Phenotypic Mutation 'mockingbird'

• Allele: mockingbird
• Mutation Type: nonsense
• Chromosome: 9
• Coordinate: 53,427,767 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Atm
• Gene Name: ataxia telangiectasia mutated
• Synonym(s): C030026E19Rik
• Chromosomal Location: 53,350,449-53,448,040 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010] ; PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glycine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000113388] [ENSMUSP00000156344]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000113388; Gene: ENSMUSG00000034218; AA Change: G448*

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably essential (E-score: 0.923)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:38 PM by Diantha La Vine
• Record Created: 2017-09-15 3:37 PM by Anne Murray
• Record Posted: 2018-08-27
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007499; MGI:107202

Alleles Listed at MGI

All Mutations and Alleles(36) : Gene trapped(19) Targeted(17)

Phenotypic Description

Figure 1. Mockingbird mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Mockingbird mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Mockingbird mice exhibit reduced CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Mockingbird mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Mockingbird mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Mockingbird mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Mockingbird mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Homozygous mockingbird mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide . IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The mockingbird phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5441, some of which showed an increase in the B to T cell ratio (Figure 1), reduced frequencies of T cells (Figure 2), a decrease in the CD4⁺ to CD8⁺ T cell ratio (Figure 3) caused by a diminished frequencies of CD4⁺ T cells (Figure 4) and CD4⁺ T cells in CD3⁺ T cells (Figure 5) coupled with lesser diminution of CD8⁺ T cells (Figure 6) and a concomitant increase in the frequency of CD8⁺ T cells in CD3⁺ T cells (Figure 7), all in the peripheral blood.  The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was also diminished (Figure 8). 

Nature of Mutation

Figure 9. Linkage mapping of the reduced CD4+ T cell frequency phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 59 mutations (X-axis) identified in the G1 male of pedigree R5441. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 59 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Atm:  a G to T transversion at base pair 53,516,467 (v38) on chromosome 9, or base pair 20,350 in the GenBank genomic region NC_000075 encoding Atm.  The strongest association was found with a recessive model of inheritance to the normalized CD4+ T cell frequency phenotype, wherein four variant homozygotes departed phenotypically from 14 homozygous reference mice and 16 heterozygous mice with a P value of 3.066 x 10^-8 (Figure 9).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

The mutation corresponds to residue 1,481 in the mRNA sequence NM_007499 within exon 10 of 64 total exons.

1466 CCTCAACAGCGACGTGGAGAACGCATCCCATAT 443  -P--Q--Q--R--R--G--E--R--I--P--Y-

The mutated nucleotide is indicated in red.  The mutation results in substitution of glycine 448 for a premature stop codon (G448*) in the ATM protein.

Protein Prediction

Figure 10. Domain organization of ATM. The location of the mockingbird mutation is indicated. Mutations found in ATM are noted in red. Click on each mutation to view more information.

Figure 11. Crystal structure of human ATM dimer. The dimer is shown in the closed position. Figure generated by UCSF Chimera and is based on PDB:5NP0.

ATM (ataxia telangiectasia mutated) is a member of the PI3/PI4-kinase (PIKK) family. The PIKK family is similar to the PI3K family, with the exception that PIKK family members do not phosphorylate lipids, but rather hundreds of proteins involved in the regulation of cell cycle progression, DNA repair, apoptosis, and cellular senescence [(1); reviewed in (2)]. PIKKs phosphorylate proteins on serine or threonine residues that are followed by glutamines (i.e., SQ or TQ motifs). The PIKK family members DNA-PK_CS (DNA-dependent protein kinase; see clover), ATR (ATM and Rad3-related), and ATM are involved in DNA repair [(3); reviewed in (4)]. Additional members of the PIKK family are human suppressor of morphogenesis in genitalia-1 (SMG1), mammalian target of rapamycin (mTOR), and transformation/transcription domain-associated protein (TRRAP), which are involved in nonsense-mediated decay of mRNA, regulation of nutrient-dependent signaling, and regulation of chromatin during transcription, respectively (1).

A 250-amino acid region at the C-terminus of ATM constitutes the catalytic PIKK domain. The PIKK domain is flanked by the FAT domain (named for its homology to FRAP, ATM and TRRAP) and a FATC domain (FAT at the extreme C-terminus). The FAT and FATC domains occur in combination in all PIKK family members, suggesting a possible role in maintaining a structural conformation essential for the activation of the catalytic site (2;5). The FAT domain mediates ATM dimerization and has three tetratriocpeptide repeat domains (TRDs). The N-terminal portion of the protein up to the FAT domain consists of HEAT (Huntingtin, Elongation factor 3, A subunit of protein phosphatase 2A and TOR1) repeats (6). HEAT repeats are helical structural repeats that mediate protein-protein interactions (7).

The structure of ATM is a large “head” domain and a long “arm” structure that protrudes from the head region and facilitates interaction with double-stranded DNA (8;9). The HEAT repeat region of ATM is proposed to form the head structure, while the C-terminal kinase domain corresponds to the arm structure. ATM occurs in a dynamic equilibrium between closed and open dimers (9). In a closed state (PDB:5NP0), the PIKK regulatory domain blocks the substrate-binding site. The active site is held in this closed conformation by interaction with a long helical hairpin in the TRD3 (tetratricopeptide repeats domain 3) domain. The open dimer (PDB:5NP1) has two protomers with only a limited contact interface, and it lacks the intermolecular interactions that block the peptide-binding site in the closed dimer (9). In an inactive state, ATM is a non-covalently-linked head-to-head homodimer. The kinase domain has a bi-lobed structure with the active site deep inside a cleft. The FAT domain wraps around half of the kinase domain, restricting substrate access.

ATM undergoes several posttranslational modifications. DNA damage promotes ATM autophosphorylation at Ser1981 in humans (corresponding to Ser1987 in mouse) (10). Ser1981 phosphorylation is essential for ATM function, as mutation of Ser1981 to alanine (Ser1981Ala) resulted in loss of irradiation-induced p53 phosphorylation or cell cycle arrest (10). Autophosphorylation promotes dissociation of the inactive ATM multimer, forming an active monomer. Mouse Ser367 and Ser1899 also undergo autophosphorylation (10). Phosphorylation at Ser1987, Ser367, and Ser1899 were necessary for DNA damage–induced activation of ATM, but were not required for ATM function (11). Mice expressing a Ser1987/367/1899Ala mutant ATM exhibited normal ATM-dependent responses, including irradiation-induced chromatin retention, cell cycle checkpoint activation, and genomic stability as well as lymphocyte and meiotic recombination. Members of the phosphoprotein phosphatase family of serine/threonine protein phosphatases (e.g., PP2A, PP5, and Wip1) regulate the autophosphorylation of ATM (12;13). ATM putatively is acetylated at Lys3016 by KAT5 after DNA damage (14). A second study found that Tip60 also acetylates ATM at Lys3016 after DNA damage (15). ATM acetylation promotes autophosphorylation, and mutation of Lys3016 results inhibition of the conversion of inactive ATM dimers to active ATM monomers. After oxidation, ATM forms disulfide bonds at Cys2991 (and putatively at other sites). The disulfide bonds cause the activated ATM to remain in covalently-bound dimers (16). Mutation of Cys2991 to a leucine (Cys2991Leu) blocked ATM oxidation-induced activation.

The mockingbird mutation results in substitution of glycine 448 for a premature stop codon (G448*) in the ATM protein; amino acid 448 is within the HEAT repeat region.

Expression/Localization

Atm is ubiquitously expressed. ATM predominantly localizes to the nucleus, but is also localized in peroxisomes, cytoplasmic vesicles, and mitochondria (17-20).

Background

ATM is a cell cycle checkpoint kinase that phosphorylates proteins in several cell processes, including DNA repair, apoptosis, cell cycle checkpoints, telomere dysfunction, translation initiation, gene regulation, mitosis, and hypoxia (Table 1). In all, there are 900 putative ATM/ATR phosphorylation sites on over 700 proteins in the DNA damage response (DDR) pathway alone (21).

Table 1. Select direct ATM substrates. For more information see (22).

Cell process	ATM target (phosphorylation site)
DNA repair	BRCA1 (Ser988)
	RAD17 (Ser645)
	RAD9 (Ser272)
	RAD50 (Ser635)
Apoptosis	p53 (Ser9 and Ser46)
	MDM2 (Ser395)
	E2F1 (Ser31)
	c-Abl (Ser465)
G2/M checkpoint	BRCA1 (Ser1423 and Ser1524)
	CHK2 (Thr68)
	CHK1 (Ser317 and Ser345)
Intra-S checkpoint	BRCA1 (Ser1387)
	NBS1 (Ser278 and Ser343)
	SMC1 (Ser957 and Ser966)
	FANCD2 (Ser222)
G1/S checkpoint	CHK2 (Thr68)
	p53 (Ser15)
	MDM2 (Ser395)
Mitosis	BUB1 (Ser314)
Telomere dysfunction	H2AX (Ser139)
	53BP1 (see the record for lentil) (Ser25)
Translation initiation	eIF-4E (Ser111)
Gene regulation	c-Jun (Ser63)
Hypoxia	HIF‐1α (Ser696)

Figure 12. Schematic overview of HR and NHEJ DNA DSB repair. Column A shows key steps in HR of DSBs: (1) PARP senses DSBs, competes with Ku binding to DNA to promote HR, and mediates the recruitment of the MRE11-RAD50-NBS1 (MRN) complex. MRN-dependent activation of protein kinases results in the recruitment of processing factors that generate 3’ ssDNA overhangs (not shown). (2) The formation of 3’-ssDNA ends leads to the accumulation of the RPA complex, which stabilizes the ssDNA regions, protects the DNA against degradation, and prevents the formation of secondary structures. (3) The RPA is displaced from the 3’-ssDNA ends; BRCA2-mediated assembly of RAD51 filaments leads to strand invasion into the homologous DNA sequence. (4) Mediators such as RAD51C and XRCC3 allow for the formation of RAD51 filaments, while strand invasion is stabilized by RAD54. RAD51 and RAD54 catalyze the formation of a displacement loop (D-loop), in which the invading strand primes DNA synthesis. D-loop formation is a branch point to different HR subpathways including break-induced replication (not shown), double Holliday junction formation (not shown), and synthesis-dependent strand annealing (SDSA); all of the subpathways result in the repair of DSB breaks. (5) Fill-in synthesis at the site of the DSB. (6) The results of SDSA is shown. Column B demonstrates selected steps in nonhomologous end joining (NEHJ) repair (see the text for details): (1) Ku associates to DSBs to promote NHEJ and (2) the recruitment of DNA-PKcs to (3) form the catalytically active DNA-PK complex that protects the DNA ends needed for ligation. (4) Autophosphorylation of DNA-PKcs allows for ARTEMIS and DNA pol x family members to access the DNA termini. ARTEMIS and DNA-PKcs form a complex that cleaves 5’ and 3’ overhangs during NHEJ. DNA pol x family members fill in the gaps with several nucleotides, if necessary, prior to relegation. Nucleases can remove base nucleotides, if necessary (not shown). (5) XRCC4/LIG4 is recruited to the site and the broken ends are religated with the help of XLF. (6) Repair resolution of the DSB following NHEJ. Abbreviations: HR, homologous recombination; NHEJ, nonhomologous end joining; DSB, double strand break; PARP; poly(ADP)ribose polymerase; MRN, MRE11-RAD50-NBS1; MRE11, meiotic recombination 11, NBS1, Nibrin or Nijmega breakage syndrome protein 1; ssDNA, single-stranded DNA; BRCA1, breast cancer 1, early onset; RPA, replication protein A; XRCC3, X-ray repair complementing defective repair in Chinese hamster cells 3; SDSA, synthesis-dependent strand annealing; XRCC4, X-ray repair cross-complementing 4; LIG4, DNA ligase IV; XLF, XRCC4-like factor. Figure modified from images found in Ciccia and Elledge. Mol Cell . (2010) 40:179-204 , Heyer et al. Annu. Rev. Genet. (2010) 44:113-139 , and Neal and Meek. Mutat. Res. (2011) 711:73-86 .

Figure 13. Figure modified from Kurz and Lees-Miller. S.P. 2004

DNA double-strand breaks (DSBs) can occur as a result of exposure to external factors including ionizing radiation (IR) (e.g. medical x-rays and radon gas decay in the soil) (23), radiomimetic drugs (e.g. the antibiotic, bleomycin) (24), toxins (e.g. asbestos, silica, and titanium dioxide) (25), and topoisomerase inhibitors (e.g. camptothecin, which traps enzyme-DNA intermediates and inhibits the re-ligation of DNA) (26). Cellular processes such as the generation of reactive oxygen species as a byproduct of oxidative metabolism, the collapse of DNA replication forks (upon recognition of single-stranded breaks by the replication machinery) (27), and, in the case of B and T lymphocytes, immune receptor gene arrangement, also cause DSBs (28-30). Repair of DSBs is required to prevent chromosomal abnormalities and chromosome loss, and thereby maintain genomic stability. If left unrepaired, cell cycle arrest typically occurs, leading to cell death (28;31;32). In addition, instances of cancer can occur after a tumor suppressor gene is inactivated or deleted by a DSB, or when an oncogene is activated or translocated (33;34). 

Several factors are involved in DDR signaling including DNA damage sensors, mediators, transducers, and effectors [reviewed in (35)]. The MRN [MRE11 (meiotic recombination 11)–Rad50–NBS1 (Nijmegen breakage syndrome 1)] complex and ATM, ATR (ATM and Rad3-related) and DNA-PK_CS (see the record for clover) are involved in early DNA DSB-induced signaling [reviewed in (35)]. Mediator/adaptor proteins such as MDC1, BRCA1, PTIP, and 53BP1 (see the record for lentil) facilitate signaling between sensors and transducers. After irradiation, ATM is activated by autophosphorylation and subsequently recruited to the sites of DNA damage to phosphorylate its substrates (e.g., MDM2, p53, BRCA1, and H2AX). 53BP1 tethers activated ATM and other repair factors at the site of DSBs (36;37). ATM requires NBS1 as a co-factor for stable recruitment to DNA damage sites (38). 53BP1 is required efficient autophosphorylation of ATM at Ser1981 as well as ATM activation in some cell lines (39;40). 53BP1-mediated regulation of ATM-dependent phosphorylation of substrates in response to IR indicates that 53BP1 is a DNA damage checkpoint protein that facilitates ATM phosphorylation events (41). In irradiated U2OS cells, ATM coprecipitated with 53BP1, but not in non-irradiated cells, indicating that the interaction of 53BP1 and ATM is DNA damage-specific (41). DiTullio et al. propose that 53BP1 may function upstream of ATM to activate ATM in response to DSBs, and/or that 53BP1 functions as a scaffold to recruit ATM substrates to ATM at DSBs (41). ATM suppresses end resection in 53BP1-deficient cells in G1, but not in S/G2 phase of the cell cycle (42-44). An IR-induced DSB induces the phosphorylation of H2AX at Ser139 by PIKKs (ATM/ATR/DNA-PKcs) to form γ-H2AX. 

In addition to being activated by DNA damage, ATM can also be activated in the cytoplasm by reactive oxygen species in a DNA- and MRN-independent manner (16). Oxidative stress-induced ATM activation inhibits mTOR complex 1 (mTORC1) through a signaling cascade that involves the tuberous sclerosis-2 (TSC2) tumor suppressor. ATM activates liver kinase B1 protein (LKB1), which phosphorylates AMP‐activated protein kinase (AMPK) at residue Thr172. AMPK then phosphorylates TSC2 at several residues, Thr1271 and Ser1387, activating its Rheb GTPase activity. ATM/AMPK-mediated activation of TSC2 results in inhibition of the mTORC1 complex and autophagy. The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis. The activation of growth factor receptor tyrosine kinases leads to the activation of phosphatidylinositol 3-kinase (PI3K), an upstream activator of mTOR, which subsequently activates Akt, allowing the protein Rheb to remain in a GTP-bound state (45). Rheb-GTP subsequently binds and activates the mTOR kinase domain through an unknown mechanism (45). mTOR activity is then regulated through the Akt-mediated phosphorylation of tumor suppressors TSC1 and TSC2 (45-47). In the mTORC1 complex, mTOR interacts with raptor, PRAS40, Deptor, and mLST8 to target proteins in a rapamycin-sensitive manner (48). The phosphorylation of TSC2 by Akt inactivates the GTPase activating protein (GAP) activity of TSC2. When mTORC1 is activated upon raptor binding to mTOR, it phosphorylates several targets, including S6 kinase 1 (S6K1) and 4E-binding protein 1 (4E-BP1) (49). S6K1, in addition to S6K2, is a kinase that phosphorylates S6, a component of the small (40S) ribosomal subunit (48). See the record hamel for more information about mTOR-associated signaling and functions.

ATM also functions in the maintenance of the cellular redox balance by inducing glucose‐6‐phosphate dehydrogenase (G6PDH), the rate‐limiting enzyme of the pentose phosphate pathway (PPP) (50). The PPP produces NADPH for antioxidant pathways and nucleotide synthesis. ATM activation promotes p38-MK2 kinase to phosphorylate HSP27, which binds and activates G6PDH.

ATM is activated during hypoxia, whereby it promotes an increase in histone H3 lysine 9 trimethylation (H3K9me3) and subsequent chromatin remodeling (51). During hypoxia, ATM also inhibits mTORC1 by phosphorylating the hypoxia‐inducible factor (HIF‐1α) transcription factor at Ser696 (52). he transcription of REDD1 (regulated in development and DDR 1) leads to activation of the TSC complex and suppression of mTORC1 activity.

ATM-deficient cells exhibit defective G1, S, and G2 checkpoints as well as aberrant DNA damage responses to ionizing radiation. The ATM-associated defective G1—S checkpoint is primarily due to a loss in ATM-dependent p53 phosphorylation. P53 is required for the activation of p21^WAF1/CIP1, which inhibits cyclin E and CDK2. The cyclin E/CDK2 complex is required for exit out of G1.

Mutations in human ATM are linked to ataxia-telangiectasia [OMIM: #208900; (53;54)] and susceptibility to breast cancer (OMIM: #114480) as well as somatic B-cell non-Hodgkin lymphoma, somatic mantle cell lymphoma, and somatic T-cell prolymphocytic leukemia. Ataxia-telangiectasia is characterized by progressive cerebellar ataxia due to premature degeneration of Purkinje and granule cells, telangiectasia (dilated blood vessels), growth retardation, gonadal atrophy, immune defects, and a predisposition to malignancy (lymphoma, leukemia, and breast cancer). Fibroblasts from ataxia-telangiectasia patients exhibit aberrant gross morphology and cytoskeletal organization, poor cell growth, defective cell-cycle checkpoints, telomere loss, and chromosome end-to-end associations.

Atm­-deficient (Atm^-/-) mice exhibited reduced body weights, increased incidence of T-cell-derived lymphoma, premature death (median survival is 113 days), reduced numbers of CD4+ and CD8+ T cells, reduced numbers of CD3/CD4 and CD3/CD8 T cells, reduced numbers of active T cells, reduced numbers of pre-B cells, reduced levels of IgG, male and female infertility, hypoactivity, impaired coordination, impaired glucose tolerance, and insulin resistance (55-63). B cells from the Atm^-/- mice exhibited reduced class switch recombination with increased genomic instability after tamoxifen treatment compared to cells from wild-type mice (64). Homozygous mice expressing a kinase dead mutant Atm allele exhibited embryonic lethality from embryonic day (E) 9.5 to E10.5 (64). Homozygous mice expressing a mutant Atm allele (a 9 base pair in-frame deletion in exon 54 resulting in deletion of Ser2556-Arg2557-Iso2558 in the protein) exhibited premature death by 40 weeks of age (50%), reduced body size, increased tumor incidence, increased numbers of double-negative and single-positive T cells, reduced thymocyte numbers, and male infertility (61).

Primers

PCR Primer
mockingbird_pcr_F: GGCCTCAAGTAAACCAAAGTTTTC
mockingbird_pcr_R: GGCCTAGTCAGTATCAGCAG

Sequencing Primer
mockingbird_seq_F: TCAGTTTGTGTTTGTCCAGAAC
mockingbird_seq_R: AGAGTGAAGATGATACTGTAGTTAGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 463 nucleotides is amplified (chromosome 9, - strand):

1   ggcctagtca gtatcagcag ttaatttact taaaaaacaa tattgaaaag agtgaagatg
61  atactgtagt taggatatag aaaggtatag tatttgcatc tttgttttct tttatgttgt
121 taaagattga aaagaattca cagaaatcct tttctttttt cctttcaggc tacagattac
181 aacccgatta atatcaaaat atccttccag tttacctaac tgtgagctgt ctccattaat
241 actgatactg taccagcttc tgcctcaaca gcgacgtgga gaacgcatcc catatgtgtt
301 acgatgcctt aaggaagttg ccttatgtca aggcaagaaa tcaaacctgg aaagctctca
361 gaagtcagat ttattgaaac tatggatcaa aatttggtct attacctttc gtggtataag
421 ttctggacaa acacaaactg aaaactttgg tttacttgag gcc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Lovejoy, C. A., and Cortez, D. (2009) Common Mechanisms of PIKK Regulation. DNA Repair (Amst). 8, 1004-1008.

  2. Hill, R., and Lee, P. W. (2010) The DNA-Dependent Protein Kinase (DNA-PK): More than just a Case of Making Ends Meet? Cell Cycle. 9, 3460-3469.

  3. Falck, J., Coates, J., and Jackson, S. P. (2005) Conserved Modes of Recruitment of ATM, ATR and DNA-PKcs to Sites of DNA Damage. Nature. 434, 605-611.

  4. Abraham, R. T. (2001) Cell Cycle Checkpoint Signaling through the ATM and ATR Kinases. Genes Dev. 15, 2177-2196.

  5. Dip, R., and Naegeli, H. (2005) More than just Strand Breaks: The Recognition of Structural DNA Discontinuities by DNA-Dependent Protein Kinase Catalytic Subunit. FASEB J. 19, 704-715.

  6. Perry, J., and Kleckner, N. (2003) The ATRs, ATMs, and TORs are Giant HEAT Repeat Proteins. Cell. 112, 151-155.

  7. Andrade, M. A., Perez-Iratxeta, C., and Ponting, C. P. (2001) Protein Repeats: Structures, Functions, and Evolution. J Struct Biol. 134, 117-131.

  8. Llorca, O., Rivera-Calzada, A., Grantham, J., and Willison, K. R. (2003) Electron Microscopy and 3D Reconstructions Reveal that Human ATM Kinase Uses an Arm-Like Domain to Clamp Around Double-Stranded DNA. Oncogene. 22, 3867-3874.

  9. Baretic, D., Pollard, H. K., Fisher, D. I., Johnson, C. M., Santhanam, B., Truman, C. M., Kouba, T., Fersht, A. R., Phillips, C., and Williams, R. L. (2017) Structures of Closed and Open Conformations of Dimeric Human ATM. Sci Adv. 3, e1700933.

  10. Bakkenist, C. J., and Kastan, M. B. (2003) DNA Damage Activates ATM through Intermolecular Autophosphorylation and Dimer Dissociation. Nature. 421, 499-506.

  11. Daniel, J. A., Pellegrini, M., Lee, J. H., Paull, T. T., Feigenbaum, L., and Nussenzweig, A. (2008) Multiple Autophosphorylation Sites are Dispensable for Murine ATM Activation in Vivo. J Cell Biol. 183, 777-783.

  12. Goodarzi, A. A., Jonnalagadda, J. C., Douglas, P., Young, D., Ye, R., Moorhead, G. B., Lees-Miller, S. P., and Khanna, K. K. (2004) Autophosphorylation of Ataxia-Telangiectasia Mutated is Regulated by Protein Phosphatase 2A. EMBO J. 23, 4451-4461.

  13. Shreeram, S., Demidov, O. N., Hee, W. K., Yamaguchi, H., Onishi, N., Kek, C., Timofeev, O. N., Dudgeon, C., Fornace, A. J., Anderson, C. W., Minami, Y., Appella, E., and Bulavin, D. V. (2006) Wip1 Phosphatase Modulates ATM-Dependent Signaling Pathways. Mol Cell. 23, 757-764.

  14. Kaidi, A., and Jackson, S. P. (2013) KAT5 Tyrosine Phosphorylation Couples Chromatin Sensing to ATM Signalling. Nature. 498, 70-74.

  15. Sun, Y., Jiang, X., Chen, S., Fernandes, N., and Price, B. D. (2005) A Role for the Tip60 Histone Acetyltransferase in the Acetylation and Activation of ATM. Proc Natl Acad Sci U S A. 102, 13182-13187.

  16. Guo, Z., Kozlov, S., Lavin, M. F., Person, M. D., and Paull, T. T. (2010) ATM Activation by Oxidative Stress. Science. 330, 517-521.

  17. Valentin-Vega, Y. A., Maclean, K. H., Tait-Mulder, J., Milasta, S., Steeves, M., Dorsey, F. C., Cleveland, J. L., Green, D. R., and Kastan, M. B. (2012) Mitochondrial Dysfunction in Ataxia-Telangiectasia. Blood. 119, 1490-1500.

  18. Lim, D. S., Kirsch, D. G., Canman, C. E., Ahn, J. H., Ziv, Y., Newman, L. S., Darnell, R. B., Shiloh, Y., and Kastan, M. B. (1998) ATM Binds to Beta-Adaptin in Cytoplasmic Vesicles. Proc Natl Acad Sci U S A. 95, 10146-10151.

  19. Barlow, C., Ribaut-Barassin, C., Zwingman, T. A., Pope, A. J., Brown, K. D., Owens, J. W., Larson, D., Harrington, E. A., Haeberle, A. M., Mariani, J., Eckhaus, M., Herrup, K., Bailly, Y., and Wynshaw-Boris, A. (2000) ATM is a Cytoplasmic Protein in Mouse Brain Required to Prevent Lysosomal Accumulation. Proc Natl Acad Sci U S A. 97, 871-876.

  20. Watters, D., Kedar, P., Spring, K., Bjorkman, J., Chen, P., Gatei, M., Birrell, G., Garrone, B., Srinivasa, P., Crane, D. I., and Lavin, M. F. (1999) Localization of a Portion of Extranuclear ATM to Peroxisomes. J Biol Chem. 274, 34277-34282.

  21. Matsuoka, S., Ballif, B. A., Smogorzewska, A., McDonald, E. R.,3rd, Hurov, K. E., Luo, J., Bakalarski, C. E., Zhao, Z., Solimini, N., Lerenthal, Y., Shiloh, Y., Gygi, S. P., and Elledge, S. J. (2007) ATM and ATR Substrate Analysis Reveals Extensive Protein Networks Responsive to DNA Damage. Science. 316, 1160-1166.

  22. Kurz, E. U., and Lees-Miller, S. P. (2004) DNA Damage-Induced Activation of ATM and ATM-Dependent Signaling Pathways. DNA Repair (Amst). 3, 889-900.

  23. Mitra, A. K., Bhat, N., Sarma, A., and Krishna, M. (2005) Alteration in the Expression of Signaling Parameters Following Carbon Ion Irradiation. Mol Cell Biochem. 276, 169-173.

  24. Martensson, S., Nygren, J., Osheroff, N., and Hammarsten, O. (2003) Activation of the DNA-Dependent Protein Kinase by Drug-Induced and Radiation-Induced DNA Strand Breaks. Radiat Res. 160, 291-301.

  25. Msiska, Z., Pacurari, M., Mishra, A., Leonard, S. S., Castranova, V., and Vallyathan, V. (2010) DNA Double-Strand Breaks by Asbestos, Silica, and Titanium Dioxide: Possible Biomarker of Carcinogenic Potential? Am J Respir Cell Mol Biol. 43, 210-219.

  26. Shao, R. G., Cao, C. X., Zhang, H., Kohn, K. W., Wold, M. S., and Pommier, Y. (1999) Replication-Mediated DNA Damage by Camptothecin Induces Phosphorylation of RPA by DNA-Dependent Protein Kinase and Dissociates RPA:DNA-PK Complexes. EMBO J. 18, 1397-1406.

  27. Saleh-Gohari, N., Bryant, H. E., Schultz, N., Parker, K. M., Cassel, T. N., and Helleday, T. (2005) Spontaneous Homologous Recombination is Induced by Collapsed Replication Forks that are Caused by Endogenous DNA Single-Strand Breaks. Mol Cell Biol. 25, 7158-7169.

  28. Collis, S. J., DeWeese, T. L., Jeggo, P. A., and Parker, A. R. (2005) The Life and Death of DNA-PK. Oncogene. 24, 949-961.

  29. Shrivastav, M., De Haro, L. P., and Nickoloff, J. A. (2008) Regulation of DNA Double-Strand Break Repair Pathway Choice. Cell Res. 18, 134-147.

  30. Cahill, D., Connor, B., and Carney, J. P. (2006) Mechanisms of Eukaryotic DNA Double Strand Break Repair. Front Biosci. 11, 1958-1976.

  31. Kaina, B. (2003) DNA Damage-Triggered Apoptosis: Critical Role of DNA Repair, Double-Strand Breaks, Cell Proliferation and Signaling. Biochem Pharmacol. 66, 1547-1554.

  32. Hammarsten, O., DeFazio, L. G., and Chu, G. (2000) Activation of DNA-Dependent Protein Kinase by Single-Stranded DNA Ends. J Biol Chem. 275, 1541-1550.

  33. Elliott, B., and Jasin, M. (2002) Double-Strand Breaks and Translocations in Cancer. Cell Mol Life Sci. 59, 373-385.

  34. Khanna, K. K., and Jackson, S. P. (2001) DNA Double-Strand Breaks: Signaling, Repair and the Cancer Connection. Nat Genet. 27, 247-254.

  35. FitzGerald, J. E., Grenon, M., and Lowndes, N. F. (2009) 53BP1: Function and Mechanisms of Focal Recruitment. Biochem Soc Trans. 37, 897-904.

  36. Lee, J. H., Goodarzi, A. A., Jeggo, P. A., and Paull, T. T. (2010) 53BP1 Promotes ATM Activity through Direct Interactions with the MRN Complex. EMBO J. 29, 574-585.

  37. Noon, A. T., Shibata, A., Rief, N., Lobrich, M., Stewart, G. S., Jeggo, P. A., and Goodarzi, A. A. (2010) 53BP1-Dependent Robust Localized KAP-1 Phosphorylation is Essential for Heterochromatic DNA Double-Strand Break Repair. Nat Cell Biol. 12, 177-184.

  38. Falck, J., Coates, J., and Jackson, S. P. (2005) Conserved Modes of Recruitment of ATM, ATR and DNA-PKcs to Sites of DNA Damage. Nature. 434, 605-611.

  39. Mochan, T. A., Venere, M., DiTullio, R. A.,Jr, and Halazonetis, T. D. (2003) 53BP1 and NFBD1/MDC1-Nbs1 Function in Parallel Interacting Pathways Activating Ataxia-Telangiectasia Mutated (ATM) in Response to DNA Damage. Cancer Res. 63, 8586-8591.

  40. Wilson, K. A., and Stern, D. F. (2008) NFBD1/MDC1, 53BP1 and BRCA1 have both Redundant and Unique Roles in the ATM Pathway. Cell Cycle. 7, 3584-3594.

  41. DiTullio, R. A.,Jr, Mochan, T. A., Venere, M., Bartkova, J., Sehested, M., Bartek, J., and Halazonetis, T. D. (2002) 53BP1 Functions in an ATM-Dependent Checkpoint Pathway that is Constitutively Activated in Human Cancer. Nat Cell Biol. 4, 998-1002.

  42. Bothmer, A., Robbiani, D. F., Feldhahn, N., Gazumyan, A., Nussenzweig, A., and Nussenzweig, M. C. (2010) 53BP1 Regulates DNA Resection and the Choice between Classical and Alternative End Joining during Class Switch Recombination. J Exp Med. 207, 855-865.

  43. Bunting, S. F., Callen, E., Wong, N., Chen, H. T., Polato, F., Gunn, A., Bothmer, A., Feldhahn, N., Fernandez-Capetillo, O., Cao, L., Xu, X., Deng, C. X., Finkel, T., Nussenzweig, M., Stark, J. M., and Nussenzweig, A. (2010) 53BP1 Inhibits Homologous Recombination in Brca1-Deficient Cells by Blocking Resection of DNA Breaks. Cell. 141, 243-254.

  44. Yamane, A., Robbiani, D. F., Resch, W., Bothmer, A., Nakahashi, H., Oliveira, T., Rommel, P. C., Brown, E. J., Nussenzweig, A., Nussenzweig, M. C., and Casellas, R. (2013) RPA Accumulation during Class Switch Recombination Represents 5'-3' DNA-End Resection during the S-G2/M Phase of the Cell Cycle. Cell Rep. 3, 138-147.

  45. Gibbons, J. J., Abraham, R. T., and Yu, K. (2009) Mammalian Target of Rapamycin: Discovery of Rapamycin Reveals a Signaling Pathway Important for Normal and Cancer Cell Growth. Semin Oncol. 36 Suppl 3, S3-S17.

  46. Hasumi, H., Baba, M., Hong, S. B., Hasumi, Y., Huang, Y., Yao, M., Valera, V. A., Linehan, W. M., and Schmidt, L. S. (2008) Identification and Characterization of a Novel Folliculin-Interacting Protein FNIP2. Gene. 415, 60-67.

  47. Lee, D. F., and Hung, M. C. (2007) All Roads Lead to mTOR: Integrating Inflammation and Tumor Angiogenesis. Cell Cycle. 6, 3011-3014.

  48. Wang, X., and Proud, C. G. (2006) The mTOR Pathway in the Control of Protein Synthesis. Physiology (Bethesda). 21, 362-369.

  49. Hay, N., and Sonenberg, N. (2004) Upstream and Downstream of mTOR. Genes Dev. 18, 1926-1945.

  50. Cosentino, C., Grieco, D., and Costanzo, V. (2011) ATM Activates the Pentose Phosphate Pathway Promoting Anti-Oxidant Defence and DNA Repair. EMBO J. 30, 546-555.

  51. Olcina, M. M., Foskolou, I. P., Anbalagan, S., Senra, J. M., Pires, I. M., Jiang, Y., Ryan, A. J., and Hammond, E. M. (2013) Replication Stress and Chromatin Context Link ATM Activation to a Role in DNA Replication. Mol Cell. 52, 758-766.

  52. Cam, H., Easton, J. B., High, A., and Houghton, P. J. (2010) MTORC1 Signaling Under Hypoxic Conditions is Controlled by ATM-Dependent Phosphorylation of HIF-1alpha. Mol Cell. 40, 509-520.

  53. Buzin, C. H., Gatti, R. A., Nguyen, V. Q., Wen, C. Y., Mitui, M., Sanal, O., Chen, J. S., Nozari, G., Mengos, A., Li, X., Fujimura, F., and Sommer, S. S. (2003) Comprehensive Scanning of the ATM Gene with DOVAM-S. Hum Mutat. 21, 123-131.

  54. Savitsky, K., Bar-Shira, A., Gilad, S., Rotman, G., Ziv, Y., Vanagaite, L., Tagle, D. A., Smith, S., Uziel, T., Sfez, S., Ashkenazi, M., Pecker, I., Frydman, M., Harnik, R., Patanjali, S. R., Simmons, A., Clines, G. A., Sartiel, A., Gatti, R. A., Chessa, L., Sanal, O., Lavin, M. F., Jaspers, N. G., Taylor, A. M., Arlett, C. F., Miki, T., Weissman, S. M., Lovett, M., Collins, F. S., and Shiloh, Y. (1995) A Single Ataxia Telangiectasia Gene with a Product Similar to PI-3 Kinase. Science. 268, 1749-1753.

  55. Barlow, C., Hirotsune, S., Paylor, R., Liyanage, M., Eckhaus, M., Collins, F., Shiloh, Y., Crawley, J. N., Ried, T., Tagle, D., and Wynshaw-Boris, A. (1996) Atm-Deficient Mice: A Paradigm of Ataxia Telangiectasia. Cell. 86, 159-171.

  56. Genik, P. C., Bielefeldt-Ohmann, H., Liu, X., Story, M. D., Ding, L., Bush, J. M., Fallgren, C. M., and Weil, M. M. (2014) Strain Background Determines Lymphoma Incidence in Atm Knockout Mice. Neoplasia. 16, 129-136.

  57. Treuner, K., Helton, R., and Barlow, C. (2004) Loss of Rad52 Partially Rescues Tumorigenesis and T-Cell Maturation in Atm-Deficient Mice. Oncogene. 23, 4655-4661.

  58. Morales, M., Theunissen, J. W., Kim, C. F., Kitagawa, R., Kastan, M. B., and Petrini, J. H. (2005) The Rad50S Allele Promotes ATM-Dependent DNA Damage Responses and Suppresses ATM Deficiency: Implications for the Mre11 Complex as a DNA Damage Sensor. Genes Dev. 19, 3043-3054.

  59. Xu, Y., Ashley, T., Brainerd, E. E., Bronson, R. T., Meyn, M. S., and Baltimore, D. (1996) Targeted Disruption of ATM Leads to Growth Retardation, Chromosomal Fragmentation during Meiosis, Immune Defects, and Thymic Lymphoma. Genes Dev. 10, 2411-2422.

  60. Borghesani, P. R., Alt, F. W., Bottaro, A., Davidson, L., Aksoy, S., Rathbun, G. A., Roberts, T. M., Swat, W., Segal, R. A., and Gu, Y. (2000) Abnormal Development of Purkinje Cells and Lymphocytes in Atm Mutant Mice. Proc Natl Acad Sci U S A. 97, 3336-3341.

  61. Spring, K., Cross, S., Li, C., Watters, D., Ben-Senior, L., Waring, P., Ahangari, F., Lu, S. L., Chen, P., Misko, I., Paterson, C., Kay, G., Smorodinsky, N. I., Shiloh, Y., and Lavin, M. F. (2001) Atm Knock-in Mice Harboring an in-Frame Deletion Corresponding to the Human ATM 7636del9 Common Mutation Exhibit a Variant Phenotype. Cancer Res. 61, 4561-4568.

  62. Elson, A., Wang, Y., Daugherty, C. J., Morton, C. C., Zhou, F., Campos-Torres, J., and Leder, P. (1996) Pleiotropic Defects in Ataxia-Telangiectasia Protein-Deficient Mice. Proc Natl Acad Sci U S A. 93, 13084-13089.

  63. Takagi, M., Uno, H., Nishi, R., Sugimoto, M., Hasegawa, S., Piao, J., Ihara, N., Kanai, S., Kakei, S., Tamura, Y., Suganami, T., Kamei, Y., Shimizu, T., Yasuda, A., Ogawa, Y., and Mizutani, S. (2015) ATM Regulates Adipocyte Differentiation and Contributes to Glucose Homeostasis. Cell Rep. .

  64. Yamamoto, K., Wang, Y., Jiang, W., Liu, X., Dubois, R. L., Lin, C. S., Ludwig, T., Bakkenist, C. J., and Zha, S. (2012) Kinase-Dead ATM Protein Causes Genomic Instability and Early Embryonic Lethality in Mice. J Cell Biol. 198, 305-313.