Phenotypic Mutation 'asilomar'

• Allele: asilomar
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 151,014,331 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Tnfrsf9
• Gene Name: tumor necrosis factor receptor superfamily, member 9
• Synonym(s): Cd137, CDw137, 4-1BB, ILA, Ly63, A930040I11Rik
• Chromosomal Location: 151,004,612-151,030,561 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contributes to the clonal expansion, survival, and development of T cells. It can also induce proliferation in peripheral monocytes, enhance T cell apoptosis induced by TCR/CD3 triggered activation, and regulate CD28 co-stimulation to promote Th1 cell responses. The expression of this receptor is induced by lymphocyte activation. TRAF adaptor proteins have been shown to bind to this receptor and transduce the signals leading to activation of NF-kappaB. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutation of this gene results in enhanced T cell proliferation, decreased B cell IgG production, decreased cytotoxic T cell activity, and increased numbers of erythrocytes, granulocyte macrophages, and multipotential progenitor cells in the bone marrow, blood, and spleen. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Alanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000030808] [ENSMUSP00000059684] [ENSMUSP00000101296] [ENSMUSP00000101297] [ENSMUSP00000111961] [ENSMUSP00000122917] [ENSMUSP00000120761] [ENSMUSP00000117860]
• AlphaFold: P20334
• PDB Structure: STRUCTURE OF TNF RECEPTOR ASSOCIATED FACTOR 2 IN COMPLEX WITH A M4-1BB PEPTIDE [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000030808; Gene: ENSMUSG00000028965; AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TNFR	47	85	2.36e-6	SMART
TNFR	119	158	1.11e-2	SMART
transmembrane domain	189	211	N/A	INTRINSIC
low complexity region	246	253	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
  (Using ENSMUST00000030808)
• SMART Domains: Protein: ENSMUSP00000059684; Gene: ENSMUSG00000028965; AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TNFR	47	85	1.1e-8	SMART
TNFR	119	158	5.4e-5	SMART
low complexity region	201	208	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
  (Using ENSMUST00000060901)
• SMART Domains: Protein: ENSMUSP00000101296; Gene: ENSMUSG00000028965; AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TNFR	47	85	2.36e-6	SMART
TNFR	119	158	1.11e-2	SMART
transmembrane domain	189	211	N/A	INTRINSIC
low complexity region	246	253	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
  (Using ENSMUST00000105671)
• SMART Domains: Protein: ENSMUSP00000101297; Gene: ENSMUSG00000028965; AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TNFR	47	85	1.1e-8	SMART
TNFR	119	158	5.4e-5	SMART
low complexity region	201	208	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
  (Using ENSMUST00000105672)
• SMART Domains: Protein: ENSMUSP00000111961; Gene: ENSMUSG00000028965; AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TNFR	47	85	2.36e-6	SMART
TNFR	119	158	1.11e-2	SMART
transmembrane domain	189	211	N/A	INTRINSIC
low complexity region	246	253	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
  (Using ENSMUST00000116257)
• SMART Domains: Protein: ENSMUSP00000122917; Gene: ENSMUSG00000028965; AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TNFR	47	85	2.36e-6	SMART
TNFR	119	158	1.11e-2	SMART
transmembrane domain	189	211	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
  (Using ENSMUST00000126707)
• SMART Domains: Protein: ENSMUSP00000120761; Gene: ENSMUSG00000028965; AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TNFR	47	85	2.36e-6	SMART
TNFR	119	158	1.11e-2	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
  (Using ENSMUST00000135169)
• SMART Domains: Protein: ENSMUSP00000117860; Gene: ENSMUSG00000028965; AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TNFR	47	85	2.36e-6	SMART
TNFR	119	158	1.11e-2	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
  (Using ENSMUST00000139826)
• Meta Mutation Damage Score: 0.0898
• Is this an essential gene?: Probably nonessential (E-score: 0.095)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Anne Murray
• Record Created: 2017-08-29 9:50 AM by Bruce Beutler
• Record Posted: 2018-09-07
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011612, NM_001077508, NM_001077509; MGI:1101059

Alleles Listed at MGI

All Mutations and Alleles(23) : Endonuclease-mediated(2) Gene trapped(12) Targeted(9)

Phenotypic Description

Figure 1. Asilomar mice exhibit decreased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Asilomar mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Asilomar mice exhibit decreased frequencies of peripheral naïve CD4 T cells in CD4 T cells . Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Asilomar mice exhibit decreased frequencies of peripheral naïve CD8 T cells in CD8 T cells . Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Asilomar mice exhibit increased frequencies of peripheral B cells . Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Asilomar mice exhibit increased frequencies of peripheral IgD+ B cells . Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Asilomar mice exhibit increased frequencies of peripheral IgM+ B cells​​​​ . Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Asilomar mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells . Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Asilomar mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells . Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The asilomar phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5596, some of which showed in increase in the B to T cell ratio (Figure 1) due to reduced frequencies of CD8+ T cells (Figure 2), naïve CD4 T cells in CD4 T cells (Figure 3) and naïve CD8 T cells in CD8 T cells (Figure 4) with concomitant increased frequencies of B cells (Figure 5), IgD+ B cells (Figure 6), IgM+ B cells (Figure 7), effector memory CD4 T cells in CD4 T cells (Figure 8), and effector memory CD8 T cells in CD8 T cells (Figure 9).

Nature of Mutation

Figure 10. Linkage mapping of the increased B to T cell ratio phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R5596. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tnfrsf9:  a T to C transition at base pair 150,929,874 (v38) on chromosome 4, or base pair 9,720 in the GenBank genomic region NC_000070 encoding Tnfrsf9. The strongest association was found with a recessive model of inheritance to the normalized B:T ratio, wherein two variant homozygotes departed phenotypically from nine homozygous reference mice and 10 heterozygous mice with a P value of 1.53 x 10^-7 (Figure 10).  

The mutation corresponds to residue 160 in the mRNA sequence NM_011612 within exon 1 of 8 total exons.

144 TGTTACAACGTGGTGGTCATTGTGCTGCTGCTA 5   -C--Y--N--V--V--V--I--V--L--L--L-

The mutated nucleotide is indicated in red. The mutation results in a valine to alanine substitution at position 10 (V10A) in the CD137 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.015).

Protein Prediction

Figure 11. Domain organization of CD137. The asilomar mutation results in a valine to alanine substitution at position 10 in the CD137 protein. Secondary structure is noted. Abbreviations: SP, signal peptide; CRD, cysteine-rich domain; TM, transmembrane domain.

Figure 12. Crystal structure of the extracellular domain of human CD137. β-strands are represented by arrows and α-helices by coils. UCSF Chimera structure is based on PDB 6BWV. Click on the 3D structure to view it rotate. 

Tnfrsf9 encodes CD137 (alternatively, 4-1BB, TNFRSF9 [tumor necrosis factor receptor (TNFR) superfamily member 9], or ILA [induced by lymphocyte activation]). CD137 is a member of the TNFR family, which also includes Fas (alternatively, TNFR6; see the record for cherry), CD40 (see the record for bluebonnet), and lymphotoxin β receptor (LTβR; see the record for kama).

Similar to other members of the TNFR family, CD137 is a single-pass type-I transmembrane-spanning protein. CD137 has a signal peptide, four cysteine-rich domains (CRDs) in the extracellular domain, and a C-terminal cytoplasmic region [Figure 11 & 12; (1); PDB:5WJF (2); PDB:6BWV (3)]. Mouse CD137 has two TNF receptor-associated factor (TRAF)-binding sites within the cytoplasmic region that can recruit TRAF1 and TRAF2 (4). Human CD137 can also recruit TRAF3 (see the record for hulk) (5).

The extracellular region of CD137 has an elongated jellyroll β-sandwich fold consisting of two β-sheets (Figure 12) (3). The CRDs (namely CRD1, CRD2, and CRD3) mediate ligand binding (2;3;6). The cysteine residues within the CRDs participate in intradomain disulfide bridges (CRD1 and CRD4 have two each, CRD2 and CRD3 have 3 each) that promote the stability of the ectodomain (2;7). CD137 is N-linked glycosylated at Asn128 and Asn138 within CRD4 (2). CD137 glycosylation mediates binding to galectin-9, which putatively functions in regulating CD137 signaling (2).

Tnfrsf9 produces two isoforms through alternative splicing: the canonical transmembrane-spanning protein (CD137) and a soluble form (sCD137) (8). Human sCD137 is released by activated lymphocytes and putatively negatively regulates immune responses by either competitive binding to the CD137 ligand or by inserting into CD137 trimers/dimers on the cell surface (9;10). Increased levels of sCD137 have been noted in the sera of patients with chronic lymphocytic leukemia (11), rheumatoid arthritis (12), multiple sclerosis (13;14), systemic lupus erythematosus, and Behcet’s disease [reviewed in (15)].

Expression/Localization

CD137 is expressed by activated T cells (not resting T cells) (16), regulatory T cells (17), activated natural killer T cells (18), B cells (19), dendritic cells (20-22), monocytes (23), eosinophils (24), neutrophils (25;26), activated NK cells (27;28), mast cells (29), vascular endothelial cells (30), and chondrocytes (6) [reviewed in (31)].

Background

The ligand for CD137, CD137L (alternatively, 4-1BBL or TNFSF9), is a type II transmembrane protein and member of the TNF (see the record for Panr1) superfamily. CD137L is expressed on antigen-presenting cells (APCs; e.g., B cells dendritic cells, and macrophages). CD137/CD137L-associated signaling mediates the activation, proliferation, survival, apoptosis, and differentiation of several immune cell types as well as preventing activation-induced cell death, promoting cell cycle progression, enhancing cytotoxicity and the production of type 1 cytokines (Table 1). More information about CD137-associated signaling is detailed, below.

Table 1. CD137/CD137L-associated functions

Cell type	CD137-related function	References
T cells	Regulates activation and survival; (human) inhibits proliferation and induces apoptosis; (mouse) inhibits proliferation; induces interferon release and subsequent inhibition of Th2-mediated allergic lung inflammation	(10;32-36)
Monocytes/macrophages	Proliferation, activation, migration, survival, and cell growth	(23;30;34;37)
Dendritic cells	Maturation; increased production of inflammatory cytokines IL-6 and IL-12 as well as enhanced DC-mediated T cell activation	(21;22;38-40)
B cells	Proliferation; immunoglobulin secretion	(20;41)
Mast cells	Activation and cytokine production	(29)
Neutrophils	Stimulates expression/secretion of IL-6, TNFα, IL-1β, IL-1Rα, migration inhibitory factor, lymphotactin, macrophage inflammatory protein-1α, IFN-γ-inducible protein-10 and thymus-derived chemotactic agent; increased phagocytic ability	(26)
Natural killer cells	Cell survival; increased activity; promotes expansion of activated T cells	(18;28;42)
Eosinophils	IgE-mediated allergic responses; eosinophils from IgE-mediated asthma and atopic dermatitis patients expressed CD137, while cells from healthy patients or from patients with non-IgE-mediated asthma did not	(24)

Figure 13. CD137/CD137L signaling. Binding of CD137L to CD137 results in recruitment of tumor necrosis factor receptor‐associated factor 1 (TRAF1) and TRAF2 leading to activation of the non-canonical NF-κB (NF-κB2) signaling pathway as well as the extracellular signal regulated kinase (ERK), c‐Jun N‐terminal kinase (JNK), and p38 MAPK signaling cascades. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. CD137/CD137L participate in bidirectional signaling. In humans, CD137L-associated signaling activates Src tyrosine kinases, p38 MAPK, MEK1/2, ERK1/2, PI3K, and NF-κB, leading to antigen presenting cell activation and differenation. In the mouse, CD137L-associated signaling induces M-CSF and IL-1β secretion through Src tyrosine kinase/mTOR/p70S6K and Src tyrosine kinase/AKT pathways. See the text for more details. This image is interactive; click on mutants to view more information.

Binding of CD137L to CD137 activates the non-canonical NF-κB (NF-κB2; see the record for xander) signaling pathway (Figure 13) (4;5). The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52 through IKK-1 and NIK, and results in the activation of p52/RelB heterodimers. The receptors involved in non-canonical signaling (e.g., lymphotoxin-β receptor [LTβR; see the record for kama], B cell activating receptor [BAFFR; see the record for tannin], CD40 [see the record for bluebonnet], receptor activator of NF-κB [RANK] and TNF-related weak inducer of apoptosis [TWEAK]) are involved in secondary lymphoid organogenesis (SLO), B cell differentiation, survival and homeostasis, osteoclastogenesis, and angiogenesis (43), and bind to TNF receptor associated factors (TRAFs) to regulate NIK activity. Downstream of the receptors, TRAF2 and TRAF3 form a complex with NIK to mediate NIK degradation (44-47). After receptor stimulation, the complex is destabilized by TRAF2/3 degradation, permitting the release of NIK from the complex (45-47). After NIK is activated, it is able to bind to and phosphorylate several substrates including IKK-1 and p100, and serves as a docking molecule between IKK-1 and p100 (48-50). Phosphorylation of p100 by IKK-1 results in polyubiquitination and processing to p52 (49). NIK also activates mitogen‐associated protein kinases (MAPKs) through MAP/ERK kinase kinases and MAPK kinases. The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression. Typically, the rapid and transient activation of NF-κB complexes in response to a wide range of stimuli such as proinflammatory cytokines tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and CD40L (see the record for walla). CD137-associated NF-κB activation promotes an increase in the expression of anti-apoptotic proteins including Bcl-2 and Bcl-XL.

CD137L/CD137 activation also leads to activation of the extracellular signal regulated kinase (ERK), c‐Jun N‐terminal kinase (JNK), and p38 MAPK signaling cascades (4;32;33;51;52). CD137 activation results in recruitment of TRAF1 and TRAF2, which activates the ERK, JNK, and p38 MAPK pathways. TRAF2 promotes ASK1 (Apoptosis Signal-Regulating Kinase-1) recruitment and activation. ASK1 activates the JNK and MAPK pathways. Activation of the ERK, JNK, and p38 MAPK pathways promotes cell cycle progression and cell survival.

CD137L/CD137 participate in bidirectional signaling (Figure 13). Several signaling factors involved in CD137L reverse signaling have been identified, including p38, ERK1/2, PI3K, and PKA (53). Reverse signaling results in cytokine production as well as survival, proliferation, migration, and differentiation of APCs. In humans, CD137L-associated signaling activates Src tyrosine kinases, p38 MAPK, MEK1/2, ERK1/2, PI3K, and NF-κB, leading to antigen presenting cell activation and differenation. In the mouse, CD137L-associated signaling induces M-CSF and IL-1β secretion through Src tyrosine kinase/mTOR/p70S6K and Src tyrosine kinase/AKT pathways.

CD137 is an inducer of antitumor immune responses (54-56), and CD137 agonists used with cancer vaccines and immune checkpoint inhibitors boost anticancer immune responses (57;58). CD137 antibodies can increase anti-pathogen immune responses and transplant rejections as well as improve several mouse model autoimmune diseases, including systemic lupus erythematosus (59), collagen-induced arthritis (60), uveoretinitis (61), experimental autoimmune encephalomyelitis (62),  allergic airway inflammation and asthma (63;64), inflammatory bowel disease (65), and chronic graft vs. host disease (66).

Some Tnfrsf9-deficient (Tnfrsf9^-/-) mice exhibited preweaning lethality (MGI). Tnfrsf9^-/- mice exhibited insulitis in non-diabetic female mice at 30 weeks (67). Tnfrsf9^-/- mice showed reduced levels of IgG2a and IgG3 in response to KLH immunization, increased levels of IgA, IgG2a, and IgG2b in naïve mice, and increased absolute numbers of granulocyte-macrophage, erythroid, and multipotential progenitor cells in the bone marrow, blood, and spleen (68;69). The Tnfrsf9^-/- mice showed reduced IL-2 and IL-4 secretion from T cells, increased T cell proliferation after stimulation with anti-CD3 and ConA, and reduced cytotoxic T lymphocyte activity to vesicular stomatitis virus (68). Tnfrsf9^-/- mice also showed increased dendritic cell frequencies and reduced dendritic cell survival rates as well as reduced NK/NK T cell numbers and functions (18). Tnfrsf9^-/- mice showed increased effector CD4 T cell responses to OVA protein in adjuvant (70). Heterozygous mice (Tnfrsf9^+/-) mice show increased bone mineral content and bone mineral density (MGI).

Putative Mechanism

The phenotype of the asilomar mice indicates loss of CD137^asilomar function mediating T cell survival.

Primers

PCR Primer
asilomar_pcr_F: AGAATGACACTTGTGAGATATCCC
asilomar_pcr_R: GGCTGCTTTGTTGGATTCAA

Sequencing Primer
asilomar_seq_F: TGGGGTTACAGCATCCACTAC
asilomar_seq_R: AGTCGGTGCTCTTAACCAAAGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 910 nucleotides is amplified (chromosome 4, + strand):

1   agaatgacac ttgtgagata tccccctctt ttagagacag ggtttcatgt agctcaggtt
61  ggcctggaac tttctctgca gtcggggatg gccttgaact cttgctcctc ccgctcccat
121 ctcatgtgtg ctggggttac agcatccact accactccgg gtatctgcac actggttcct
181 gtttagcaag catgctatca gtcaagcaac agcagcagcc agaggacaac tcatctgact
241 gagacacttt cggaatctcc tttgctagtg tcctgtgcat gtgacatttc gccatgggaa
301 acaactgtta caacgtggtg gtcattgtgc tgctgctagt gggctgtgag aaggtgggag
361 ccgtgcagaa ctcctgtgat aactgtcagc ctggtaagtg ccaaagtgac atgactgttg
421 aagactcagt tcagttagcc tggtgtctta gttagggttc cgttgctgtg aagagacacc
481 acggccaagg cagctcttat aaagaacagc atttaattgg ggctggctta caggctcaga
541 ggtttggttc attatcatct ctgtgggaag catggaatct tcccaccagg taggcttggt
601 gctggagaag gagctgagag ttctacatct tgatccaaag actgccagga gaagactgtc
661 ttctgcagct actcattccc ttgcaaaagc ttgttgaggg ggctggagag atgactttgg
721 ttaagagcac cgactgctct tctgaaggtc ctgagttcaa atcccagcaa ccacatggtg
781 gctcacaaac atccgtaatg agatgccctc tacgggtgca tctgaagaca gctacagtgt
841 acttagatat aataataata ataaataaat ccttttaaaa aaaaagcttg ttgaatccaa
901 caaagcagcc 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Schwarz, H., Tuckwell, J., and Lotz, M. (1993) A Receptor Induced by Lymphocyte Activation (ILA): A New Member of the Human Nerve-Growth-factor/tumor-Necrosis-Factor Receptor Family. Gene. 134, 295-298.

  2. Bitra, A., Doukov, T., Wang, J., Picarda, G., Benedict, C. A., Croft, M., and Zajonc, D. M. (2018) Crystal Structure of Murine 4-1BB and its Interaction with 4-1BBL Support a Role for Galectin-9 in 4-1BB Signaling. J Biol Chem. 293, 1317-1329.

  3. Gilbreth, R. N., Oganesyan, V. Y., Amdouni, H., Novarra, S., Grinberg, L., Barnes, A., and Baca, M. (2018) Crystal Structure of the Human 4-1BB/4-1BBL Complex. J Biol Chem. 293, 9880-9891.

  4. Arch, R. H., and Thompson, C. B. (1998) 4-1BB and Ox40 are Members of a Tumor Necrosis Factor (TNF)-Nerve Growth Factor Receptor Subfamily that Bind TNF Receptor-Associated Factors and Activate Nuclear Factor kappaB. Mol Cell Biol. 18, 558-565.

  5. Jang, I. K., Lee, Z. H., Kim, Y. J., Kim, S. H., and Kwon, B. S. (1998) Human 4-1BB (CD137) Signals are Mediated by TRAF2 and Activate Nuclear Factor-Kappa B. Biochem Biophys Res Commun. 242, 613-620.

  6. Loo, D. T., Chalupny, N. J., Bajorath, J., Shuford, W. W., Mittler, R. S., and Aruffo, A. (1997) Analysis of 4-1BBL and Laminin Binding to Murine 4-1BB, a Member of the Tumor Necrosis Factor Receptor Superfamily, and Comparison with Human 4-1BB. J Biol Chem. 272, 6448-6456.

  7. Bitra, A., Doukov, T., Croft, M., and Zajonc, D. M. (2018) Crystal Structures of the Human 4-1BB Receptor Bound to its Ligand 4-1BBL Reveal Covalent Receptor Dimerization as a Potential Signaling Amplifier. J Biol Chem. .

  8. Setareh, M., Schwarz, H., and Lotz, M. (1995) A mRNA Variant Encoding a Soluble Form of 4-1BB, a Member of the Murine NGF/TNF Receptor Family. Gene. 164, 311-315.

  9. Hurtado, J. C., Kim, S. H., Pollok, K. E., Lee, Z. H., and Kwon, B. S. (1995) Potential Role of 4-1BB in T Cell Activation. Comparison with the Costimulatory Molecule CD28. J Immunol. 155, 3360-3367.

  10. Michel, J., and Schwarz, H. (2000) Expression of Soluble CD137 Correlates with Activation-Induced Cell Death of Lymphocytes. Cytokine. 12, 742-746.

  11. Furtner, M., Straub, R. H., Kruger, S., and Schwarz, H. (2005) Levels of Soluble CD137 are Enhanced in Sera of Leukemia and Lymphoma Patients and are Strongly Associated with Chronic Lymphocytic Leukemia. Leukemia. 19, 883-885.

  12. Jung, H. W., Choi, S. W., Choi, J. I., and Kwon, B. S. (2004) Serum Concentrations of Soluble 4-1BB and 4-1BB Ligand Correlated with the Disease Severity in Rheumatoid Arthritis. Exp Mol Med. 36, 13-22.

  13. Sharief, M. K. (2002) Heightened Intrathecal Release of Soluble CD137 in Patients with Multiple Sclerosis. Eur J Neurol. 9, 49-54.

  14. Liu, G. Z., Gomes, A. C., Putheti, P., Karrenbauer, V., Kostulas, K., Press, R., Hillert, J., Hjelmstrom, P., and Gao, X. G. (2006) Increased Soluble 4-1BB Ligand (4-1BBL) Levels in Peripheral Blood of Patients with Multiple Sclerosis. Scand J Immunol. 64, 412-419.

  15. Thum, E., Shao, Z., and Schwarz, H. (2009) CD137, Implications in Immunity and Potential for Therapy. Front Biosci (Landmark Ed). 14, 4173-4188.

  16. Garni-Wagner, B. A., Lee, Z. H., Kim, Y. J., Wilde, C., Kang, C. Y., and Kwon, B. S. (1996) 4-1BB is Expressed on CD45RAhiROhi Transitional T Cell in Humans. Cell Immunol. 169, 91-98.

  17. McHugh, R. S., Whitters, M. J., Piccirillo, C. A., Young, D. A., Shevach, E. M., Collins, M., and Byrne, M. C. (2002) CD4(+)CD25(+) Immunoregulatory T Cells: Gene Expression Analysis Reveals a Functional Role for the Glucocorticoid-Induced TNF Receptor. Immunity. 16, 311-323.

  18. Vinay, D. S., Choi, B. K., Bae, J. S., Kim, W. Y., Gebhardt, B. M., and Kwon, B. S. (2004) CD137-Deficient Mice have Reduced NK/NKT Cell Numbers and Function, are Resistant to Lipopolysaccharide-Induced Shock Syndromes, and have Lower IL-4 Responses. J Immunol. 173, 4218-4229.

  19. Zhang, X., Voskens, C. J., Sallin, M., Maniar, A., Montes, C. L., Zhang, Y., Lin, W., Li, G., Burch, E., Tan, M., Hertzano, R., Chapoval, A. I., Tamada, K., Gastman, B. R., Schulze, D. H., and Strome, S. E. (2010) CD137 Promotes Proliferation and Survival of Human B Cells. J Immunol. 184, 787-795.

  20. Pauly, S., Broll, K., Wittmann, M., Giegerich, G., and Schwarz, H. (2002) CD137 is Expressed by Follicular Dendritic Cells and Costimulates B Lymphocyte Activation in Germinal Centers. J Leukoc Biol. 72, 35-42.

  21. Futagawa, T., Akiba, H., Kodama, T., Takeda, K., Hosoda, Y., Yagita, H., and Okumura, K. (2002) Expression and Function of 4-1BB and 4-1BB Ligand on Murine Dendritic Cells. Int Immunol. 14, 275-286.

  22. Wilcox, R. A., Chapoval, A. I., Gorski, K. S., Otsuji, M., Shin, T., Flies, D. B., Tamada, K., Mittler, R. S., Tsuchiya, H., Pardoll, D. M., and Chen, L. (2002) Cutting Edge: Expression of Functional CD137 Receptor by Dendritic Cells. J Immunol. 168, 4262-4267.

  23. Langstein, J., Michel, J., Fritsche, J., Kreutz, M., Andreesen, R., and Schwarz, H. (1998) CD137 (ILA/4-1BB), a Member of the TNF Receptor Family, Induces Monocyte Activation Via Bidirectional Signaling. J Immunol. 160, 2488-2494.

  24. Heinisch, I. V., Bizer, C., Volgger, W., and Simon, H. U. (2001) Functional CD137 Receptors are Expressed by Eosinophils from Patients with IgE-Mediated Allergic Responses but Not by Eosinophils from Patients with Non-IgE-Mediated Eosinophilic Disorders. J Allergy Clin Immunol. 108, 21-28.

  25. Heinisch, I. V., Daigle, I., Knopfli, B., and Simon, H. U. (2000) CD137 Activation Abrogates Granulocyte-Macrophage Colony-Stimulating Factor-Mediated Anti-Apoptosis in Neutrophils. Eur J Immunol. 30, 3441-3446.

  26. Lee, S. C., Ju, S. A., Sung, B. H., Heo, S. K., Cho, H. R., Lee, E. A., Kim, J. D., Lee, I. H., Park, S. M., Nguyen, Q. T., Suh, J. H., and Kim, B. S. (2009) Stimulation of the Molecule 4-1BB Enhances Host Defense Against Listeria Monocytogenes Infection in Mice by Inducing Rapid Infiltration and Activation of Neutrophils and Monocytes. Infect Immun. 77, 2168-2176.

  27. Melero, I., Johnston, J. V., Shufford, W. W., Mittler, R. S., and Chen, L. (1998) NK1.1 Cells Express 4-1BB (CDw137) Costimulatory Molecule and are Required for Tumor Immunity Elicited by Anti-4-1BB Monoclonal Antibodies. Cell Immunol. 190, 167-172.

  28. Wilcox, R. A., Tamada, K., Strome, S. E., and Chen, L. (2002) Signaling through NK Cell-Associated CD137 Promotes both Helper Function for CD8+ Cytolytic T Cells and Responsiveness to IL-2 but Not Cytolytic Activity. J Immunol. 169, 4230-4236.

  29. Nishimoto, H., Lee, S. W., Hong, H., Potter, K. G., Maeda-Yamamoto, M., Kinoshita, T., Kawakami, Y., Mittler, R. S., Kwon, B. S., Ware, C. F., Croft, M., and Kawakami, T. (2005) Costimulation of Mast Cells by 4-1BB, a Member of the Tumor Necrosis Factor Receptor Superfamily, with the High-Affinity IgE Receptor. Blood. 106, 4241-4248.

  30. Drenkard, D., Becke, F. M., Langstein, J., Spruss, T., Kunz-Schughart, L. A., Tan, T. E., Lim, Y. C., and Schwarz, H. (2007) CD137 is Expressed on Blood Vessel Walls at Sites of Inflammation and Enhances Monocyte Migratory Activity. FASEB J. 21, 456-463.

  31. Shao, Z., and Schwarz, H. (2011) CD137 Ligand, a Member of the Tumor Necrosis Factor Family, Regulates Immune Responses Via Reverse Signal Transduction. J Leukoc Biol. 89, 21-29.

  32. Lee, H. W., Park, S. J., Choi, B. K., Kim, H. H., Nam, K. O., and Kwon, B. S. (2002) 4-1BB Promotes the Survival of CD8+ T Lymphocytes by Increasing Expression of Bcl-xL and Bfl-1. J Immunol. 169, 4882-4888.

  33. Sabbagh, L., Pulle, G., Liu, Y., Tsitsikov, E. N., and Watts, T. H. (2008) ERK-Dependent Bim Modulation Downstream of the 4-1BB-TRAF1 Signaling Axis is a Critical Mediator of CD8 T Cell Survival in Vivo. J Immunol. 180, 8093-8101.

  34. Ju, S. W., Ju, S. G., Wang, F. M., Gu, Z. J., Qiu, Y. H., Yu, G. H., Ma, H. B., and Zhang, X. G. (2003) A Functional Anti-Human 4-1BB Ligand Monoclonal Antibody that Enhances Proliferation of Monocytes by Reverse Signaling of 4-1BBL. Hybrid Hybridomics. 22, 333-338.

  35. Schwarz, H., Blanco, F. J., von Kempis, J., Valbracht, J., and Lotz, M. (1996) ILA, a Member of the Human Nerve Growth factor/tumor Necrosis Factor Receptor Family, Regulates T-Lymphocyte Proliferation and Survival. Blood. 87, 2839-2845.

  36. Polte, T., Jagemann, A., Foell, J., Mittler, R. S., and Hansen, G. (2007) CD137 Ligand Prevents the Development of T-Helper Type 2 Cell-Mediated Allergic Asthma by Interferon-Gamma-Producing CD8+ T Cells. Clin Exp Allergy. 37, 1374-1385.

  37. Langstein, J., Becke, F. M., Sollner, L., Krause, G., Brockhoff, G., Kreutz, M., Andreesen, R., and Schwarz, H. (2000) Comparative Analysis of CD137 and LPS Effects on Monocyte Activation, Survival, and Proliferation. Biochem Biophys Res Commun. 273, 117-122.

  38. Laderach, D., Wesa, A., and Galy, A. (2003) 4-1BB-Ligand is Regulated on Human Dendritic Cells and Induces the Production of IL-12. Cell Immunol. 226, 37-44.

  39. Lippert, U., Zachmann, K., Ferrari, D. M., Schwarz, H., Brunner, E., Mahbub-Ul Latif, A. H., Neumann, C., and Soruri, A. (2008) CD137 Ligand Reverse Signaling has Multiple Functions in Human Dendritic Cells during an Adaptive Immune Response. Eur J Immunol. 38, 1024-1032.

  40. Kim, Y. J., Li, G., and Broxmeyer, H. E. (2002) 4-1BB Ligand Stimulation Enhances Myeloid Dendritic Cell Maturation from Human Umbilical Cord Blood CD34+ Progenitor Cells. J Hematother Stem Cell Res. 11, 895-903.

  41. Pollok, K. E., Kim, Y. J., Hurtado, J., Zhou, Z., Kim, K. K., and Kwon, B. S. (1994) 4-1BB T-Cell Antigen Binds to Mature B Cells and Macrophages, and Costimulates Anti-Mu-Primed Splenic B Cells. Eur J Immunol. 24, 367-374.

  42. Sun, Y., Chen, J. H., and Fu, Y. (2004) Immunotherapy with Agonistic Anti-CD137: Two Sides of a Coin. Cell Mol Immunol. 1, 31-36.

  43. Dejardin, E. (2006) The Alternative NF-kappaB Pathway from Biochemistry to Biology: Pitfalls and Promises for Future Drug Development. Biochem Pharmacol. 72, 1161-1179.

  44. Liao, G., Zhang, M., Harhaj, E. W., and Sun, S. C. (2004) Regulation of the NF-kappaB-Inducing Kinase by Tumor Necrosis Factor Receptor-Associated Factor 3-Induced Degradation. J Biol Chem. 279, 26243-26250.

  45. Vallabhapurapu, S., Matsuzawa, A., Zhang, W., Tseng, P. H., Keats, J. J., Wang, H., Vignali, D. A., Bergsagel, P. L., and Karin, M. (2008) Nonredundant and Complementary Functions of TRAF2 and TRAF3 in a Ubiquitination Cascade that Activates NIK-Dependent Alternative NF-kappaB Signaling. Nat Immunol. 9, 1364-1370.

  46. Zarnegar, B. J., Wang, Y., Mahoney, D. J., Dempsey, P. W., Cheung, H. H., He, J., Shiba, T., Yang, X., Yeh, W. C., Mak, T. W., Korneluk, R. G., and Cheng, G. (2008) Noncanonical NF-kappaB Activation Requires Coordinated Assembly of a Regulatory Complex of the Adaptors cIAP1, cIAP2, TRAF2 and TRAF3 and the Kinase NIK. Nat Immunol. 9, 1371-1378.

  47. Gardam, S., Sierro, F., Basten, A., Mackay, F., and Brink, R. (2008) TRAF2 and TRAF3 Signal Adapters Act Cooperatively to Control the Maturation and Survival Signals Delivered to B Cells by the BAFF Receptor. Immunity. 28, 391-401.

  48. Xiao, G., Harhaj, E. W., and Sun, S. C. (2001) NF-kappaB-Inducing Kinase Regulates the Processing of NF-kappaB2 p100. Mol Cell. 7, 401-409.

  49. Xiao, G., Fong, A., and Sun, S. C. (2004) Induction of p100 Processing by NF-kappaB-Inducing Kinase Involves Docking IkappaB Kinase Alpha (IKKalpha) to p100 and IKKalpha-Mediated Phosphorylation. J Biol Chem. 279, 30099-30105.

  50. Qing, G., and Xiao, G. (2005) Essential Role of IkappaB Kinase Alpha in the Constitutive Processing of NF-kappaB2 p100. J Biol Chem. 280, 9765-9768.

  51. Cannons, J. L., Choi, Y., and Watts, T. H. (2000) Role of TNF Receptor-Associated Factor 2 and p38 Mitogen-Activated Protein Kinase Activation during 4-1BB-Dependent Immune Response. J Immunol. 165, 6193-6204.

  52. Cannons, J. L., Hoeflich, K. P., Woodgett, J. R., and Watts, T. H. (1999) Role of the Stress Kinase Pathway in Signaling Via the T Cell Costimulatory Receptor 4-1BB. J Immunol. 163, 2990-2998.

  53. Sollner, L., Shaqireen D O Kwajah, M. M., Wu, J. T., and Schwarz, H. (2007) Signal Transduction Mechanisms of CD137 Ligand in Human Monocytes. Cell Signal. 19, 1899-1908.

  54. Melero, I., Shuford, W. W., Newby, S. A., Aruffo, A., Ledbetter, J. A., Hellstrom, K. E., Mittler, R. S., and Chen, L. (1997) Monoclonal Antibodies Against the 4-1BB T-Cell Activation Molecule Eradicate Established Tumors. Nat Med. 3, 682-685.

  55. Wang, S., and Chen, L. (2011) Immunobiology of Cancer Therapies Targeting CD137 and B7-H1/PD-1 Cosignal Pathways. Curr Top Microbiol Immunol. 344, 245-267.

  56. Vinay, D. S., and Kwon, B. S. (2014) 4-1BB (CD137), an Inducible Costimulatory Receptor, as a Specific Target for Cancer Therapy. BMB Rep. 47, 122-129.

  57. McGray, A. J., Bernard, D., Hallett, R., Kelly, R., Jha, M., Gregory, C., Bassett, J. D., Hassell, J. A., Pare, G., Wan, Y., and Bramson, J. L. (2012) Combined Vaccination and Immunostimulatory Antibodies Provides Durable Cure of Murine Melanoma and Induces Transcriptional Changes Associated with Positive Outcome in Human Melanoma Patients. Oncoimmunology. 1, 419-431.

  58. Houot, R., and Kohrt, H. (2014) CD137 Stimulation Enhances the Vaccinal Effect of Anti-Tumor Antibodies. Oncoimmunology. 3, e941740.

  59. Foell, J., McCausland, M., Burch, J., Corriazzi, N., Yan, X. J., Suwyn, C., O'Neil, S. P., Hoffmann, M. K., and Mittler, R. S. (2003) CD137-Mediated T Cell Co-Stimulation Terminates Existing Autoimmune Disease in SLE-Prone NZB/NZW F1 Mice. Ann N Y Acad Sci. 987, 230-235.

  60. Seo, S. K., Choi, J. H., Kim, Y. H., Kang, W. J., Park, H. Y., Suh, J. H., Choi, B. K., Vinay, D. S., and Kwon, B. S. (2004) 4-1BB-Mediated Immunotherapy of Rheumatoid Arthritis. Nat Med. 10, 1088-1094.

  61. Choi, B. K., Asai, T., Vinay, D. S., Kim, Y. H., and Kwon, B. S. (2006) 4-1BB-Mediated Amelioration of Experimental Autoimmune Uveoretinitis is Caused by Indoleamine 2,3-Dioxygenase-Dependent Mechanisms. Cytokine. 34, 233-242.

  62. Sun, Y., Lin, X., Chen, H. M., Wu, Q., Subudhi, S. K., Chen, L., and Fu, Y. X. (2002) Administration of Agonistic Anti-4-1BB Monoclonal Antibody Leads to the Amelioration of Experimental Autoimmune Encephalomyelitis. J Immunol. 168, 1457-1465.

  63. Sun, Y., Blink, S. E., Liu, W., Lee, Y., Chen, B., Solway, J., Weinstock, J., Chen, L., and Fu, Y. X. (2006) Inhibition of Th2-Mediated Allergic Airway Inflammatory Disease by CD137 Costimulation. J Immunol. 177, 814-821.

  64. Polte, T., Foell, J., Werner, C., Hoymann, H. G., Braun, A., Burdach, S., Mittler, R. S., and Hansen, G. (2006) CD137-Mediated Immunotherapy for Allergic Asthma. J Clin Invest. 116, 1025-1036.

  65. Lee, J., Lee, E. N., Kim, E. Y., Park, H. J., Chang, C. Y., Jung, D. Y., Choi, S. Y., Lee, S. K., Lee, K. W., Kwon, G. Y., Joh, J. W., and Kim, S. J. (2005) Administration of Agonistic Anti-4-1BB Monoclonal Antibody Leads to the Amelioration of Inflammatory Bowel Disease. Immunol Lett. 101, 210-216.

  66. Kim, J., Choi, W. S., La, S., Suh, J. H., Kim, B. S., Cho, H. R., Kwon, B. S., and Kwon, B. (2005) Stimulation with 4-1BB (CD137) Inhibits Chronic Graft-Versus-Host Disease by Inducing Activation-Induced Cell Death of Donor CD4+ T Cells. Blood. 105, 2206-2213.

  67. Chen, Y. G., Forsberg, M. H., Khaja, S., Ciecko, A. E., Hessner, M. J., and Geurts, A. M. (2014) Gene Targeting in NOD Mouse Embryos using Zinc-Finger Nucleases. Diabetes. 63, 68-74.

  68. Kwon, B. S., Hurtado, J. C., Lee, Z. H., Kwack, K. B., Seo, S. K., Choi, B. K., Koller, B. H., Wolisi, G., Broxmeyer, H. E., and Vinay, D. S. (2002) Immune Responses in 4-1BB (CD137)-Deficient Mice. J Immunol. 168, 5483-5490.

  69. Vinay, D. S., Wolisi, G. O., Yu, K. Y., Choi, B. K., and Kwon, B. S. (2003) Immunity in the Absence of CD28 and CD137 (4-1BB) Molecules. Immunol Cell Biol. 81, 176-184.

  70. Lee, S. W., Vella, A. T., Kwon, B. S., and Croft, M. (2005) Enhanced CD4 T Cell Responsiveness in the Absence of 4-1BB. J Immunol. 174, 6803-6808.