Phenotypic Mutation 'mockingbird' (pdf version)
List |< first << previous [record 8 of 30] next >> last >|
Allelemockingbird
Mutation Type nonsense
Chromosome9
Coordinate53,516,467 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Atm
Gene Name ataxia telangiectasia mutated
Synonym(s) C030026E19Rik
Chromosomal Location 53,439,149-53,536,740 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007499; MGI:107202

Mapped Yes 
Amino Acid Change Glycine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000113388] [ENSMUSP00000156344]
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: G448*

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably null
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased 26310626
FACS CD4+ T cells in CD3+ T cells - decreased 26310626
FACS CD8+ T cells - decreased 26310626
FACS CD8+ T cells in CD3+ T cells - increased
FACS T cells - decreased 26310626
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(36) : Gene trapped(19) Targeted(17)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 unclassified probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense
Strato UTSW 9 53503018 missense
P0019:Atm UTSW 9 53465028 splice site probably benign
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 intron probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-08-27 2:15 PM by Anne Murray
Record Created 2017-09-15 3:37 PM by Anne Murray
Record Posted 2018-08-27
Phenotypic Description
Figure 1. Mockingbird mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Mockingbird mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Mockingbird mice exhibit reduced CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Mockingbird mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Mockingbird mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Mockingbird mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Mockingbird mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Homozygous mockingbird mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The mockingbird phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5441, some of which showed an increase in the B to T cell ratio (Figure 1), reduced frequencies of T cells (Figure 2), a decrease in the CD4+ to CD8+ T cell ratio (Figure 3) caused by a diminished frequencies of CD4+ T cells (Figure 4) and CD4+ T cells in CD3+ T cells (Figure 5) coupled with lesser diminution of CD8+ T cells (Figure 6) and a concomitant increase in the frequency of CD8+ T cells in CD3+ T cells (Figure 7), all in the peripheral blood.  The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was also diminished (Figure 8). 

Nature of Mutation

Figure 9. Linkage mapping of the reduced CD4+ T cell frequency phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 59 mutations (X-axis) identified in the G1 male of pedigree R5441. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 59 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Atm:  a G to T transversion at base pair 53,516,467 (v38) on chromosome 9, or base pair 20,350 in the GenBank genomic region NC_000075 encoding Atm.  The strongest association was found with a recessive model of inheritance to the normalized CD4+ T cell frequency phenotype, wherein four variant homozygotes departed phenotypically from 14 homozygous reference mice and 16 heterozygous mice with a P value of 3.066 x 10-8 (Figure 9).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 1,481 in the mRNA sequence NM_007499 within exon 10 of 64 total exons.


 
1466 CCTCAACAGCGACGTGGAGAACGCATCCCATAT
443  -P--Q--Q--R--R--G--E--R--I--P--Y-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of glycine 448 for a premature stop codon (G448*) in the ATM protein.

Protein Prediction
Figure 10. Domain organization of ATM. The location of the mockingbird mutation is indicated. Mutations found in ATM are noted in red. Click on each mutation to view more information.
Figure 11. Crystal structure of human ATM dimer. The dimer is shown in the closed position. Figure generated by UCSF Chimera and is based on PDB:5NP0.

ATM (ataxia telangiectasia mutated) is a member of the PI3/PI4-kinase (PIKK) family. The PIKK family is similar to the PI3K family, with the exception that PIKK family members do not phosphorylate lipids, but rather hundreds of proteins involved in the regulation of cell cycle progression, DNA repair, apoptosis, and cellular senescence [(1); reviewed in (2)]. PIKKs phosphorylate proteins on serine or threonine residues that are followed by glutamines (i.e., SQ or TQ motifs). The PIKK family members DNA-PKCS (DNA-dependent protein kinase; see clover), ATR (ATM and Rad3-related), and ATM are involved in DNA repair [(3); reviewed in (4)]. Additional members of the PIKK family are human suppressor of morphogenesis in genitalia-1 (SMG1), mammalian target of rapamycin (mTOR), and transformation/transcription domain-associated protein (TRRAP), which are involved in nonsense-mediated decay of mRNA, regulation of nutrient-dependent signaling, and regulation of chromatin during transcription, respectively (1).

 

A 250-amino acid region at the C-terminus of ATM constitutes the catalytic PIKK domain. The PIKK domain is flanked by the FAT domain (named for its homology to FRAP, ATM and TRRAP) and a FATC domain (FAT at the extreme C-terminus). The FAT and FATC domains occur in combination in all PIKK family members, suggesting a possible role in maintaining a structural conformation essential for the activation of the catalytic site (2;5). The FAT domain mediates ATM dimerization and has three tetratriocpeptide repeat domains (TRDs). The N-terminal portion of the protein up to the FAT domain consists of HEAT (Huntingtin, Elongation factor 3, A subunit of protein phosphatase 2A and TOR1) repeats (6). HEAT repeats are helical structural repeats that mediate protein-protein interactions (7).

 

The structure of ATM is a large “head” domain and a long “arm” structure that protrudes from the head region and facilitates interaction with double-stranded DNA (8;9). The HEAT repeat region of ATM is proposed to form the head structure, while the C-terminal kinase domain corresponds to the arm structure. ATM occurs in a dynamic equilibrium between closed and open dimers (9). In a closed state (PDB:5NP0), the PIKK regulatory domain blocks the substrate-binding site. The active site is held in this closed conformation by interaction with a long helical hairpin in the TRD3 (tetratricopeptide repeats domain 3) domain. The open dimer (PDB:5NP1) has two protomers with only a limited contact interface, and it lacks the intermolecular interactions that block the peptide-binding site in the closed dimer (9). In an inactive state, ATM is a non-covalently-linked head-to-head homodimer. The kinase domain has a bi-lobed structure with the active site deep inside a cleft. The FAT domain wraps around half of the kinase domain, restricting substrate access.

 

ATM undergoes several posttranslational modifications. DNA damage promotes ATM autophosphorylation at Ser1981 in humans (corresponding to Ser1987 in mouse) (10). Ser1981 phosphorylation is essential for ATM function, as mutation of Ser1981 to alanine (Ser1981Ala) resulted in loss of irradiation-induced p53 phosphorylation or cell cycle arrest (10). Autophosphorylation promotes dissociation of the inactive ATM multimer, forming an active monomer. Mouse Ser367 and Ser1899 also undergo autophosphorylation (10). Phosphorylation at Ser1987, Ser367, and Ser1899 were necessary for DNA damage–induced activation of ATM, but were not required for ATM function (11). Mice expressing a Ser1987/367/1899Ala mutant ATM exhibited normal ATM-dependent responses, including irradiation-induced chromatin retention, cell cycle checkpoint activation, and genomic stability as well as lymphocyte and meiotic recombination. Members of the phosphoprotein phosphatase family of serine/threonine protein phosphatases (e.g., PP2A, PP5, and Wip1) regulate the autophosphorylation of ATM (12;13). ATM putatively is acetylated at Lys3016 by KAT5 after DNA damage (14). A second study found that Tip60 also acetylates ATM at Lys3016 after DNA damage (15). ATM acetylation promotes autophosphorylation, and mutation of Lys3016 results inhibition of the conversion of inactive ATM dimers to active ATM monomers. After oxidation, ATM forms disulfide bonds at Cys2991 (and putatively at other sites). The disulfide bonds cause the activated ATM to remain in covalently-bound dimers (16). Mutation of Cys2991 to a leucine (Cys2991Leu) blocked ATM oxidation-induced activation.

 

The mockingbird mutation results in substitution of glycine 448 for a premature stop codon (G448*) in the ATM protein; amino acid 448 is within the HEAT repeat region.

Expression/Localization

Atm is ubiquitously expressed. ATM predominantly localizes to the nucleus, but is also localized in peroxisomes, cytoplasmic vesicles, and mitochondria (17-20).

Background

ATM is a cell cycle checkpoint kinase that phosphorylates proteins in several cell processes, including DNA repair, apoptosis, cell cycle checkpoints, telomere dysfunction, translation initiation, gene regulation, mitosis, and hypoxia (Table 1). In all, there are 900 putative ATM/ATR phosphorylation sites on over 700 proteins in the DNA damage response (DDR) pathway alone (21).

 

Table 1. Select direct ATM substrates. For more information see (22).

Cell process

ATM target (phosphorylation site)

DNA repair

BRCA1 (Ser988)

RAD17 (Ser645)

RAD9 (Ser272)

RAD50 (Ser635)

Apoptosis

p53 (Ser9 and Ser46)

MDM2 (Ser395)

E2F1 (Ser31)

c-Abl (Ser465)

G2/M checkpoint

BRCA1 (Ser1423 and Ser1524)

CHK2 (Thr68)

CHK1 (Ser317 and Ser345)

Intra-S checkpoint

BRCA1 (Ser1387)

NBS1 (Ser278 and Ser343)

SMC1 (Ser957 and Ser966)

FANCD2 (Ser222)

G1/S checkpoint

CHK2 (Thr68)

p53 (Ser15)

MDM2 (Ser395)

Mitosis

BUB1 (Ser314)

Telomere dysfunction

H2AX (Ser139)

53BP1 (see the record for lentil) (Ser25)

Translation initiation

eIF-4E (Ser111)

Gene regulation

c-Jun (Ser63)

Hypoxia

HIF‐1α (Ser696)

Figure 12. Schematic overview of HR and NHEJ DNA DSB repair.    Column A shows key steps in HR of DSBs: (1) PARP senses DSBs, competes with Ku binding to DNA to promote HR, and mediates the recruitment of the MRE11-RAD50-NBS1 (MRN) complex.  MRN-dependent activation of protein kinases results in the recruitment of processing factors that generate 3’ ssDNA overhangs (not shown). (2) The formation of 3’-ssDNA ends leads to the accumulation of the RPA complex, which stabilizes the ssDNA regions, protects the DNA against degradation, and prevents the formation of secondary structures.   (3) The RPA is displaced from the 3’-ssDNA ends; BRCA2-mediated assembly of RAD51 filaments leads to strand invasion into the homologous DNA sequence. (4) Mediators such as RAD51C and XRCC3 allow for the formation of RAD51 filaments, while strand invasion is stabilized by RAD54.  RAD51 and RAD54 catalyze the formation of a displacement loop (D-loop), in which the invading strand primes DNA synthesis. D-loop formation is a branch point to different HR subpathways including break-induced replication (not shown), double Holliday junction formation (not shown), and synthesis-dependent strand annealing (SDSA); all of the subpathways result in the repair of DSB breaks. (5) Fill-in synthesis at the site of the DSB. (6) The results of SDSA is shown. Column B demonstrates selected steps in nonhomologous end joining (NEHJ) repair (see the text for details): (1) Ku associates to DSBs to promote NHEJ and (2) the recruitment of DNA-PKcs to (3) form the catalytically active DNA-PK complex that protects the DNA ends needed for ligation. (4) Autophosphorylation of DNA-PKcs allows for ARTEMIS and DNA pol x family members to access the DNA termini.  ARTEMIS and DNA-PKcs form a complex that cleaves 5’ and 3’ overhangs during NHEJ. DNA pol x family members fill in the gaps with several nucleotides, if necessary, prior to relegation. Nucleases can remove base nucleotides, if necessary (not shown). (5) XRCC4/LIG4 is recruited to the site and the broken ends are religated with the help of XLF.  (6) Repair resolution of the DSB following NHEJ.  Abbreviations: HR, homologous recombination; NHEJ, nonhomologous end joining; DSB, double strand break; PARP; poly(ADP)ribose polymerase; MRN, MRE11-RAD50-NBS1; MRE11, meiotic recombination 11, NBS1, Nibrin or Nijmega breakage syndrome protein 1; ssDNA, single-stranded DNA; BRCA1, breast cancer 1, early onset; RPA, replication protein A; XRCC3, X-ray repair complementing defective repair in Chinese hamster cells 3; SDSA, synthesis-dependent strand annealing; XRCC4, X-ray repair cross-complementing 4; LIG4, DNA ligase IV; XLF, XRCC4-like factor. Figure modified from images found in Ciccia and Elledge. Mol Cell. (2010) 40:179-204Heyer et al. Annu. Rev. Genet. (2010) 44:113-139, and Neal and Meek. Mutat. Res. (2011) 711:73-86
Figure 13. Figure modified from Kurz and Lees-Miller. S.P. 2004

DNA double-strand breaks (DSBs) can occur as a result of exposure to external factors including ionizing radiation (IR) (e.g. medical x-rays and radon gas decay in the soil) (23), radiomimetic drugs (e.g. the antibiotic, bleomycin) (24), toxins (e.g. asbestos, silica, and titanium dioxide) (25), and topoisomerase inhibitors (e.g. camptothecin, which traps enzyme-DNA intermediates and inhibits the re-ligation of DNA) (26). Cellular processes such as the generation of reactive oxygen species as a byproduct of oxidative metabolism, the collapse of DNA replication forks (upon recognition of single-stranded breaks by the replication machinery) (27), and, in the case of B and T lymphocytes, immune receptor gene arrangement, also cause DSBs (28-30). Repair of DSBs is required to prevent chromosomal abnormalities and chromosome loss, and thereby maintain genomic stability. If left unrepaired, cell cycle arrest typically occurs, leading to cell death (28;31;32). In addition, instances of cancer can occur after a tumor suppressor gene is inactivated or deleted by a DSB, or when an oncogene is activated or translocated (33;34)

 

Several factors are involved in DDR signaling including DNA damage sensors, mediators, transducers, and effectors [reviewed in (35)]. The MRN [MRE11 (meiotic recombination 11)–Rad50–NBS1 (Nijmegen breakage syndrome 1)] complex and ATM, ATR (ATM and Rad3-related) and DNA-PKCS (see the record for clover) are involved in early DNA DSB-induced signaling [reviewed in (35)]. Mediator/adaptor proteins such as MDC1, BRCA1, PTIP, and 53BP1 (see the record for lentil) facilitate signaling between sensors and transducers. After irradiation, ATM is activated by autophosphorylation and subsequently recruited to the sites of DNA damage to phosphorylate its substrates (e.g., MDM2, p53, BRCA1, and H2AX). 53BP1 tethers activated ATM and other repair factors at the site of DSBs (36;37). ATM requires NBS1 as a co-factor for stable recruitment to DNA damage sites (38). 53BP1 is required efficient autophosphorylation of ATM at Ser1981 as well as ATM activation in some cell lines (39;40). 53BP1-mediated regulation of ATM-dependent phosphorylation of substrates in response to IR indicates that 53BP1 is a DNA damage checkpoint protein that facilitates ATM phosphorylation events (41). In irradiated U2OS cells, ATM coprecipitated with 53BP1, but not in non-irradiated cells, indicating that the interaction of 53BP1 and ATM is DNA damage-specific (41). DiTullio et al. propose that 53BP1 may function upstream of ATM to activate ATM in response to DSBs, and/or that 53BP1 functions as a scaffold to recruit ATM substrates to ATM at DSBs (41). ATM suppresses end resection in 53BP1-deficient cells in G1, but not in S/G2 phase of the cell cycle (42-44). An IR-induced DSB induces the phosphorylation of H2AX at Ser139 by PIKKs (ATM/ATR/DNA-PKcs) to form γ-H2AX. 

 

In addition to being activated by DNA damage, ATM can also be activated in the cytoplasm by reactive oxygen species in a DNA- and MRN-independent manner (16). Oxidative stress-induced ATM activation inhibits mTOR complex 1 (mTORC1) through a signaling cascade that involves the tuberous sclerosis-2 (TSC2) tumor suppressor. ATM activates liver kinase B1 protein (LKB1), which phosphorylates AMP‐activated protein kinase (AMPK) at residue Thr172. AMPK then phosphorylates TSC2 at several residues, Thr1271 and Ser1387, activating its Rheb GTPase activity. ATM/AMPK-mediated activation of TSC2 results in inhibition of the mTORC1 complex and autophagy. The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis. The activation of growth factor receptor tyrosine kinases leads to the activation of phosphatidylinositol 3-kinase (PI3K), an upstream activator of mTOR, which subsequently activates Akt, allowing the protein Rheb to remain in a GTP-bound state (45). Rheb-GTP subsequently binds and activates the mTOR kinase domain through an unknown mechanism (45). mTOR activity is then regulated through the Akt-mediated phosphorylation of tumor suppressors TSC1 and TSC2 (45-47). In the mTORC1 complex, mTOR interacts with raptor, PRAS40, Deptor, and mLST8 to target proteins in a rapamycin-sensitive manner (48). The phosphorylation of TSC2 by Akt inactivates the GTPase activating protein (GAP) activity of TSC2. When mTORC1 is activated upon raptor binding to mTOR, it phosphorylates several targets, including S6 kinase 1 (S6K1) and 4E-binding protein 1 (4E-BP1) (49). S6K1, in addition to S6K2, is a kinase that phosphorylates S6, a component of the small (40S) ribosomal subunit (48). See the record hamel for more information about mTOR-associated signaling and functions.

 

ATM also functions in the maintenance of the cellular redox balance by inducing glucose‐6‐phosphate dehydrogenase (G6PDH), the rate‐limiting enzyme of the pentose phosphate pathway (PPP) (50). The PPP produces NADPH for antioxidant pathways and nucleotide synthesis. ATM activation promotes p38-MK2 kinase to phosphorylate HSP27, which binds and activates G6PDH.

 

ATM is activated during hypoxia, whereby it promotes an increase in histone H3 lysine 9 trimethylation (H3K9me3) and subsequent chromatin remodeling (51). During hypoxia, ATM also inhibits mTORC1 by phosphorylating the hypoxia‐inducible factor (HIF‐1α) transcription factor at Ser696 (52). he transcription of REDD1 (regulated in development and DDR 1) leads to activation of the TSC complex and suppression of mTORC1 activity.

 

ATM-deficient cells exhibit defective G1, S, and G2 checkpoints as well as aberrant DNA damage responses to ionizing radiation. The ATM-associated defective G1—S checkpoint is primarily due to a loss in ATM-dependent p53 phosphorylation. P53 is required for the activation of p21WAF1/CIP1, which inhibits cyclin E and CDK2. The cyclin E/CDK2 complex is required for exit out of G1.

 

Mutations in human ATM are linked to ataxia-telangiectasia [OMIM: #208900; (53;54)] and susceptibility to breast cancer (OMIM: #114480) as well as somatic B-cell non-Hodgkin lymphoma, somatic mantle cell lymphoma, and somatic T-cell prolymphocytic leukemia. Ataxia-telangiectasia is characterized by progressive cerebellar ataxia due to premature degeneration of Purkinje and granule cells, telangiectasia (dilated blood vessels), growth retardation, gonadal atrophy, immune defects, and a predisposition to malignancy (lymphoma, leukemia, and breast cancer). Fibroblasts from ataxia-telangiectasia patients exhibit aberrant gross morphology and cytoskeletal organization, poor cell growth, defective cell-cycle checkpoints, telomere loss, and chromosome end-to-end associations.

 

Atm­-deficient (Atm-/-) mice exhibited reduced body weights, increased incidence of T-cell-derived lymphoma, premature death (median survival is 113 days), reduced numbers of CD4+ and CD8+ T cells, reduced numbers of CD3/CD4 and CD3/CD8 T cells, reduced numbers of active T cells, reduced numbers of pre-B cells, reduced levels of IgG, male and female infertility, hypoactivity, impaired coordination, impaired glucose tolerance, and insulin resistance (55-63). B cells from the Atm-/- mice exhibited reduced class switch recombination with increased genomic instability after tamoxifen treatment compared to cells from wild-type mice (64). Homozygous mice expressing a kinase dead mutant Atm allele exhibited embryonic lethality from embryonic day (E) 9.5 to E10.5 (64). Homozygous mice expressing a mutant Atm allele (a 9 base pair in-frame deletion in exon 54 resulting in deletion of Ser2556-Arg2557-Iso2558 in the protein) exhibited premature death by 40 weeks of age (50%), reduced body size, increased tumor incidence, increased numbers of double-negative and single-positive T cells, reduced thymocyte numbers, and male infertility (61).

Primers PCR Primer
mockingbird(F):5'- GGCCTCAAGTAAACCAAAGTTTTC -3'
mockingbird(R):5'- GGCCTAGTCAGTATCAGCAG -3'

Sequencing Primer
mockingbird_seq(F):5'- TCAGTTTGTGTTTGTCCAGAAC -3'
mockingbird_seq(R):5'- AGAGTGAAGATGATACTGTAGTTAGG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 8 of 30] next >> last >|