Phenotypic Mutation 'grouper'

• Allele: grouper
• Mutation Type: nonsense
• Chromosome: 2
• Coordinate: 117,132,485 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Rasgrp1
• Gene Name: RAS guanyl releasing protein 1
• Chromosomal Location: 117,110,464-117,173,358 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Lysine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000099593] [ENSMUSP00000133449] [ENSMUSP00000134592] [ENSMUSP00000134027] [ENSMUSP00000134167] [ENSMUSP00000136423]
• AlphaFold: Q9Z1S3
• SMART Domains: Protein: ENSMUSP00000099593; Gene: ENSMUSG00000027347; AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
Pfam:EF-hand_6	474	502	5e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U|B	740	791	2e-23	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000133449; Gene: ENSMUSG00000027347; AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.2e-5	PFAM
C1	507	556	5.77e-16	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000134592; Gene: ENSMUSG00000027347; AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.1e-5	PFAM
Pfam:C1_1	507	539	3.4e-8	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000134027; Gene: ENSMUSG00000027347; AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	441	464	1.6e-5	PFAM
Pfam:EF-hand_6	442	467	1.6e-5	PFAM
C1	507	556	5.77e-16	SMART
PDB:4L9U|B	705	756	2e-23	PDB

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000134167; Gene: ENSMUSG00000027347; AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000136423; Gene: ENSMUSG00000027347; AA Change: K116*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U|B	740	791	2e-23	PDB

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Possibly nonessential (E-score: 0.264)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Diantha La Vine
• Record Created: 2017-08-28 11:58 AM by Bruce Beutler
• Record Posted: 2018-07-19
• Science Writers: Anne Murray
• Authors: Xue Zhong, Jin Huk Choi, Koichi Tabeta, Jeff SoRelle, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011246; MGI:1314635

Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (ENU)(2) Chemically induced (other)(1) Radiation induced(1) Spontaneous(1) Targeted(4)

Phenotypic Description

Figure 1. Grouper mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Grouper mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Grouper mice exhibit decreased frequencies of peripheral naive CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Grouper mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Grouper mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Grouper mice exhibit increased frequencies of peripheral effector memory CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Grouper mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Grouper mice exhibited increased IgA responses to challenge with ovalbumin administered with aluminum hydroxide (OVA/Alum ) . IgA levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Grouper mice exhibited increased total IgE levels in the serum . IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Homozygous grouper mice exhibit diminished T-dependent IgG responses to OVA/Alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Homozygous grouper mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Homozygous grouper mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The grouper phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5028, some of which showed increased B to T cell ratios (Figure 1), reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 2), naive CD4 T cells in CD4 T cells (Figure 3), and naive CD8 T cells in CD8 T cells (Figure 4) with concomitant increased frequencies of CD8+ T cells in CD3+ T cells (Figure 5), effector memory CD4 T cells in CD4 T cells (Figure 6), and natural killer cells (Figure 7), all in the peripheral blood. Some mice exhibited an increased IgA response to challenge with ovalbumin administered with aluminum hydroxide (OVA/Alum) (Figure 8) as well as increased total IgE levels in the serum (Figure 9). The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 10) and to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 11) were also diminished. The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was reduced (Figure 12). 

Nature of Mutation

Figure 13. Linkage mapping of the IgE phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R5028. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 2: Ttn and Rasgrp1. The Rasgrp1 was presumed causative as the immunological phenotypes observed in the grouper mice mimic those found in other Rasgrp1 alleles (see MGI; accessed September 20, 2017). The mutation in Rasgrp1 is an A to T transversion at base pair 117,302,004 (v38) on chromosome 2, or base pair 40,874 in the GenBank genomic region NC_000068 encoding Rasgrp1. The strongest association was found with a recessive model of inheritance to the normalized amount of IgE, wherein one variant homozygote departed phenotypically from 10 homozygous reference mice and 13 heterozygous mice with a P value of 7.314 x 10^-9 (Figure 13).  

The mutation corresponds to residue 514 in the mRNA sequence NM_011246 within exon 4 of 17 total exons.

499 AAGGATGCCCTGGAAAAGAATTCTCCAGGAGTT 111 -K--D--A--L--E--K--N--S--P--G--V-

The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine 116 for a premature stop codon (K116*).

Protein Prediction

Figure 14. Domain structure of RasGRP1. Domain information is from SMART and UniProt. The grouper mutation results in substitution of lysine 116 for a premature stop codon. This image is interactive. Click on each mutation for more information.

Figure 15. Structure of human RasGRP1. Domains are colored as in Figure 14. Figure generated by UCSF Chimera and is based on PDB:4L9M.

Ras guanine-releasing protein 1 (RasGRP1) is a member of the Ras guanine nucleotide exchange factor (RasGEF) family that also includes the son of sevenless (SOS) proteins and the Ras guanine nucleotide releasing factors (RasGRFs). There are four members of the RasGRP subfamily: RasGRP-1, -2, -3 (see the record for aster), and -4. All of the RasGRPs have a central catalytic core, two EF hands, and a C1 domain (Figure 14) (1-3). The catalytic domain of the RasGEF proteins can be subdivided into a Cdc25/GEF domain and a Ras exchanger motif (REM). The C-terminus of RasGRP1 contains an unstructured region and a predicted coiled coil (alternatively, plasma membrane targeter [PT] domain) (3;4). A portion of the unstructured region adjacent to the PT domain was designated as a suppressor of PT (SuPT) domain.

The Cdc25/GEF domain binds directly with Ras to dislodge the bound nucleotide (5), while the REM is required for RasGEF activity. The REM domain controls the orientation of the helical hairpin of the Cdc25/GEF domain (6).EF hands are typically calcium-binding motifs (3). The C1 domain and the first EF hand domain are required for translocation of RasGRP1 to the plasma membrane upon receptor activation (4;7). The C1 and catalytic domains are both required for BCR-mediated Ras activation (8). The C1 domain of RasGRP1 binds diacylglycerol (DAG) (3). The PT domain is sufficient and essential for plasma membrane targeting of RasGRP1, while the SuPT domain attenuates the targeting activity of the PT domain to prevent constitutive plasma membrane localization of RasGRP1. A second study found that the C-terminal tail region containing the PT and SuPT domains is required for cell membrane trafficking, thymic selection, and ERK activation after TCR stimulation (9).

The structure of a human RasGRP1 fragment containing the REM, Cdc25/GEF, EF hand, and C1 domains has been solved [Figure 15; PDB:4L9M; (6)]. The Cdc25/GEF domain is comprised of 10 helices that form a compact bundle. Two antiparallel helices stick out from the core and form a hairpin. In SOS, Ras docks on the Cdc25/GEF bundle, while the hairpin splays a segment of Ras away from the rest of the protein (5;10). Ras is predicted to bind RasGRP1 in a similar manner (6). Without Ras•GTP bound, the helical hairpin of the RasGRP1 Cdc25/GEF domain is an open conformation to bind Ras. The EF hand and C1 domains interact with the Cdc25/GEF domain. The EF hands interact with one side of the Cdc25/GEF domain, while the C1 domain extends from the opposite side of the EF hand domain.

The grouper mutation results in substitution of lysine 116 for a premature stop codon (K116*); amino acid 110 is within the REM.

Expression/Localization

RasGRP1 is expressed in human and mouse T cell lines and thymocytes (11) as well as in human NK cells (12), B1 cells, and B2 cells (13). RasGRP1 expression was also noted in the nervous system (3).

Background

Figure 16. TCR signaling pathway. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors.

The RAS subfamily of GTPases link membrane receptor signals to internal signaling pathways through proteins including RAF and RalGDS. The RAS proteins are switches that cycle between inactive GDP (Ras-GDP)- and active GTP (Ras-GTP)-bound states. RasGEFs (e.g., RasGRP1, RasGRP3, and SOS) function as RAS activators by maintaining the active GTP-bound state. In contrast, Ras GTPase-activating proteins (RasGAPs) promote GTP hydroloysis, subsequently returning Ras-GTP to an inactive state. The Ras-RAF-MEK-ERK pathway is the best-characterized Ras-GTP-associated signaling pathway. RAS-associated signaling regulates several functions including cell proliferation, differentiation, and apoptosis as well as the development and activity of lymphocytes. 

Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [Figure 16; reviewed in (14;15)]. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs). Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β for most T cells), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. Upon TCR crosslinking, the Src family kinases Lck (see iconoclast) and Fyn are recruited and activated, specifically phosphorylating ITAMs in CD3γ, δ, ε (see tumormouse) and ζ (see allia). These phosphorylated ITAMs then recruit ZAP-70 (ζ-chain-associated protein of 70 kDa; see murdock) and Syk (see poppy), which trans- and auto-phosphorylate, forming binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. ZAP-70 and Syk may also phosphorylate the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (16). LAT binds to the adaptor proteins growth factor receptor-bound 2 (Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1. SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk; see itxaro), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1). These events lead to activation of multiple serine/threonine kinases, including MAP kinases, IκB kinases, and PKC family members, which ultimately regulate transcription factor activity (for a more detailed description of TCR-associated signaling, please see the record for murdock.

RasGRP1 is essential for the activation of the ERK/MAPK signaling cascade in T cells, the regulation of T- and B-cell development, and B cell proliferation as well as T cell homeostasis, survival, differentiation, and proliferation (11;17-24). GRB2 and DAG recruit SOS and RasGRP1, respectively, to the membrane after T cell receptor stimulation (11). At the membrane, RasGRP1 and SOS associate with membrane-anchored Ras. RasGRP1 primers SOS for activation by initiating a burst of Ras•GTP (25). The Ras•GTP activates SOS by binding SOS and stabilizing it at the plasma membrane, and subsequently promoting the conversion of Ras•GDP to Ras•GTP. Several functions of RasGRP1 are described below.

RasGRP1-facilitated Ras activation functions in positive selection of αβT cells (26). Rasgrp1-deficient (Rasgrp1^-/-) mice had increased numbers of CD8+ γδT cells in the peripheral lymphoid organs; γδT cell numbers in the thymus were comparable to that in wild-type mice. RasGRP1-deficient γδT cells were defective in proliferation following TCR stimulation and showed impaired IL-17 production.

RasGRP1 is required for intrathymic development of CD4 T_reg cells, but not for their peripheral expansion and function (26). RasGRP1 is not required for CD8⁺CD44^highCD122⁺ T_reg cell development. Rasgrp1^-/- mice showed impaired CD4 T_reg development in the thymus, but increased CD4⁺Foxp3⁺ T_reg cells in the periphery (26). Also, the Rasgrp1^-/- mice showed increased numbers of CD8⁺CD44^highCD122⁺ T cells in the spleen.

RasGRP1 functions downstream of the chemokine receptor CXCR4, which is one of several receptors that drive β-selection (i.e., the checkpoint by which double-negative thymocytes enter before maturing into double-positive thymocytes) (27). RasGRP1 promotes ERK activation downstream of CXCR4. Thymi from Rasgrp1^-/- mice exhibited a partial developmental block at the early DN3 stage.

RasGRP1 functions in the Ras-MAPK signaling pathway in NK cells, which subsequently leads to NK effector functions (12). Activating NK cell receptors (e.g., natural cytotoxicity receptors (NCRs) and NKG2D) signal through ITAM-containing adaptors, such as CD3ζ, FcRγ, DAP12, or DAP10. Src kinases phosphorylate the ITAM motifs (or YINM motif in DAP10), causing activation of downstream signaling proteins, including Vav proteins, PI3K, and PLC-γ. DAG activates RasGRP1. Signals are subsequently transmitted to MAPKs, which promote cytolytic granule release and cytokine generation (28).

RasGRP1 also functions in IgE-mediated signal transduction and mast cell function (29). Rasgrp1^-/- mice did not mount anaphylactic allergic reactions. Mast cells from the Rasgrp1^-/- mice showed reduced degranulation and cytokine production as well as aberrant granule translocation, microtubule formation and Rho activation.

A mutation in RASGRP1 was linked to a case of immunodeficiency (30). The patient with RasGRP1-associated immunodeficiency showed recurrent infections and failure to thrive. The patient showed a progressive reduction in the number of CD4+ T cells, an increased relative proportion of TCRγδ cells, a progressive decline in the number of B cells, and developed a low-grade Epstein-Barr virus (EBV)-associated B cell lymphoma. ERK phosphorylation was reduced in both B and T cells from the patient. NK cells from the patient showed impaired cytotoxicity with defective granule convergence and actin accumulation. Low levels of RasGRP1 as well as expression of aberrant RASGRP1 transcripts in T cells in humans are putatively associated with the development of autoimmunity in a subset of systemic lupus erythematosus patients (31). Increased levels of RASGRP1 are often found in pediatric T cell leukemia where it stimulates growth (32;33). Mutations in RASGRP1 have been associated with autoimmune diabetes  (34;35).

Rasgrp1^-/- mice exhibited reduced numbers of peripheral B cells, CD4+ T cells, and CD8+ T cells, but increased numbers of CD4+ T cells with activated memory phenotype (17;24;36-38). The Rasgrp1^-/- mice showed reduced numbers of invariant NKT cells (39). The Rasgrp1^-/- mice exhibited enlarged spleens, increased levels of IgE and IgG1, and increased levels of autoantibody (24;36).

Homozygous mice for expressing a spontaneous Rasgrp1 mutation (Rasgrp1^lag/lag) exhibited increased numbers of activated B cells and CD4+ T cells (40). The Rasgrp1^lag/lag mice have enlarged spleens and livers as well as glomerulonephritis and increased serum levels of IgG (40). Homozygous mice expressing ENU-induced Rasgrp1 alleles exhibited aberrant T cell differentiation, increased numbers of effector memory CD4+ T cells, and subclinical autoimmune susceptibility [MGI and (37)].

Transgenic mice overexpressing RasGRP1 exhibited increased numbers of CD8+ thymocytes (41). Transgenic mice overexpressing RasGRP1 also exhibited thymic lymphomas independent of TCR-associated signaling (42). Overexpression of RasGRP1 promoted pre-TCR-independent survival and proliferation of immature thymocytes. RasGRP1 overexpression also resulted in the formation of spontaneous skin tumors (43;44).

Putative Mechanism

The phenotype(s) displayed by the grouper mice indicate that the mutation may affect the catalytic activity of RasGRP1^grouper.

Primers

PCR Primer
grouper_pcr_F: CATCAGTGTGAGGAAGCCTACAC
grouper_pcr_R: ACTGCCTAGTTATGCATACATCAG

Sequencing Primer
grouper_seq_F: CCTACACAAGGCTGGGAGG
grouper_seq_R: GACAAAAGGGATCTCTTTCTAACTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 2, - strand):

1   actgcctagt tatgcataca tcagttacta taaaaatttt aaaagacaaa agggatctct
61  ttctaactca ttcattcagt tggtctccta gtcacttggg catatacaag aggcaatttg
121 cccacatttt agggattaac ttgataaata cttccaaagt attttatggt ttctataata
181 cagcttccat tttccttaac catgacccta catataagga tgccctggaa aagaattctc
241 caggagtttg cctgaagatc tgctattttg tcaggtaatg tgtctgtgat ctggagactg
301 tgtggcgtga gatgggatga aaagctgctg cctacaatgt gtctcctgct ggtcctccct
361 acctctccct cccagccttg tgtaggcttc ctcacactga tg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Johnson, J. E., Goulding, R. E., Ding, Z., Partovi, A., Anthony, K. V., Beaulieu, N., Tazmini, G., Cornell, R. B., and Kay, R. J. (2007) Differential Membrane Binding and Diacylglycerol Recognition by C1 Domains of RasGRPs. Biochem J. 406, 223-236.

  2. Lorenzo, P. S., Kung, J. W., Bottorff, D. A., Garfield, S. H., Stone, J. C., and Blumberg, P. M. (2001) Phorbol Esters Modulate the Ras Exchange Factor RasGRP3. Cancer Res. 61, 943-949.

  3. Ebinu, J. O., Bottorff, D. A., Chan, E. Y., Stang, S. L., Dunn, R. J., and Stone, J. C. (1998) RasGRP, a Ras Guanyl Nucleotide- Releasing Protein with Calcium- and Diacylglycerol-Binding Motifs. Science. 280, 1082-1086.

  4. Beaulieu, N., Zahedi, B., Goulding, R. E., Tazmini, G., Anthony, K. V., Omeis, S. L., de Jong, D. R., and Kay, R. J. (2007) Regulation of RasGRP1 by B Cell Antigen Receptor Requires Cooperativity between Three Domains Controlling Translocation to the Plasma Membrane. Mol Biol Cell. 18, 3156-3168.

  5. Boriack-Sjodin, P. A., Margarit, S. M., Bar-Sagi, D., and Kuriyan, J. (1998) The Structural Basis of the Activation of Ras by Sos. Nature. 394, 337-343.

  6. Iwig, J. S., Vercoulen, Y., Das, R., Barros, T., Limnander, A., Che, Y., Pelton, J. G., Wemmer, D. E., Roose, J. P., and Kuriyan, J. (2013) Structural Analysis of Autoinhibition in the Ras-Specific Exchange Factor RasGRP1. Elife. 2, e00813.

  7. Tazmini, G., Beaulieu, N., Woo, A., Zahedi, B., Goulding, R. E., and Kay, R. J. (2009) Membrane Localization of RasGRP1 is Controlled by an EF-Hand, and by the GEF Domain. Biochim Biophys Acta. 1793, 447-461.

  8. Oh-hora, M., Johmura, S., Hashimoto, A., Hikida, M., and Kurosaki, T. (2003) Requirement for Ras Guanine Nucleotide Releasing Protein 3 in Coupling Phospholipase C-gamma2 to Ras in B Cell Receptor Signaling. J Exp Med. 198, 1841-1851.

  9. Fuller, D. M., Zhu, M., Song, X., Ou-Yang, C. W., Sullivan, S. A., Stone, J. C., and Zhang, W. (2012) Regulation of RasGRP1 Function in T Cell Development and Activation by its Unique Tail Domain. PLoS One. 7, e38796.

  10. Margarit, S. M., Sondermann, H., Hall, B. E., Nagar, B., Hoelz, A., Pirruccello, M., Bar-Sagi, D., and Kuriyan, J. (2003) Structural Evidence for Feedback Activation by Ras.GTP of the Ras-Specific Nucleotide Exchange Factor SOS. Cell. 112, 685-695.

  11. Ebinu, J. O., Stang, S. L., Teixeira, C., Bottorff, D. A., Hooton, J., Blumberg, P. M., Barry, M., Bleakley, R. C., Ostergaard, H. L., and Stone, J. C. (2000) RasGRP Links T-Cell Receptor Signaling to Ras. Blood. 95, 3199-3203.

  12. Lee, S. H., Yun, S., Lee, J., Kim, M. J., Piao, Z. H., Jeong, M., Chung, J. W., Kim, T. D., Yoon, S. R., Greenberg, P. D., and Choi, I. (2009) RasGRP1 is Required for Human NK Cell Function. J Immunol. 183, 7931-7938.

  13. Guo, B., and Rothstein, T. L. (2016) RasGRP1 is an Essential Signaling Molecule for Development of B1a Cells with Autoantigen Receptors. J Immunol. 196, 2583-2590.

  14. Zamoyska, R., Basson, A., Filby, A., Legname, G., Lovatt, M., and Seddon, B. (2003) The Influence of the Src-Family Kinases, Lck and Fyn, on T Cell Differentiation, Survival and Activation. Immunol Rev. 191, 107-118.

  15. Palacios, E. H., and Weiss, A. (2004) Function of the Src-Family Kinases, Lck and Fyn, in T-Cell Development and Activation. Oncogene. 23, 7990-8000.

  16. Pitcher, L. A., and van Oers, N. S. (2003) T-Cell Receptor Signal Transmission: Who Gives an ITAM? Trends Immunol. 24, 554-560.

  17. Dower, N. A., Stang, S. L., Bottorff, D. A., Ebinu, J. O., Dickie, P., Ostergaard, H. L., and Stone, J. C. (2000) RasGRP is Essential for Mouse Thymocyte Differentiation and TCR Signaling. Nat Immunol. 1, 317-321.

  18. Roose, J. P., Mollenauer, M., Gupta, V. A., Stone, J., and Weiss, A. (2005) A Diacylglycerol-Protein Kinase C-RasGRP1 Pathway Directs Ras Activation upon Antigen Receptor Stimulation of T Cells. Mol Cell Biol. 25, 4426-4441.

  19. Priatel, J. J., Chen, X., Dhanji, S., Abraham, N., and Teh, H. S. (2006) RasGRP1 Transmits Prodifferentiation TCR Signaling that is Crucial for CD4 T Cell Development. J Immunol. 177, 1470-1480.

  20. Priatel, J. J., Teh, S. J., Dower, N. A., Stone, J. C., and Teh, H. S. (2002) RasGRP1 Transduces Low-Grade TCR Signals which are Critical for T Cell Development, Homeostasis, and Differentiation. Immunity. 17, 617-627.

  21. Golec, D. P., Henao Caviedes, L. M., and Baldwin, T. A. (2016) RasGRP1 and RasGRP3 are Required for Efficient Generation of Early Thymic Progenitors. J Immunol. 197, 1743-1753.

  22. Golec, D. P., Hoeppli, R. E., Henao Caviedes, L. M., McCann, J., Levings, M. K., and Baldwin, T. A. (2017) Thymic Progenitors of TCRalphabeta(+) CD8alphaalpha Intestinal Intraepithelial Lymphocytes Require RasGRP1 for Development. J Exp Med. 214, 2421-2435.

  23. Priatel, J. J., Chen, X., Huang, Y. H., Chow, M. T., Zenewicz, L. A., Coughlin, J. J., Shen, H., Stone, J. C., Tan, R., and Teh, H. S. (2010) RasGRP1 Regulates Antigen-Induced Developmental Programming by Naive CD8 T Cells. J Immunol. 184, 666-676.

  24. Coughlin, J. J., Stang, S. L., Dower, N. A., and Stone, J. C. (2005) RasGRP1 and RasGRP3 Regulate B Cell Proliferation by Facilitating B Cell Receptor-Ras Signaling. J Immunol. 175, 7179-7184.

  25. Roose, J. P., Mollenauer, M., Ho, M., Kurosaki, T., and Weiss, A. (2007) Unusual Interplay of Two Types of Ras Activators, RasGRP and SOS, Establishes Sensitive and Robust Ras Activation in Lymphocytes. Mol Cell Biol. 27, 2732-2745.

  26. Chen, Y., Ci, X., Gorentla, B., Sullivan, S. A., Stone, J. C., Zhang, W., Pereira, P., Lu, J., and Zhong, X. P. (2012) Differential Requirement of RasGRP1 for Gammadelta T Cell Development and Activation. J Immunol. 189, 61-71.

  27. Golec, D. P., Dower, N. A., Stone, J. C., and Baldwin, T. A. (2013) RasGRP1, but Not RasGRP3, is Required for Efficient Thymic Beta-Selection and ERK Activation Downstream of CXCR4. PLoS One. 8, e53300.

  28. Vivier, E., Nunes, J. A., and Vely, F. (2004) Natural Killer Cell Signaling Pathways. Science. 306, 1517-1519.

  29. Liu, Y., Zhu, M., Nishida, K., Hirano, T., and Zhang, W. (2007) An Essential Role for RasGRP1 in Mast Cell Function and IgE-Mediated Allergic Response. J Exp Med. 204, 93-103.

  30. Salzer, E., Cagdas, D., Hons, M., Mace, E. M., Garncarz, W., Petronczki, O. Y., Platzer, R., Pfajfer, L., Bilic, I., Ban, S. A., Willmann, K. L., Mukherjee, M., Supper, V., Hsu, H. T., Banerjee, P. P., Sinha, P., McClanahan, F., Zlabinger, G. J., Pickl, W. F., Gribben, J. G., Stockinger, H., Bennett, K. L., Huppa, J. B., Dupre, L., Sanal, O., Jager, U., Sixt, M., Tezcan, I., Orange, J. S., and Boztug, K. (2016) RASGRP1 Deficiency Causes Immunodeficiency with Impaired Cytoskeletal Dynamics. Nat Immunol. 17, 1352-1360.

  31. Yasuda, S., Stevens, R. L., Terada, T., Takeda, M., Hashimoto, T., Fukae, J., Horita, T., Kataoka, H., Atsumi, T., and Koike, T. (2007) Defective Expression of Ras Guanyl Nucleotide-Releasing Protein 1 in a Subset of Patients with Systemic Lupus Erythematosus. J Immunol. 179, 4890-4900.

  32. Oki, T., Kitaura, J., Watanabe-Okochi, N., Nishimura, K., Maehara, A., Uchida, T., Komeno, Y., Nakahara, F., Harada, Y., Sonoki, T., Harada, H., and Kitamura, T. (2012) Aberrant Expression of RasGRP1 Cooperates with Gain-of-Function NOTCH1 Mutations in T-Cell Leukemogenesis. Leukemia. 26, 1038-1045.

  33. Hartzell, C., Ksionda, O., Lemmens, E., Coakley, K., Yang, M., Dail, M., Harvey, R. C., Govern, C., Bakker, J., Lenstra, T. L., Ammon, K., Boeter, A., Winter, S. S., Loh, M., Shannon, K., Chakraborty, A. K., Wabl, M., and Roose, J. P. (2013) Dysregulated RasGRP1 Responds to Cytokine Receptor Input in T Cell Leukemogenesis. Sci Signal. 6, ra21.

  34. Plagnol, V., Howson, J. M., Smyth, D. J., Walker, N., Hafler, J. P., Wallace, C., Stevens, H., Jackson, L., Simmonds, M. J., Type 1 Diabetes Genetics Consortium, Bingley, P. J., Gough, S. C., and Todd, J. A. (2011) Genome-Wide Association Analysis of Autoantibody Positivity in Type 1 Diabetes Cases. PLoS Genet. 7, e1002216.

  35. Qu, H. Q., Grant, S. F., Bradfield, J. P., Kim, C., Frackelton, E., Hakonarson, H., and Polychronakos, C. (2009) Association of RASGRP1 with Type 1 Diabetes is Revealed by Combined Follow-Up of Two Genome-Wide Studies. J Med Genet. 46, 553-554.

  36. Fuller, D. M., Zhu, M., Song, X., Ou-Yang, C. W., Sullivan, S. A., Stone, J. C., and Zhang, W. (2012) Regulation of RasGRP1 Function in T Cell Development and Activation by its Unique Tail Domain. PLoS One. 7, e38796.

  37. Daley, S. R., Coakley, K. M., Hu, D. Y., Randall, K. L., Jenne, C. N., Limnander, A., Myers, D. R., Polakos, N. K., Enders, A., Roots, C., Balakishnan, B., Miosge, L. A., Sjollema, G., Bertram, E. M., Field, M. A., Shao, Y., Andrews, T. D., Whittle, B., Barnes, S. W., Walker, J. R., Cyster, J. G., Goodnow, C. C., and Roose, J. P. (2013) Rasgrp1 Mutation Increases Naive T-Cell CD44 Expression and Drives mTOR-Dependent Accumulation of Helios(+) T Cells and Autoantibodies. Elife. 2, e01020.

  38. Priatel, J. J., Chen, X., Zenewicz, L. A., Shen, H., Harder, K. W., Horwitz, M. S., and Teh, H. S. (2007) Chronic Immunodeficiency in Mice Lacking RasGRP1 Results in CD4 T Cell Immune Activation and Exhaustion. J Immunol. 179, 2143-2152.

  39. Shen, S., Chen, Y., Gorentla, B. K., Lu, J., Stone, J. C., and Zhong, X. P. (2011) Critical Roles of RasGRP1 for Invariant NKT Cell Development. J Immunol. 187, 4467-4473.

  40. Layer, K., Lin, G., Nencioni, A., Hu, W., Schmucker, A., Antov, A. N., Li, X., Takamatsu, S., Chevassut, T., Dower, N. A., Stang, S. L., Beier, D., Buhlmann, J., Bronson, R. T., Elkon, K. B., Stone, J. C., Van Parijs, L., and Lim, B. (2003) Autoimmunity as the Consequence of a Spontaneous Mutation in Rasgrp1. Immunity. 19, 243-255.

  41. Norment, A. M., Bogatzki, L. Y., Klinger, M., Ojala, E. W., Bevan, M. J., and Kay, R. J. (2003) Transgenic Expression of RasGRP1 Induces the Maturation of Double-Negative Thymocytes and Enhances the Production of CD8 Single-Positive Thymocytes. J Immunol. 170, 1141-1149.

  42. Klinger, M. B., Guilbault, B., Goulding, R. E., and Kay, R. J. (2005) Deregulated Expression of RasGRP1 Initiates Thymic Lymphomagenesis Independently of T-Cell Receptors. Oncogene. 24, 2695-2704.

  43. Luke, C. T., Oki-Idouchi, C. E., Cline, J. M., and Lorenzo, P. S. (2007) RasGRP1 Overexpression in the Epidermis of Transgenic Mice Contributes to Tumor Progression during Multistage Skin Carcinogenesis. Cancer Res. 67, 10190-10197.

  44. Oki-Idouchi, C. E., and Lorenzo, P. S. (2007) Transgenic Overexpression of RasGRP1 in Mouse Epidermis Results in Spontaneous Tumors of the Skin. Cancer Res. 67, 276-280.