Phenotypic Mutation 'concur' (pdf version)
Allele | concur |
Mutation Type |
splice site
|
Chromosome | 2 |
Coordinate | 121,100,800 bp (GRCm39) |
Base Change | A ⇒ T (forward strand) |
Gene |
Trp53bp1
|
Gene Name | transformation related protein 53 binding protein 1 |
Synonym(s) | 53BP1, p53BP1 |
Chromosomal Location |
121,023,762-121,101,888 bp (-) (GRCm39)
|
MGI Phenotype |
PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_013735, NM_001290830; MGI:1351320
|
Mapped | Yes |
Amino Acid Change |
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000106277 †]
[ENSMUSP00000106278 †]
[ENSMUSP00000114457 †]
† probably from a misspliced transcript
|
AlphaFold |
P70399 |
SMART Domains |
Protein: ENSMUSP00000106277 Gene: ENSMUSG00000043909
Domain | Start | End | E-Value | Type |
low complexity region
|
136 |
149 |
N/A |
INTRINSIC |
low complexity region
|
158 |
169 |
N/A |
INTRINSIC |
low complexity region
|
647 |
661 |
N/A |
INTRINSIC |
low complexity region
|
1031 |
1042 |
N/A |
INTRINSIC |
low complexity region
|
1099 |
1112 |
N/A |
INTRINSIC |
low complexity region
|
1260 |
1272 |
N/A |
INTRINSIC |
low complexity region
|
1290 |
1332 |
N/A |
INTRINSIC |
Pfam:53-BP1_Tudor
|
1430 |
1551 |
2.5e-80 |
PFAM |
low complexity region
|
1581 |
1601 |
N/A |
INTRINSIC |
BRCT
|
1673 |
1785 |
7.13e-1 |
SMART |
BRCT
|
1813 |
1901 |
1.03e-6 |
SMART |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000106278 Gene: ENSMUSG00000043909
Domain | Start | End | E-Value | Type |
low complexity region
|
136 |
149 |
N/A |
INTRINSIC |
low complexity region
|
158 |
169 |
N/A |
INTRINSIC |
low complexity region
|
647 |
661 |
N/A |
INTRINSIC |
low complexity region
|
1031 |
1042 |
N/A |
INTRINSIC |
low complexity region
|
1099 |
1112 |
N/A |
INTRINSIC |
low complexity region
|
1260 |
1272 |
N/A |
INTRINSIC |
low complexity region
|
1290 |
1332 |
N/A |
INTRINSIC |
low complexity region
|
1389 |
1409 |
N/A |
INTRINSIC |
Pfam:53-BP1_Tudor
|
1480 |
1601 |
1.5e-80 |
PFAM |
low complexity region
|
1631 |
1651 |
N/A |
INTRINSIC |
BRCT
|
1723 |
1835 |
7.13e-1 |
SMART |
BRCT
|
1863 |
1951 |
1.03e-6 |
SMART |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000106278 Gene: ENSMUSG00000043909
Domain | Start | End | E-Value | Type |
low complexity region
|
136 |
149 |
N/A |
INTRINSIC |
low complexity region
|
158 |
169 |
N/A |
INTRINSIC |
low complexity region
|
647 |
661 |
N/A |
INTRINSIC |
low complexity region
|
1031 |
1042 |
N/A |
INTRINSIC |
low complexity region
|
1099 |
1112 |
N/A |
INTRINSIC |
low complexity region
|
1260 |
1272 |
N/A |
INTRINSIC |
low complexity region
|
1290 |
1332 |
N/A |
INTRINSIC |
low complexity region
|
1389 |
1409 |
N/A |
INTRINSIC |
Pfam:53-BP1_Tudor
|
1480 |
1601 |
1.5e-80 |
PFAM |
low complexity region
|
1631 |
1651 |
N/A |
INTRINSIC |
BRCT
|
1723 |
1835 |
7.13e-1 |
SMART |
BRCT
|
1863 |
1951 |
1.03e-6 |
SMART |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000114457 Gene: ENSMUSG00000043909
Domain | Start | End | E-Value | Type |
low complexity region
|
136 |
149 |
N/A |
INTRINSIC |
low complexity region
|
158 |
169 |
N/A |
INTRINSIC |
low complexity region
|
647 |
661 |
N/A |
INTRINSIC |
low complexity region
|
991 |
1002 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
Meta Mutation Damage Score |
0.9755 |
Is this an essential gene? |
Non Essential (E-score: 0.000) |
Phenotypic Category |
Autosomal Recessive |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All alleles(33) : Chemically induced (ENU)(2) Chemically induced (other)(1) Gene trapped(26) Radiation induced(1) Targeted(3)
|
Lab Alleles |
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:39 PM
by Diantha La Vine
|
Record Created |
2017-08-28 11:42 AM
by Bruce Beutler
|
Record Posted |
2017-09-15 |
Phenotypic Description |
The concur phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5019, some of which showed a decrease in IgD expression on B cells (Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 32 mutations. The IgD phenotype was linked by continuous variable mapping to mutations in two genes on chromosome 2: Trp53bp1. The mutation in Trp53bp1 was presumed causative as the phenotype of the concur mice mimics that of other Trp53bp1 alleles (see lentil), and is a T to A transversion at base pair 121,270,319 (v38) on chromosome 2, or base pair 20,007 in the GenBank genomic region NC_000068 within intron 2 (10 base pairs from exon 3). Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from 17 homozygous reference mice and 16 heterozygous mice with a P value of 0.000775 (Figure 2). The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic site in intron 2. The resulting transcript would have a 60-base pair insertion of intron 2, which would cause an in-frame insertion of 19 aberrant amino acids beginning after amino acid 64.
C57BL/6J:
<--exon 2 <--intron 2 exon 3--> <--exon 28
19791 ……AACCCCGTGTTG ……atgtgctcatgttttctag GATATTGTATCA…… ……GTTTCTCACTAA…… 91906
61 ……-N--P--V--L- -D--I--V--S-…… ……-V--S--H--*- 1969
|
The acceptor splice site of intron 2 is indicated in blue lettering and the mutated nucleotide is indicated in red.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Trp53bp1 (transformation related protein 53 binding protein 1) encodes 53BP1. 53BP1 has two tandem Tudor domains at amino acids 1475-1575 (1) (alternatively, amino acids 1469-1574 (2) or amino acids 1480-1601, SMART) [Figure 3; (3;4)]. Amino acids 1220-1601 of 53BP1 comprise a kinetochore-binding domain (KBD) (1;5). A nuclear localization signal (NLS; amino acids 1645-1703) and the KBD are sufficient to target 53BP1 to IR-induced foci (IRIF) (2). Within the KBD, amino acids 1231–1270 are required for homo-oligomerization (6). 53BP1 has two tandem breast cancer 1 early-onset (BRCA1) C-terminus (BRCT) domains at amino acids 1708-1969 (alternatively, amino acids 1723-1951, SMART) (7). 53BP1 has a highly conserved glycine/arginine-rich region (GAR; RGRGRRGR; amino acids 1380-1386) (1;2). The concur mutation is predicted to cause an in-frame insertion of 19 aberrant amino acids beginning after amino acid 64. The affected region is within an undefined region of the 53BP1 protein. For more information about Trp53bp1, please see the record for lentil and (8).
|
Putative Mechanism | 53BP1 has several functions including facilitating DNA damage signaling, telomere fusions, NHEJ of DNA double strand break (DSBs) in CSR, transducing ATM-dependent cell cycle checkpoints (intra-S and G2/M), accumulation of p53, phosphorylation of several ATM substrates (e.g., Chk2 and BRCA1) in response to IR, and tumor suppression (9-16). Dysregulation of TRP53BP1 expression is associated with several human conditions. TRP53BP1 expression in BRCA1-associated breast cancers (17;18), lymphomas, and solid tumors is reduced (17;19-21). Low levels of TRP53BP1 are correlated with an aggressive form of the disease, correlating with increased metastases and decreased survival [reviewed in (22)]. 53BP1 deficiency and the deregulation of AID, leads to increased DSB formation, resulting in B cell lymphoma (23). Patients with RIDDLE syndrome (OMIM: #611943) lack the ability to recruit 53BP1 to the sites of DNA DSBs (24). MEFs from both Trp53bp1-/- and m53BP1tr/tr embryos exhibited reduced proliferation compared to controls (25). Both models are viable, but exhibit growth retardation and increased cellular sensitivity to IR (25;26). The m53BP1tr/tr mice were fertile, but produced smaller litters than wild-type animals (26). After IR, Trp53bp1-/- cells arrested in G2 and exhibited a delayed exit from the G2/M phase; the percentage of mitotic cells 24 hours after IR was lower than wild-type cells (25). The Trp53bp1 mouse models exhibit immune deficiencies including defects in T cell maturation (25;26). The levels of CD4 T cells, γ–δ T cells, and B cells were all reduced in the Trp53bp1-/- mice with a concomitant increase in the percentage of CD4-CD8- progenitors and apoptosis (25;27). In addition, the Trp53bp1-/- thymocytes exhibited an increased number of aberrant cells (either lost Cα (2 TCRVα, 1 TCRCα signal) or both Vα and Cα from one allele (1 TCRVα, 1 TCRCα)) (27). Bone marrow pro-B, pre-B, myeloid, and erthyroid progenitor populations were normal in the m53BP1tr/tr mice (16;26). However, the spleens from the m53BP1tr/tr mice were deficient in mature B cells (IgMloIgDhi) (26). IgM levels in the Trp53bp1-/- mice were similar to those in wild-type mice, indicating that B cell activation to mediate IgM secretion is not affected upon loss of 53BP1, however, the levels of all IgG subclasses and IgA were decreased (16). CD4 and CD8 T cell populations were similar between m53BP1tr/tr and wild-type mice, but the progression out of the DNIII stage in development, when β-gene rearrangement occurs, was impaired in the m53BP1tr/tr mice (26). Thymus size in the m53BP1tr/tr mice was smaller and had fewer cells than wild-type mice; the lymphoid organ architecture was normal (26). The phenotype exhibited by the concur mice indicate loss of 53BP1concur function.
|
Primers |
PCR Primer
concur_pcr_F: GGCTTCCTTACACATAATCTCAACTG
concur_pcr_R: AAGAGAACCCCGTGTTGGTG
Sequencing Primer
concur_seq_F: CAACTGCATGTTTAAATCGTTCTGC
concur_seq_R: AGTGATGATGCCCTGTTCAAG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 416 nucleotides is amplified (chromosome 2, - strand):
1 aagagaaccc cgtgttggtg agtgagtgat gatgccctgt tcaagttatt atttttttct 61 gaccccccta caccaaacta acccagaaaa ttaacgtgtt tagttgattg ttagcttttg 121 gataaagttg gtggggaacg aaaaatgaaa tcaacgtgtt ctcacccaca gaaaggtccc 181 tgttgtacta ctttgtgtac tgtgaggatc ttatgtgctc atgttttcta ggatattgta 241 tcaaatccgg aacaatctgc tgtagaacaa ggagacagta atagctcatt caatgaacat 301 ctgaaagaaa agaaagcttc aggtgagcag ttgaaggctt ggctctctgc agtgtttaag 361 gtcctgtggg ggcagaacga tttaaacatg cagttgagat tatgtgtaag gaagcc
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Charier, G., Couprie, J., Alpha-Bazin, B., Meyer, V., Quemeneur, E., Guerois, R., Callebaut, I., Gilquin, B., and Zinn-Justin, S. (2004) The Tudor Tandem of 53BP1: A New Structural Motif Involved in DNA and RG-Rich Peptide Binding. Structure. 12, 1551-1562.
2. Pryde, F., Khalili, S., Robertson, K., Selfridge, J., Ritchie, A. M., Melton, D. W., Jullien, D., and Adachi, Y. (2005) 53BP1 Exchanges Slowly at the Sites of DNA Damage and Appears to Require RNA for its Association with Chromatin. J Cell Sci. 118, 2043-2055.
3. Iwabuchi, K., Basu, B. P., Kysela, B., Kurihara, T., Shibata, M., Guan, D., Cao, Y., Hamada, T., Imamura, K., Jeggo, P. A., Date, T., and Doherty, A. J. (2003) Potential Role for 53BP1 in DNA End-Joining Repair through Direct Interaction with DNA. J Biol Chem. 278, 36487-36495.
4. Huyen, Y., Zgheib, O., Ditullio, R. A.,Jr, Gorgoulis, V. G., Zacharatos, P., Petty, T. J., Sheston, E. A., Mellert, H. S., Stavridi, E. S., and Halazonetis, T. D. (2004) Methylated Lysine 79 of Histone H3 Targets 53BP1 to DNA Double-Strand Breaks. Nature. 432, 406-411.
7. Bothmer, A., Robbiani, D. F., Di Virgilio, M., Bunting, S. F., Klein, I. A., Feldhahn, N., Barlow, J., Chen, H. T., Bosque, D., Callen, E., Nussenzweig, A., and Nussenzweig, M. C. (2011) Regulation of DNA End Joining, Resection, and Immunoglobulin Class Switch Recombination by 53BP1. Mol Cell. 42, 319-329.
8. Choi, J. H., Wang, K. W., Zhang, D., Zhan, X., Wang, T., Bu, C. H., Behrendt, C. L., Zeng, M., Wang, Y., Misawa, T., Li, X., Tang, M., Zhan, X., Scott, L., Hildebrand, S., Murray, A. R., Moresco, E. M., Hooper, L. V., and Beutler, B. (2017) IgD Class Switching is Initiated by Microbiota and Limited to Mucosa-Associated Lymphoid Tissue in Mice. Proc Natl Acad Sci U S A. 114, E1196-E1204.
9. Liu, X., Jiang, W., Dubois, R. L., Yamamoto, K., Wolner, Z., and Zha, S. (2012) Overlapping Functions between XLF Repair Protein and 53BP1 DNA Damage Response Factor in End Joining and Lymphocyte Development. Proc Natl Acad Sci U S A. 109, 3903-3908.
10. Lee, H., Kwak, H. J., Cho, I. T., Park, S. H., and Lee, C. H. (2009) S1219 Residue of 53BP1 is Phosphorylated by ATM Kinase upon DNA Damage and Required for Proper Execution of DNA Damage Response. Biochem Biophys Res Commun. 378, 32-36.
12. Ward, I. M., Reina-San-Martin, B., Olaru, A., Minn, K., Tamada, K., Lau, J. S., Cascalho, M., Chen, L., Nussenzweig, A., Livak, F., Nussenzweig, M. C., and Chen, J. (2004) 53BP1 is Required for Class Switch Recombination. J Cell Biol. 165, 459-464.
14. DiTullio, R. A.,Jr, Mochan, T. A., Venere, M., Bartkova, J., Sehested, M., Bartek, J., and Halazonetis, T. D. (2002) 53BP1 Functions in an ATM-Dependent Checkpoint Pathway that is Constitutively Activated in Human Cancer. Nat Cell Biol. 4, 998-1002.
15. Fernandez-Capetillo, O., Chen, H. T., Celeste, A., Ward, I., Romanienko, P. J., Morales, J. C., Naka, K., Xia, Z., Camerini-Otero, R. D., Motoyama, N., Carpenter, P. B., Bonner, W. M., Chen, J., and Nussenzweig, A. (2002) DNA Damage-Induced G2-M Checkpoint Activation by Histone H2AX and 53BP1. Nat Cell Biol. 4, 993-997.
16. Manis, J. P., Morales, J. C., Xia, Z., Kutok, J. L., Alt, F. W., and Carpenter, P. B. (2004) 53BP1 Links DNA Damage-Response Pathways to Immunoglobulin Heavy Chain Class-Switch Recombination. Nat Immunol. 5, 481-487.
17. Bouwman, P., Aly, A., Escandell, J. M., Pieterse, M., Bartkova, J., van der Gulden, H., Hiddingh, S., Thanasoula, M., Kulkarni, A., Yang, Q., Haffty, B. G., Tommiska, J., Blomqvist, C., Drapkin, R., Adams, D. J., Nevanlinna, H., Bartek, J., Tarsounas, M., Ganesan, S., and Jonkers, J. (2010) 53BP1 Loss Rescues BRCA1 Deficiency and is Associated with Triple-Negative and BRCA-Mutated Breast Cancers. Nat Struct Mol Biol. 17, 688-695.
18. Bunting, S. F., Callen, E., Wong, N., Chen, H. T., Polato, F., Gunn, A., Bothmer, A., Feldhahn, N., Fernandez-Capetillo, O., Cao, L., Xu, X., Deng, C. X., Finkel, T., Nussenzweig, M., Stark, J. M., and Nussenzweig, A. (2010) 53BP1 Inhibits Homologous Recombination in Brca1-Deficient Cells by Blocking Resection of DNA Breaks. Cell. 141, 243-254.
19. Li, X., Xu, B., Moran, M. S., Zhao, Y., Su, P., Haffty, B. G., Shao, C., and Yang, Q. (2012) 53BP1 Functions as a Tumor Suppressor in Breast Cancer Via the Inhibition of NF-kappaB through miR-146a. Carcinogenesis. 33, 2593-2600.
20. Neboori, H. J., Haffty, B. G., Wu, H., Yang, Q., Aly, A., Goyal, S., Schiff, D., Moran, M. S., Golhar, R., Chen, C., Moore, D., and Ganesan, S. (2012) Low p53 Binding Protein 1 (53BP1) Expression is Associated with Increased Local Recurrence in Breast Cancer Patients Treated with Breast-Conserving Surgery and Radiotherapy. Int J Radiat Oncol Biol Phys. 83, e677-83.
21. Takeyama, K., Monti, S., Manis, J. P., Dal Cin, P., Getz, G., Beroukhim, R., Dutt, S., Aster, J. C., Alt, F. W., Golub, T. R., and Shipp, M. A. (2008) Integrative Analysis Reveals 53BP1 Copy Loss and Decreased Expression in a Subset of Human Diffuse Large B-Cell Lymphomas. Oncogene. 27, 318-322.
23. Jankovic, M., Feldhahn, N., Oliveira, T. Y., Silva, I. T., Kieffer-Kwon, K. R., Yamane, A., Resch, W., Klein, I., Robbiani, D. F., Casellas, R., and Nussenzweig, M. C. (2013) 53BP1 Alters the Landscape of DNA Rearrangements and Suppresses AID-Induced B Cell Lymphoma. Mol Cell. 49, 623-631.
24. Stewart, G. S., Stankovic, T., Byrd, P. J., Wechsler, T., Miller, E. S., Huissoon, A., Drayson, M. T., West, S. C., Elledge, S. J., and Taylor, A. M. (2007) RIDDLE Immunodeficiency Syndrome is Linked to Defects in 53BP1-Mediated DNA Damage Signaling. Proc Natl Acad Sci U S A. 104, 16910-16915.
26. Morales, J. C., Xia, Z., Lu, T., Aldrich, M. B., Wang, B., Rosales, C., Kellems, R. E., Hittelman, W. N., Elledge, S. J., and Carpenter, P. B. (2003) Role for the BRCA1 C-Terminal Repeats (BRCT) Protein 53BP1 in Maintaining Genomic Stability. J Biol Chem. 278, 14971-14977.
27. Difilippantonio, S., Gapud, E., Wong, N., Huang, C. Y., Mahowald, G., Chen, H. T., Kruhlak, M. J., Callen, E., Livak, F., Nussenzweig, M. C., Sleckman, B. P., and Nussenzweig, A. (2008) 53BP1 Facilitates Long-Range DNA End-Joining during V(D)J Recombination. Nature. 456, 529-533.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine |
Authors | Jin Huk Choi, Xue Zhong, and Bruce Beutler |