Phenotypic Mutation 'Armitage'

• Allele: Armitage
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 125,289,757 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Ltbr
• Gene Name: lymphotoxin B receptor
• Synonym(s): Ltar, TNF-R-III, Tnfrsf3, TNFR2-RP, LT-beta receptor, LT beta-R, TNF receptor-related protein, Tnfbr, LTbetaR, TNFCR, TNFRrp
• Chromosomal Location: 125,283,534-125,290,848 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012] ; PHENOTYPE: Homozygotes for a targeted null mutation lack Peyer's patches, colon-associated lymphoid tissues, and lymph nodes. Mutants also exhibit severely reduced numbers of NK cells and increased susceptibility to Theiler's murine encephalomyelitis virus. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Tryptophan
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000032489]
• AlphaFold: P50284
• SMART Domains: Protein: ENSMUSP00000032489; Gene: ENSMUSG00000030339; AA Change: R146W

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
TNFR	43	80	5.73e-5	SMART
TNFR	83	124	3.96e-8	SMART
Blast:TNFR	126	169	3e-7	BLAST
TNFR	172	212	1.95e-7	SMART
transmembrane domain	222	244	N/A	INTRINSIC
low complexity region	294	305	N/A	INTRINSIC
low complexity region	362	388	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000032489)
• Meta Mutation Damage Score: 0.6467
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2022-04-15 6:45 AM by External Program
• Record Created: 2017-09-20 7:35 AM
• Record Posted: 2018-01-12
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010736; MGI:104875

Alleles Listed at MGI

All alleles(7) : Chemically induced (ENU)(1) Targeted(6)

Phenotypic Description

Figure 1. Homozygous armitage mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The armitage phenotype was initially identified among G3 mice of the pedigree R5434, some of which exhibited diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll; Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the diminished T-independent antibody response to NP-Ficoll using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R5434. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. The reduced T-independent antibody response to NP-Ficoll phenotype was linked by continuous variable mapping to a mutation in Ltbr:  a C to T transition at base pair 125,312,794 on chromosome 6, corresponding to base pair 1,077 in GenBank genomic region NC_000072 encoding Ltbr. Linkage was found with a recessive model of inheritance, wherein 10 variant homozygotes departed phenotypically from 23 homozygous reference mice and 23 heterozygous mice with a P value of 5.958 x 10^-5 (Figure 2). 

The mutation corresponds to residue 636 in the mRNA sequence NM_010736 within exon 4 of 10 total exons.

621 CACTGTGAGGAGGAGCGGCTTGTACTCTGCCAG 141 -H--C--E--E--E--R--L--V--L--C--Q-

The mutated nucleotide is indicated in red.  The mutation results in an arginine to tryptophan substitution at position 146 (R146W) in the LTβR protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.973).

Protein Prediction

Domain structure of LTβR. The armitage mutation within CRD3 is shown. Abbreviations: SP, signal peptide; CRD, cysteine-rich domain; TMD, transmembrane domain; SAD, self-association domain; TRAF, tumor necrosis factor receptor-associated factor; ECD, extracellular domain; ICD, intracellular domain. really interesting new gene; ZINC, zinc finger motifs; CC, coiled coil; MATH, meprin and TRAF homology. This image is interactive. Other mutations found in LTβR are noted in red. Click on the mutations for more information.

Ltbr encodes the lymphotoxin β receptor (LTβR), a member of the tumor necrosis factor receptor (TNFR) superfamily (1). Similar to other members of the TNFR family, LTβR has an extracellular domain (ECD; amino acids 28-221; SMART), a transmembrane domain (TMD; amino acids 222-244), and an intracellular domain (ICD; amino acids 245-415) [(2); reviewed in (3)]. Amino acids 1-27 of LTβR comprise a signal peptide (2). LTβR has two conserved putative Asn-linked glycosylation sites at Asn40 and Asn179 (2). Within the ECD, LTβR has four cysteine-rich domains (CRDs; amino acids 43-80, 83-124, 126-169, and 172-212) [(4); reviewed in (3)]. The CRDs mediate ligand (i.e., LTα₁β₂ and LIGHT) specificity and affinity [(5;6); reviewed in (3)]. The second and third CRDs (i.e., amino acids 83-124 and 126-169) mediate most receptor-ligand interactions (6). The self-association domain (SAD; amino acids 324-377) within the ICD is required for LTβR-associated apoptotic signaling as well as for the association of LTβR with the serine/threonine kinases p50 and p80 (1;7).

The armitage mutation results in an arginine to tryptophan substitution at position 146 (R146W) in the LTβR protein; amino acid 146 is within the third CRD within the ECD.

See the record for kama for more information about Ltbr.

Putative Mechanism

LTα₁β₂ and LIGHT (alternatively, TNF superfamily (TNFSF)14) are the known ligands of LTβR; both LTα₁β₂ and LIGHT are members of the TNF superfamily [4;8-12); see the record PanR1 (Tnf) and walla (Cd40lg)]. LTα₁β₂ is expressed on activated T and B lymphocytes as well as natural killer (NK) cells, a subset of follicular B cells, and lymphoid tissue inducer (LTi) cells (CD4⁺IL-7R⁺CD3⁻ CD45⁺RORγt⁺; see the record for chestnut) (9;13;14). LIGHT is a homotrimer expressed on T lymphocytes, monocytes, granulocytes, and immature dendritic cells (13).

LTβR signals through both the canonical (classical; see the record for finlay) and non-canonical (alternative; see the record for xander) nuclear factor κB (NF-κB) signaling pathways [(15-17); reviewed in (18)]. LTβR-mediated activation of the NF-κB signaling pathways results in the expression of genes that encode adhesion molecules, chemokines (e.g., CCL21 and CXCL13), and lymphokines involved in inflammation and secondary lymphoid organogenesis and homeostasis [(16); reviewed in (3)]. For a detailed review on the NF-κB signaling pathways see the records for finlay and xander.

LTβR-associated signaling mediates several functions including lymphoid tissue development and maintenance (19-23), formation of germinal centers (24), dendritic cell-mediated immune function (25;26), apoptosis (27), chemokine secretion, maintenance of splenic architecture, maintenance of T and B cell segregation into discrete compartments, protection against autoimmune diseases, regulation of lipid metabolism (28), homeostasis of the intestinal immune system (16) including protection against Citrobacter rodentium-induced colitis (10;29) and DSS-induced colitis (30) as well as protection against Mycbacterium bovis bacillus Calmette-Guérin (BCG), Mycobacterium tuberculosis, Listeria monocytogenes, and cytomegalovirus infections (31-33).

LTβR-associated signaling has been linked to several human conditions including autoimmunity, atherosclerosis, and cancer (see descriptions, above). Mutations in LTBR have been linked to increased risk for IgA nephropathy (OMIM: %161950), a form of glomerulonephritis that leads to end-stage renal disease, in Korean children (34).

Ltbr knockout (Ltbr^-/-; Ltbr^tm1Kpf, MGI:2384140) mice appear healthy, are born at the expected Menelian frequency, and are fertile (22). Ltbr^-/- mice exhibited defects in secondary lymphoid organogenesis including the absence of cervical, axillary, inguinal, paraaortic/sacral, popliteal, and mesenteric lymph nodes, Peyer’s patches, and germinal centers, disorganization of the splenic architecture (i.e., disturbed microarchitecture of the white pulp, no separate B- and T-cell areas, no follicles, and disruptions to the marginal zone), and disruption of the thymic stroma architecture (21;22;35;36). All of the Ltbr^-/- mice had a spleen and a thymus; the spleens of the Ltbr^-/- mice were 1.5 to 2 times bigger than those in wild-type mice (22). Thymocyte maturation was normal in the Ltbr^-/- mice (22). Within the spleen, the marginal zone B cell population (B220⁺, IgM^high, IgD^dull), MOMA-1⁺ metallophilic macrophages, sialoadhesin⁺ MZ macrophages, and MAdCAM-1⁺ sinus lining cells were completely undetectable (22). Flow cytometric analysis of lymphocytes from lungs and spleens of the Ltbr^-/- mice determined that α_Eβ₇^high integrin⁺ T cells were absent (22). Infiltrations of lymphocytes (mainly CD4⁺ T cells and B220⁺ B cells) were observed in the Ltbr^-/- mice around the perivascular areas in the lungs, liver, pancreas, submandibular glands, the fatty tissue of the mediastinum, mesenterium, cortex of the suprarenal glands, and kidney (22). Ltbr^-/- mice exhibited lethality three weeks after exposure to Plasmodium berghei ANKA (PbA)-induced experimental cerebral malaria (ECM) with a concomitant high parasitaemia and severe anemia; wild-type mice succumb after approximately one week (37). Ltbr^-/- mice did not develop ECM-associated neurological signs such as postural disorders, ataxia, impaired reflexes, loss of grip strength, progressive paralysis, and coma (37).  

LTβR-associated signaling is known to maintain the marginal zone to promote antibody responses and is required for the formation of germinal centers during antigen-dependent responses (16;22;38-41). Ltbr^-/- mice exhibited higher levels of IgM in response to the T-dependent antigen, NP₁₉-CG (4-hydroxy-3-nitrophenyl-acetyl-chicken gamma globulin absorbed to alum) compared to wild-type mice, however the amount of anti-NP IgG₁ levels produced were lower than wild-type mice (22). The armitage mice exhibit a negligible T-independent IgM response to NP-Ficoll. The morphology of the spleen in the armitage mice has not been examined, but the diminished antibody response indicates defects in germinal center formation in the armitage mice.  

Primers

PCR Primer
Armitage_pcr_F: TCATACCAGTTCATGTCTTGGC
Armitage_pcr_R: TGCATGATGGGTACGACTGG

Sequencing Primer
Armitage_seq_F: GACTGATAGATTCTTTATGGTTCTCC
Armitage_seq_R: TACGACTGGGAGGGCCAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 415 nucleotides is amplified (chromosome 6, - strand):

1   tgcatgatgg gtacgactgg gagggccagc tcctctctga ctcttccctc tccctgacag
61  tgctgggctt tgaggaggtt gccccttgca ccagcgatcg gaaagccgag tgccgctgtc
121 agccggggat gtcctgtgtg tatctggaca atgagtgtgt gcactgtgag gaggagcggc
181 ttgtactctg ccagcctggc acagaagccg aggtcacagg tcagaggtca ctgagggcag
241 ccagtaaagg gaggctgggc atcaagggca aggaacgtga tactgtgcgc atggtgcttc
301 tccccactgg tactgtgagt gtggtacctc tgcccactgg gagaaccata aagaatctat
361 cagtccttga aaaaggctca caggaggggg tctgccaaga catgaactgg tatga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Wu, M. Y., Wang, P. Y., Han, S. H., and Hsieh, S. L. (1999) The Cytoplasmic Domain of the Lymphotoxin-Beta Receptor Mediates Cell Death in HeLa Cells. J Biol Chem. 274, 11868-11873.

  2. Nakamura, T., Tashiro, K., Nazarea, M., Nakano, T., Sasayama, S., and Honjo, T. (1995) The Murine Lymphotoxin-Beta Receptor cDNA: Isolation by the Signal Sequence Trap and Chromosomal Mapping. Genomics. 30, 312-319.

  3. Remouchamps, C., Boutaffala, L., Ganeff, C., and Dejardin, E. (2011) Biology and Signal Transduction Pathways of the Lymphotoxin-alphabeta/LTbetaR System. Cytokine Growth Factor Rev. 22, 301-310.

  4. Crowe, P. D., VanArsdale, T. L., Walter, B. N., Ware, C. F., Hession, C., Ehrenfels, B., Browning, J. L., Din, W. S., Goodwin, R. G., and Smith, C. A. (1994) A Lymphotoxin-Beta-Specific Receptor. Science. 264, 707-710.

  5. Eldredge, J., Berkowitz, S., Corin, A. F., Day, E. S., Hayes, D., Meier, W., Strauch, K., Zafari, M., Tadi, M., and Farrington, G. K. (2006) Stoichiometry of LTbetaR Binding to LIGHT. Biochemistry. 45, 10117-10128.

  6. Sudhamsu, J., Yin, J., Chiang, E. Y., Starovasnik, M. A., Grogan, J. L., and Hymowitz, S. G. (2013) Dimerization of LTbetaR by LTalpha1beta2 is Necessary and Sufficient for Signal Transduction. Proc Natl Acad Sci U S A. 110, 19896-19901.

  7. Wu, M. Y., Hsu, T. L., Lin, W. W., Campbell, R. D., and Hsieh, S. L. (1997) Serine/threonine Kinase Activity Associated with the Cytoplasmic Domain of the Lymphotoxin-Beta Receptor in HepG2 Cells. J Biol Chem. 272, 17154-17159.

  8. Schneider, K., Potter, K. G., and Ware, C. F. (2004) Lymphotoxin and LIGHT Signaling Pathways and Target Genes. Immunol Rev. 202, 49-66.

  9. Wimmer, N., Huber, B., Barabas, N., Rohrl, J., Pfeffer, K., and Hehlgans, T. (2012) Lymphotoxin Beta Receptor Activation on Macrophages Induces Cross-Tolerance to TLR4 and TLR9 Ligands. J Immunol. 188, 3426-3433.

  10. Wang, Y., Koroleva, E. P., Kruglov, A. A., Kuprash, D. V., Nedospasov, S. A., Fu, Y. X., and Tumanov, A. V. (2010) Lymphotoxin Beta Receptor Signaling in Intestinal Epithelial Cells Orchestrates Innate Immune Responses Against Mucosal Bacterial Infection. Immunity. 32, 403-413.

  11. Browning, J. L., Dougas, I., Ngam-ek, A., Bourdon, P. R., Ehrenfels, B. N., Miatkowski, K., Zafari, M., Yampaglia, A. M., Lawton, P., and Meier, W. (1995) Characterization of Surface Lymphotoxin Forms. use of Specific Monoclonal Antibodies and Soluble Receptors. J Immunol. 154, 33-46.

  12. Mauri, D. N., Ebner, R., Montgomery, R. I., Kochel, K. D., Cheung, T. C., Yu, G. L., Ruben, S., Murphy, M., Eisenberg, R. J., Cohen, G. H., Spear, P. G., and Ware, C. F. (1998) LIGHT, a New Member of the TNF Superfamily, and Lymphotoxin Alpha are Ligands for Herpesvirus Entry Mediator. Immunity. 8, 21-30.

  13. Ware, C. F., VanArsdale, T. L., Crowe, P. D., and Browning, J. L. (1995) The Ligands and Receptors of the Lymphotoxin System. Curr Top Microbiol Immunol. 198, 175-218.

  14. Lane, P. J., Gaspal, F. M., and Kim, M. Y. (2005) Two Sides of a Cellular Coin: CD4(+)CD3- Cells Regulate Memory Responses and Lymph-Node Organization. Nat Rev Immunol. 5, 655-660.

  15. Muller, J. R., and Siebenlist, U. (2003) Lymphotoxin Beta Receptor Induces Sequential Activation of Distinct NF-Kappa B Factors Via Separate Signaling Pathways. J Biol Chem. 278, 12006-12012.

  16. Dejardin, E., Droin, N. M., Delhase, M., Haas, E., Cao, Y., Makris, C., Li, Z. W., Karin, M., Ware, C. F., and Green, D. R. (2002) The Lymphotoxin-Beta Receptor Induces Different Patterns of Gene Expression Via Two NF-kappaB Pathways. Immunity. 17, 525-535.

  17. Daller, B., Musch, W., Rohrl, J., Tumanov, A. V., Nedospasov, S. A., Mannel, D. N., Schneider-Brachert, W., and Hehlgans, T. (2011) Lymphotoxin-Beta Receptor Activation by Lymphotoxin-Alpha(1)Beta(2) and LIGHT Promotes Tumor Growth in an NFkappaB-Dependent Manner. Int J Cancer. 128, 1363-1370.

  18. Upadhyay, V., and Fu, Y. X. (2013) Lymphotoxin Signalling in Immune Homeostasis and the Control of Microorganisms. Nat Rev Immunol. 13, 270-279.

  19. Onder, L., Danuser, R., Scandella, E., Firner, S., Chai, Q., Hehlgans, T., Stein, J. V., and Ludewig, B. (2013) Endothelial Cell-Specific Lymphotoxin-Beta Receptor Signaling is Critical for Lymph Node and High Endothelial Venule Formation. J Exp Med. 210, 465-473.

  20. Banks, T. A., Rouse, B. T., Kerley, M. K., Blair, P. J., Godfrey, V. L., Kuklin, N. A., Bouley, D. M., Thomas, J., Kanangat, S., and Mucenski, M. L. (1995) Lymphotoxin-Alpha-Deficient Mice. Effects on Secondary Lymphoid Organ Development and Humoral Immune Responsiveness. J Immunol. 155, 1685-1693.

  21. De Togni, P., Goellner, J., Ruddle, N. H., Streeter, P. R., Fick, A., Mariathasan, S., Smith, S. C., Carlson, R., Shornick, L. P., and Strauss-Schoenberger, J. (1994) Abnormal Development of Peripheral Lymphoid Organs in Mice Deficient in Lymphotoxin. Science. 264, 703-707.

  22. Futterer, A., Mink, K., Luz, A., Kosco-Vilbois, M. H., and Pfeffer, K. (1998) The Lymphotoxin Beta Receptor Controls Organogenesis and Affinity Maturation in Peripheral Lymphoid Tissues. Immunity. 9, 59-70.

  23. Rennert, P. D., James, D., Mackay, F., Browning, J. L., and Hochman, P. S. (1998) Lymph Node Genesis is Induced by Signaling through the Lymphotoxin Beta Receptor. Immunity. 9, 71-79.

  24. Matsumoto, M., Mariathasan, S., Nahm, M. H., Baranyay, F., Peschon, J. J., and Chaplin, D. D. (1996) Role of Lymphotoxin and the Type I TNF Receptor in the Formation of Germinal Centers. Science. 271, 1289-1291.

  25. Kabashima, K., Banks, T. A., Ansel, K. M., Lu, T. T., Ware, C. F., and Cyster, J. G. (2005) Intrinsic Lymphotoxin-Beta Receptor Requirement for Homeostasis of Lymphoid Tissue Dendritic Cells. Immunity. 22, 439-450.

  26. Wang, Y. G., Kim, K. D., Wang, J., Yu, P., and Fu, Y. X. (2005) Stimulating Lymphotoxin Beta Receptor on the Dendritic Cells is Critical for their Homeostasis and Expansion. J Immunol. 175, 6997-7002.

  27. Chen, M. C., Hsu, T. L., Luh, T. Y., and Hsieh, S. L. (2000) Overexpression of Bcl-2 Enhances LIGHT- and Interferon-Gamma -Mediated Apoptosis in Hep3BT2 Cells. J Biol Chem. 275, 38794-38801.

  28. Lo, J. C., Wang, Y., Tumanov, A. V., Bamji, M., Yao, Z., Reardon, C. A., Getz, G. S., and Fu, Y. X. (2007) Lymphotoxin Beta Receptor-Dependent Control of Lipid Homeostasis. Science. 316, 285-288.

  29. Spahn, T. W., Maaser, C., Eckmann, L., Heidemann, J., Lugering, A., Newberry, R., Domschke, W., Herbst, H., and Kucharzik, T. (2004) The Lymphotoxin-Beta Receptor is Critical for Control of Murine Citrobacter Rodentium-Induced Colitis. Gastroenterology. 127, 1463-1473.

  30. Jungbeck, M., Stopfer, P., Bataille, F., Nedospasov, S. A., Mannel, D. N., and Hehlgans, T. (2008) Blocking Lymphotoxin Beta Receptor Signalling Exacerbates Acute DSS-Induced Intestinal Inflammation--Opposite Functions for Surface Lymphotoxin Expressed by T and B Lymphocytes. Mol Immunol. 45, 34-41.

  31. Ehlers, S., Holscher, C., Scheu, S., Tertilt, C., Hehlgans, T., Suwinski, J., Endres, R., and Pfeffer, K. (2003) The Lymphotoxin Beta Receptor is Critically Involved in Controlling Infections with the Intracellular Pathogens Mycobacterium Tuberculosis and Listeria Monocytogenes. J Immunol. 170, 5210-5218.

  32. Banks, T. A., Rickert, S., and Ware, C. F. (2006) Restoring Immune Defenses Via Lymphotoxin Signaling: Lessons from Cytomegalovirus. Immunol Res. 34, 243-254.

  33. Lucas, R., Tacchini-Cottier, F., Guler, R., Vesin, D., Jemelin, S., Olleros, M. L., Marchal, G., Browning, J. L., Vassalli, P., and Garcia, I. (1999) A Role for Lymphotoxin Beta Receptor in Host Defense Against Mycobacterium Bovis BCG Infection. Eur J Immunol. 29, 4002-4010.

  34. Kim, S. K., Lee, J. Y., Jeong Park, H., Chung, J. H., Suh, J. S., Hahn, W. H., Cho, B. S., and Kim, M. J. (2012) Association between Lymphotoxin Beta Receptor Gene Polymorphisms and IgA Nephropathy in Korean Children. Immunol Invest. 41, 447-457.

  35. Seymour, R., Sundberg, J. P., and Hogenesch, H. (2006) Abnormal Lymphoid Organ Development in Immunodeficient Mutant Mice. Vet Pathol. 43, 401-423.

  36. Elewaut, D., and Ware, C. F. (2007) The Unconventional Role of LT Alpha Beta in T Cell Differentiation. Trends Immunol. 28, 169-175.

  37. Togbe, D., de Sousa, P. L., Fauconnier, M., Boissay, V., Fick, L., Scheu, S., Pfeffer, K., Menard, R., Grau, G. E., Doan, B. T., Beloeil, J. C., Renia, L., Hansen, A. M., Ball, H. J., Hunt, N. H., Ryffel, B., and Quesniaux, V. F. (2008) Both Functional LTbeta Receptor and TNF Receptor 2 are Required for the Development of Experimental Cerebral Malaria. PLoS One. 3, e2608.

  38. Gommerman, J. L., and Browning, J. L. (2003) Lymphotoxin/light, Lymphoid Microenvironments and Autoimmune Disease. Nat Rev Immunol. 3, 642-655.

  39. Zindl, C. L., Kim, T. H., Zeng, M., Archambault, A. S., Grayson, M. H., Choi, K., Schreiber, R. D., and Chaplin, D. D. (2009) The Lymphotoxin LTalpha(1)Beta(2) Controls Postnatal and Adult Spleen Marginal Sinus Vascular Structure and Function. Immunity. 30, 408-420.

  40. Fu, Y. X., Huang, G., Wang, Y., and Chaplin, D. D. (1998) B Lymphocytes Induce the Formation of Follicular Dendritic Cell Clusters in a Lymphotoxin Alpha-Dependent Fashion. J Exp Med. 187, 1009-1018.

  41. Gonzalez, M., Mackay, F., Browning, J. L., Kosco-Vilbois, M. H., and Noelle, R. J. (1998) The Sequential Role of Lymphotoxin and B Cells in the Development of Splenic Follicles. J Exp Med. 187, 997-1007.