encoded by this gene is a receptor for BAFF and is a type III transmembrane protein containing a single extracellular cysteine-rich domain. It is thought that this receptor is the principal receptor required for BAFF-mediated mature B-cell survival. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygous inactivation of this gene results in defective splenic B-cell maturation, reduced marginal zone B-cell numbers, and impaired T-cell-dependent antibody formation. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_028075, NM_001357758; MGI:1919299 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Valine changed to Methionine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000086564] [ENSMUSP00000105161] [ENSMUSP00000154899] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9D8D0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000086564 Gene: ENSMUSG00000068105 AA Change: V36M
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000105161 Gene: ENSMUSG00000068105 AA Change: V36M
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.6648 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.194) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Dominant | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(10) : Chemically induced (other)(1) QTL(2) Radiation induced(2) Targeted(5) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Dominant | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:39 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2017-08-28 11:27 AM by Bruce Beutler | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-08-20 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The tannin phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5058, some of which showed a reduced B to T cell ratio (Figure 1) due to reduced frequencies of peripheral blood B cells (Figure 2), IgD+ B cells (Figure 3), and IgM+ B cells (Figure 4). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 74 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tnfrsf13c: a G to A transition at base pair 82,224,207 (v38) on chromosome 15, or base pair 174 in the GenBank genomic region NC_000081 encoding Tnfrsf13c. The strongest association was found with a dominant model of inheritance to the IgD+ B cell phenotype, wherein 30 heterozygous mice departed phenotypically from 18 homozygous reference mice with a P value of 0.000168 (Figure 5); no homozygous variant mice were born to pedigree R5058. The mutation corresponds to residue 174 in the mRNA sequence NM_028075 within exon 1 of 3 total exons.
The mutated nucleotide is indicated in red. The mutation results in a valine to methionine substitution at residue 36 (V36M) in the BAFF-R protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.979). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Tnfrsf13c encodes B cell activating factor receptor (BAFFR; alternatively, BR3, CD268, or TNFRSF17), a type III membrane protein. BAFFR has an extracellular ligand-binding domain, a single transmembrane domain, and an intracellular domain that binds the downstream signaling molecule, TRAF3 (see the record for hulk) (Figure 6) (1;2). For more information about the BAFFR ligand BAFF, please the record for Frozen. BAFFR undergoes proteolytic shedding, resulting in reduced cell surface expression and ligand-mediated cell survival (3). BAFFR is cleaved by ADAM10 or ADAM17. BAFF trimers promote BAFFR cleavage by ADAM10, while BAFF oligomers (60-mer formed of 20 trimers) promote ADAM17-mediated cleavage of BAFFR. BAFFR cleavage is dependent on BAFF binding to functional BAFFR and TACI (TACI is another BAFF receptor). Binding of BAFF to BAFFR and TACI brings ADAM10 in close proximity to BAFFR, subsequently promoting BAFFR cleavage. After BAFFR cleavage, the extracellular domain of BAFFR is released and the C-terminal fragment is processed in lysosomes (4). The function of the shed BAFFR ectodomain is unknown; the ectodomains of other BAF receptors acts as decoys for BAFF and another ligand APRIL (5-7). BAFFR shedding on germinal center B cells promotes B cell maturation, and shedding of the BAFF receptors BCMA, TACI, and BAFFR regulates B cell survival (3). Alternative splice donor sites in exon 1 and alternative acceptor sites in exon 3 generate several mouse BAFFR isoforms. Each isoform shares the same ligand binding and TRAF binding sites. The functional significance of these isoforms is unknown. The tannin mutation results in a valine to methionine substitution at residue 36 (V36M) in the BAFFR protein; Val36 is within the LBD. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | BAFFR is expressed on mature follicular and marginal zone B cells as well as on T2 and T3 transitional B cells, plasma cells, a subset of circulating T cells, and plasmablasts (2;8-10). BAFFR expression is observed in most B cell lymphoproliferative disorders, including follicular lymphoma, mantle cell lymphoma, a subset of diffuse large B-cell lymphomas, marginal zone lymphoma, hairy cell leukemia, and chronic lymphocytic leukemia/small lymphocytic lymphoma (9). BAFFR is not expressed in Pre–B acute lymphoblastic lymphoma, Burkitt lymphoma, and nodular lymphocyte-predominant Hodgkin lymphoma (9). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
BAFF/BAFFR signaling is essential for B cell homeostasis, differentiation, proliferation, survival, and function (Figure 7) (3-8). BAFF/BAFFR activates the alternative NF-κB (NF-κB2) signaling pathway (see the record for xander) to mediate splenic B cell survival and maturation (9;10). The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52 through IKK-1 and NIK, and results in the activation of p52/RelB heterodimers (11;12). TRAF2 and TRAF5 positively regulate NIK activity under certain conditions (13), but in other contexts, TRAF2 and TRAF3 form a complex with NIK to mediate NIK degradation (14-17). After stimulation with BAFFR, the complex is destabilized by TRAF2/3 degradation, permitting the release of NIK from the complex (15-17). After NIK is activated, it is able to bind to and phosphorylate several substrates including IKK-1 and p100, and serves as a docking molecule between IKK-1 and p100 (18-20). Phosphorylation of p100 by IKK-1 results in polyubiquitination and processing to p52 (19). BAFF/BAFFR-induced NF-κB2 signaling promotes B cell survival by upregulating integrins that retains autoreactive B cells in the splenic marginal zone (21). In addition, ERK activation is sustained and there is an increased turnover of Bim, a proapoptotic protein (9;10;22). BAFF also activates the classical NF-κB (NF-κB1) signaling pathway (see the record for Finlay) to regulate immunoglobulin class switching (to IgG and IgE) through an induction of activation induced deaminase (AID) and to generate antibodies (21). During T cell activation, there are two required signals transmitted by the antigen presenting cell (APC): signal 1 and signal 2. Signal 1 occurs upon recognition of the antigenic peptide MHC complex by the T cell receptor, and signal 2 occurs upon recognition of molecules expressed constitutively by professional APCs. BAFF binds to BAFFR expressed on naïve and primed/memory CD4 and CD8 T cells. In the presence of signal 1, BAFF/BAFFR promotes T cell activation, proliferation, and cytokine production (8;11;12). The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis. BAFF binding to the BAFFR activates phosphoinositide 3-kinase (PI3K), an upstream activator of mTOR, which subsequently activates Akt (23). BAFF-stimulated activation of mTOR leads to subsequent phosphorylation of mTOR targets p70 S6 kinase and the translational inhibitor 4E-BP1 as well as the activation of Akt targets forkhead transcription factors FOXO3a and FOXO1 [reviewed in (24)]. Mutations in TNFRSF13C are associated with common variable immunodeficiency-4 (OMIM: #613494) (13). Patients with common variable immunodeficiency-4 have recurrent infections, persistent B-cell lymphopenia, reduced numbers of class-switched memory B cells, low levels of serum IgG and IgM, and defective T cell-independent humoral responses (13). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The BAFFR-associated signaling is required for expression of the B cell co-receptor complex components CD21 and CD23 (14;15). Tnfrsf13c-deficient (Tnfrsf13c-/-) mice showed reduce surface expression of CD21 and CD23 on mature B cells (15). Tnfrsf13c-/- mice exhibited defects in B cell development and survival (16;17). Tnfrsf13c-/- mice showed reduced numbers of late transitional B cells, follicular B cells, and marginal zone B cells (15). The Tnfrsf13c-/- mice exhibited reduced antigen-specific antibody responses, but formed spontaneous germinal centers in mesenteric lymph nodes (15). The Tnfrsf13c-/- mice also showed reduced B cell proliferation after LPS, anti-CD40, anti-IgM, and IL4 stimulation as well as reduced anti-NP IgG levels, reduced CD4+ T cell proliferation, and reduced interferon-gamma secretion in a mixed lymphocyte response (18;19). A/WySnj mice have a transposon insertion that replaces the last eight amino acids of BAFFR (16;20). The mutant BAFFR is expressed on the surface of B cells and binds BAFF, but it shows aberrant signaling (10). The A/WySnj mice have CD21- and CD23-expressing follicular and CD21highCD23low marginal zone B cells as well as normal IgM serum levels (17;20;21). The A/WySnj mice show normal IgM antibody responses to T-dependent and T-independent antigens, but the IgG responses are diminished (17). The phenotype of the tannin mice indicates loss of BAFFR function and diminished BAFF/BAFFR-associated signaling. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer Tannin_pcr_F: CTCCTTCTGAAGTGTCTGGG Tannin_pcr_R: TCATTCTAGACTACAGGGCACAC Sequencing Primer Tannin_seq_F: AGTATCAGTCCCAGGAGTGC Tannin_seq_R: CAGCCCAGACTCGGAACTGTC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 649 nucleotides is amplified (chromosome 15, - strand): 1 tcattctaga ctacagggca cacagcccag actcggaact gtcccagctg catgaggcgg Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Xue Zhong, Jin Huk Choi, and Bruce Beutler |