Phenotypic Mutation 'dregs' (pdf version)
List |< first << previous [record 2 of 4] next >> last >|
Alleledregs
Mutation Type splice site
Chromosome7
Coordinate128,267,505 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Slc5a2
Gene Name solute carrier family 5 (sodium/glucose cotransporter), member 2
Synonym(s) Sglt2
Chromosomal Location 128,265,657-128,272,430 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urine glucose, increased eating and drinking behaviors, increased circulating renin activity, decreased urine osmolality, decreased serum aldosterone levels, polyuria, and decreased glucose renal reabsorption. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_133254; MGI:2384572

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000033044] [ENSMUSP00000145789] [ENSMUSP00000112597] [ENSMUSP00000114673] [ENSMUSP00000124318] [ENSMUSP00000115451] [ENSMUSP00000145699] [ENSMUSP00000145581] [ENSMUSP00000145739]
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000112597
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 53 490 7e-170 PFAM
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 566 577 N/A INTRINSIC
low complexity region 615 635 N/A INTRINSIC
transmembrane domain 650 669 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000124318
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 1 103 3.3e-41 PFAM
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000115451
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 53 276 5.7e-81 PFAM
Predicted Effect probably null
Predicted Effect probably benign
Predicted Effect probably benign
Predicted Effect probably benign
Predicted Effect probably benign
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - increased
Body Weight (Female) - increased
DSS: sensitive day 10
TLR signaling defect: hypersensitivity to CpG + IFNg
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(4) : Chemically induced (ENU)(1) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc5a2 APN 7 128270622 missense probably benign 0.07
IGL03084:Slc5a2 APN 7 128266604 missense probably benign 0.25
jimbee UTSW 7 large deletion
R0026:Slc5a2 UTSW 7 128270053 missense probably damaging 1.00
R0395:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0544:Slc5a2 UTSW 7 128269999 missense probably damaging 1.00
R0762:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0966:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R0968:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1382:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1383:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1385:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1467:Slc5a2 UTSW 7 128271256 unclassified probably benign
R4836:Slc5a2 UTSW 7 128267505 splice site probably null
R4983:Slc5a2 UTSW 7 128271810 makesense probably null
R5703:Slc5a2 UTSW 7 128270615 missense possibly damaging 0.77
R6185:Slc5a2 UTSW 7 128271177 missense probably damaging 0.98
R6696:Slc5a2 UTSW 7 128270043 missense probably damaging 1.00
R6969:Slc5a2 UTSW 7 128272077 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-04-11 2:33 PM by Anne Murray
Record Created 2017-08-31 8:18 AM by Bruce Beutler
Record Posted 2018-04-11
Phenotypic Description
Figure 1. Dregs mice exhibited increased body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dregs mice exhibited increased TNFα secretion in response to TLR9 ligand, CpG (primed with IFNγ). TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Dregs mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The dregs phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4836, some of which showed increased body weights compared to wild-type littermates (Figure 1). Some mice also exhibited increased TNFα secretion in response to TLR9 ligand, CpG (primed with IFNγ) (Figure 2) and susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days post-DSS treatment (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the increased TNFα secretion after CpG stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 79 mutations (X-axis) identified in the G1 male of pedigree R4836. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 79 mutations. Both of the above anomalies were linked to a mutation in Slc5a2:  an A to G transition at base pair 128,267,505 (v38) on chromosome 7, or base pair 1,809 in the GenBank genomic region NC_000073 within the donor splice site of intron 4. The strongest association was found with a recessive model of inheritance to the normalized TLR9 phenotype, wherein two variant homozygotes departed phenotypically from seven homozygous reference mice and 16 heterozygous mice with a P value of 1.03 x 10-10 (Figure 4).

 

The effect of the mutation at the cDNA and protein levels has not been examined, and the splicing prediction program has not been run for the transcript of interest. The mutation may result in skipping of the 165-base pair exon 4, which would result in an in-frame deletion of amino acids 100 to 154 in the SGLT2 protein, which is normally 670 amino acids long.

 

         <--exon 3      <--exon 4 intron 4-->        exon 5-->          <--exon 14

286 ……TTTGAGTGGAAT ……ACCAAGATCTCG gtgagcacgtgtggtg…… GTGGATATGTTC…… ……TTCTATGCATAA
96  ……-F--E--W--N- ……-T--K--I--S-                    -V--D--M--F-…… ……-F--Y--A--*- 
        correct        deleted                                  correct

 

The donor splice site of intron 4, which is destroyed by the dregs mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 5. SGLT2 topology. The 670 amino acid SGLT2 protein has 14 transmembrane spanning domains and the N- and C-termini are extracellular. Mouse SGLT2 is N-glycosylated at Asn 248 between transmembrane domains six and seven. The dregs mutation results in an A to G transition within the donor splice site of intron 4. Mutations found within SGLT2 are noted in red. Click on the mutation to view more information.

The Slc5a2 (alternatively, Sglt2) gene encodes the 670 amino acid SGLT2 protein, a member of the solute carrier family V transporter family (SLC5; alternatively, sodium (Na+) substrate symporter gene family (SSSF)) [(1;2); reviewed in (3)]. SGLT2 has 14 transmembrane-spanning domains and the N- and C-termini are extracellular, although most of the C-terminus comprises transmembrane domain 14 [(4;5); reviewed in (3;6-8)]. Several studies propose that transmembrane domains 10 through 13 in the SGLT proteins are essential to bind and translocate the sugar substrate [(4;9-11); reviewed in (3)].  SGLT2 mutations within transmembrane domains two, three, four, and eight can also cause glucosuria, indicating that these domains are functionally significant, although this has not been further studied (3;9;12). Within the fifth transmembrane domain is an SSSF consensus sequence [GS]-2(2)-[LIY]-x(3)-[LIVMFYWSTAG](7)-x(3)-[LIY]- [STAV]-x(2)-G-G-[LMF]-x-[SAP] (7;13).  The second motif, a SGLT/SMIT consensus sequence [R-xT-x-x-x-x-F-L-A-G-x-x-x-x-W-W-x-x-G-A-S-], is near the N-terminus (13).

 

Please see the record jimbee for more information about Slc5a2.

Putative Mechanism

In the mouse, Sglt2 is almost exclusively expressed in the kidney; Sglt2 mRNA was not detected in mouse extrarenal organs (14). SGLTs of the proximal tubule (i.e., SGLT2) facilitate the transport of glucose from the lumen into the renal epithelial cell. The SGLT1 and SGLT2 proteins are Na+/glucose co-transporters and act via secondary active transport (6;7;15). Glucose transport is coupled to Na+ transport, which is powered by a Na+ electrochemical gradient [(16;17); reviewed in (3;18;19)]. Knockout mouse models of Slc5a2 (18;20;21), and humans with mutations in SLC5A2 (3;9;7;12;22-25) have shown that SGLT2 is essential for the reabsorption of glucose in the kidney.  Due to the failure in renal glucose reabsorption, Sglt2 mutant mice exhibit osmotic diuresis and excessive thirst (18;20;21)

Primers PCR Primer
dregs(F):5'- ATTTGTTCCCACAGGCGCTC -3'
dregs(R):5'- ATCCATCCTGTGTGGCCATAC -3'

Sequencing Primer
dregs_seq(F):5'- ACAGGCGCTCTTCGTGGTG -3'
dregs_seq(R):5'- AGAAATCTGAGTGCCTCTGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsLei Sun, Zhao Zhang, Hexin Shi, Emre Turer, and Bruce Beutler
List |< first << previous [record 2 of 4] next >> last >|