Phenotypic Mutation 'Flojo' (pdf version)
AlleleFlojo
Mutation Type missense
Chromosome18
Coordinate4,339,548 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Map3k8
Gene Name mitogen-activated protein kinase kinase kinase 8
Synonym(s) Tpl2, Tpl-2, c-COT, Cot, Cot/Tpl2
Chromosomal Location 4,331,327-4,353,015 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007746; MGI:1346878

Mapped Yes 
Amino Acid Change Serine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025078] [ENSMUSP00000133469]
SMART Domains Protein: ENSMUSP00000025078
Gene: ENSMUSG00000024235
AA Change: S274R

DomainStartEndE-ValueType
Pfam:Pkinase 137 388 1.1e-47 PFAM
Pfam:Pkinase_Tyr 139 386 4.6e-26 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000025078)
SMART Domains Protein: ENSMUSP00000133469
Gene: ENSMUSG00000024235

DomainStartEndE-ValueType
SCOP:d1phk__ 146 169 2e-4 SMART
Predicted Effect probably benign
Meta Mutation Damage Score 0.284 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
TLR signaling defect: hyposensitivity to LPS 11163183
TLR signaling defect: TNF production by macrophages
Candidate Explorer Status CE: excellent candidate; human score: 2; ML prob: 0.586
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles (15) : Chemically induced (ENU)(3); Targeted(11) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Map3k8 APN 18 4334660 missense probably damaging 1.00
IGL02483:Map3k8 APN 18 4349318 utr 5 prime probably benign
IGL03174:Map3k8 APN 18 4349247 missense probably damaging 1.00
gnostic_gospel UTSW 18 4333965 missense probably damaging 1.00
juicy UTSW 18 4339552 missense probably damaging 0.99
Sluggish UTSW 18 4339608 splice site probably benign
R0304:Map3k8 UTSW 18 4339552 missense probably damaging 0.99
R0569:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R1748:Map3k8 UTSW 18 4334766 missense probably damaging 1.00
R1793:Map3k8 UTSW 18 4332389 nonsense probably null
R2310:Map3k8 UTSW 18 4349001 missense probably benign
R3625:Map3k8 UTSW 18 4333965 missense probably damaging 1.00
R4786:Map3k8 UTSW 18 4340647 nonsense probably null
R4921:Map3k8 UTSW 18 4349124 missense possibly damaging 0.92
R4930:Map3k8 UTSW 18 4349215 nonsense probably null
R4934:Map3k8 UTSW 18 4339548 missense possibly damaging 0.95
R4956:Map3k8 UTSW 18 4339530 missense probably benign 0.00
R5241:Map3k8 UTSW 18 4340750 missense probably damaging 0.98
R5549:Map3k8 UTSW 18 4340762 missense probably damaging 0.98
R6317:Map3k8 UTSW 18 4348979 critical splice donor site probably null
R6326:Map3k8 UTSW 18 4340651 missense probably damaging 1.00
R6910:Map3k8 UTSW 18 4340801 missense probably benign 0.03
R7010:Map3k8 UTSW 18 4334060 missense probably damaging 1.00
R7247:Map3k8 UTSW 18 4334036 missense probably damaging 1.00
R7300:Map3k8 UTSW 18 4349076 missense probably damaging 0.98
R7348:Map3k8 UTSW 18 4340561 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-09-04 9:39 PM by Anne Murray
Record Created 2017-08-28 1:06 PM by Bruce Beutler
Record Posted 2017-09-15
Phenotypic Description

Figure 1. Flojo mice exhibited decreased TNFα secretion in response to TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Flojo phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4934, some of which showed reduced TNFα (see the record for PanR1) secretion in response to the Toll-like receptor ligand lipopolysaccharide (TLR4; Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of reduced TNFα secretion after LPS stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 132 mutations (X-axis) identified in the G1 male of pedigree R4934. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 132 mutations. The diminished TLR4 signaling phenotype was linked by continuous variable mapping to a mutation in Map3k8:  a T to A transversion at base pair 4,339,548 (v38) on chromosome 18, or base pair 13,865 in the NC_000084 GenBank genomic region. Linkage was found with an additive model of inheritance, wherein one variant homozygote and 11 heterozygous mice departed phenotypically from eight homozygous reference mice with a P value of 3.729 x 10-5 (Figure 2).  

 

The mutation corresponds to residue 946 in the mRNA sequence NM_008713 within exon 5 of 8 total exons.

 

929 GTAGATTTTGGCCTGAGTGTTAAGATGACTGAA

269 -V--D--F--G--L--S--V--K--M--T--E-

 

The mutated nucleotide is indicated in red. The mutation results in a serine to arginine substitution at position 274 (S274R) in the TPL2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.947) (1).

Protein Prediction
Figure 3. Domain structure of TPL2 protein. The TPL2 protein contains an N-terminal domain, a kinase domain, and a C-terminal region. A PEST sequence was identified between residues 415 and 438. There is a conserved ATP-binding lysine (K167), and phosphorylation of T290 is required for activation. The Flojo mutation (red asterisk) is a serine to arginine substitution at position 274 (S274R). The image is interactive; click to see other Map3k8 mutations.

Map3k8 encodes TPL2 (tumor progression locus 2)/COT (cancer Osaka thryoid)/MAP3K8, a serine/threonine kinase member of the mitogen-activated protein kinase kinase kinase (MAP3K) family of proteins. Full-length TPL2 contains three domains: the N-terminal domain (amino acids 1-132), the kinase domain (amino acids 133-388), and a C-terminal region (Figure 3). The N-terminal domain may have a role in regulating protein stability (2).  The kinase domain of TPL2 shows sequence homology to the kinase domains of other MAP3 kinases (2-4). The C-terminus of TPL2 appears both to inhibit TPL2 kinase activity (5-7), and to target the protein for degradation (7;8). The Flojo mutation results in a serine to arginine substitution at position 274 (S274R) within the kinase domain of the TPL2 protein.

 

Please see the record Sluggish for information about Map3k8.

Putative Mechanism

TPL2 activates the MEK/ERK pathway downstream of most TLRs. Upon TLR stimulation, both p105 and TPL2 are phosphorylated by the IKK complex, resulting in degradation of p105 and the release and activation of TPL2 (9). Phosphorylation of TPL2 by the IKK complex occurs at T290, and is necessary for both the dissociation of TPL2 from p105, as well as kinase activity (10-12). Activated TPL2 phosphorylates MEK1/2 (MAP kinase 1 and 2), which then activates ERK1/2 (13-15). The Flojo phenotype is similar to that of Sluggish (16)juicy and Mapk38-deficient mice in that TNFα production by Flojo macrophages is abnormal in response to TLR agonists. In Mapk38-deficient macrophages, the levels of TNF-α are normal, but the transport of TNF-α mRNA to the cytoplasm in response to LPS is defective, suggesting that TPL2 regulates TNF-α mRNA transport, but not stability (14).

Primers PCR Primer
Flojo_pcr_F: GGCACTGAATTGTCTGTAAGTGC
Flojo_pcr_R: CCACCTGAGTCATTATCAGAAGC

Sequencing Primer
Flojo_seq_F: ACTGAATTGTCTGTAAGTGCTTTGTG
Flojo_seq_R: CCTGAGTCATTATCAGAAGCGTTTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 455 nucleotides is amplified (chromosome 18, - strand):


1   ccacctgagt cattatcaga agcgtttcct tctgctctgc ttggaacttg ctgttctaga
61  tgattttcct gttgggttag gatgcattaa ctcacattaa aaacccctct cgttgcagct
121 agcaacattg tattcatgtc tacaaaagct gttttggtag attttggcct gagtgttaag
181 atgactgaag atgtctatct tcccaaggac ctccggggaa cagaggtaat tgattgattg
241 tattggtgat ggtctggaaa tgctgtgaca atcagcaatg aaggggacaa aatggcaaca
301 ttggatgatc gttgtcacca gaacaaattc attttacatt ttaccttttt tactatttct
361 atgataagac tttaaatatg catggttata tttatagata ttttttatta ctgtttatat
421 atacaacaca aagcacttac agacaattca gtgcc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsZhao Zhang and Bruce Beutler