Phenotypic Mutation 'weg'

• Allele: weg
• Mutation Type: nonsense
• Chromosome: 18
• Coordinate: 20,713,708 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Dsg2
• Gene Name: desmoglein 2
• Synonym(s): D18Ertd293e
• Chromosomal Location: 20,691,131-20,737,578 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016] ; PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000057096] [ENSMUSP00000113153] [ENSMUSP00000113029]
• AlphaFold: O55111
• SMART Domains: Protein: ENSMUSP00000057096; Gene: ENSMUSG00000044393; AA Change: Y226*

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
CA	298	392	1.94e-8	SMART
CA	418	502	2.34e-16	SMART
transmembrane domain	618	640	N/A	INTRINSIC
low complexity region	822	838	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000113153; Gene: ENSMUSG00000044393; AA Change: Y226*

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
Pfam:Cadherin	282	347	6.9e-10	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000113029; Gene: ENSMUSG00000044393; AA Change: Y226*

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9648
• Is this an essential gene?: Probably nonessential (E-score: 0.202)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:38 PM by Anne Murray
• Record Created: 2017-09-26 12:41 PM by Bruce Beutler
• Record Posted: 2019-01-18
• Science Writers: Anne Murray
• Authors: Emre Turer, William McAlpine, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007883; MGI:1196466

Alleles Listed at MGI

All Mutations and Alleles(12) : Gene trapped(8) Targeted(4)

Phenotypic Description

Figure 1. Weg mice exhibited susceptibility to dextran sodium sulfate-induced colitis at 7 days after DSS treatment . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Weg mice exhibited susceptibility to dextran sodium sulfate-induced colitis at 10 days after DSS treatment . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The weg phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5503, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at days 7 (Figure 1) and 10 (Figure 2) after DSS treatment.

Nature of Mutation

Figure 3. Linkage mapping of the day 7 DSS phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 99 mutations (X-axis) identified in the G1 male of pedigree R5503. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 99 mutations. The DSS susceptibility phenotype wax linked by continuous variable mapping to mutations in three genes on chromosome 18: Dsg2, B4galt6, Trappc8. The mutation in Dsg2 was presumed causative because DSG2 has known functions in intestinal barrier maintenance. The Dsg2 mutation is a T to A transversion at base pair 20,580,651 (v38) on chromosome 18, or base pair 22,578 in the GenBank genomic region NC_000084 encoding DSG2. The strongest association was found with a recessive model of inheritance to the DSS day 7 phenotype, wherein five variant homozygotes departed phenotypically from 18 homozygous reference mice and 23 heterozygous mice with a P value of 1.339 x 10^-8 (Figure 3).  

The mutation corresponds to residue 889 in the mRNA sequence NM_007883 within exon 6 of 15 total exons.

872 GACACGGGGGAGATCTATACGACCAGTTTTACTTTG 221 -D--T--G--E--I--Y--T--T--S--F--T--L-

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 226 for a premature stop codon (Y226*) in the DSG2 protein.

Protein Prediction

Figure 4. Domain organization of DSG2. The weg mutation results in substitution of tyrosine 226 for a premature stop codon. Abbreviations: SP, signal peptide; PP, propeptide; EC, extracellular cadherin repeats; EA, extracellular anchor; TM, transmembrane domain; IA, intracellular anchor, ICS, intracellular cadherin-specific sequence; IPL, intracellular proline-rich linker; DSG, desmoglein repeat; DTD, desmoglein terminal domain. This image is interactive. Other mutations found in DSG2 are noted in red. Click on each mutation for more information.

DSG2 is a member of the desmoglein (DSG) family of cadherins. Dsg2 is part of the desmosomal cadherin gene cluster on chromosome 18. The mouse genome desmosomal cadherin gene cluster includes: Dsc3 (desmocollin 3)—Dsc2—Dsc1—Dsg1β (Dsg5)—Dsg1α—Dsg1γ (Dsg6)—Dsg4 (see the record for burrito)—Dsg3—Dsg2 (1).

DSG2 has a signal peptide, four N-terminal extracellular cadherin (EC) repeats, an extracellular anchor, a transmembrane domain, an intracellular anchor, an intracellular cadherin-specific sequence (ICS), a proline-rich linker region (IPL), six intracellular DSG repeat domains, and a DSG terminal domain (DTD) (Figure 4) (2).

Classical cadherins typically have five of EC repeats, a single transmembrane domain, and a conserved cytoplasmic domain that interacts with α- and β-catenin and connects a cadherin molecule to the actin cytoskeleton (3). EC repeats are defined by DRE, DXD, and DXNDNXPXF motifs. EC repeats mediate the Ca²⁺-dependent dimerization of cadherin molecules and the trans-extracellular linkages between cadherin dimers of two neighboring cells. Each EC repeat has four calcium binding motifs that together bind three calcium ions. Calcium binding facilitates linearization and rigidification of the cadherin ectodomain, prevents ectodomain unfolding, and promotes cadherin dimerization and consequent cell-cell adhesion (4-6). The overall 3D structure of the cadherin repeat motif is quite similar to the Greek-key topology of immunoglobulin domains with seven β-strands arranged as two opposing β-sheets with N- and C-termini at the opposite ends (3;5). The overall topology of the extracellular region is that of an elongated, curved structure of tandem EC domains connected by calcium-binding linker regions (7).

The intracellular domain of the DSG proteins binds to intermediate filaments via the adaptor proteins desmoplakin and plakoglobin (8). The function of the intracellular anchor sequence in DSG2 is unclear, but that sequence in DSC recruits plakoglobin and desmoplakin to the membrane as well as anchors intermediate filaments (9). The ICS domain mediates interacts between the desmosomal cadherins and catenin family members (e.g., plakoglobin). The region encompassing the IPL, DSG repeat domains, and the DTD is required for strong cell-cell adhesion as well as stabilization of DSG2 at the cell surface through the inhibition of DSG2 internalization (10). The specific functions of the IPL, DSG repeat domains, and DTD are unknown, but the DSG repeat domain putatively regulates homodimerization (11) and the DTD putatively mediates interactions with plakophilins (8).

DSG2 is palmitoylated at two cysteines in the juxtamembrane (intracellular anchor) domain (12). DSG2 palmitoylation promotes efficient DSG2 incorporation into junctions and trafficking to the cell surface. The EC1 and EC4 domains undergo N- and O-linked glycosylation, respectively (7). The functional significance of DSG2 glycosylation is unknown; the N-linked glycosylation does not regulate adhesive contacts.

The extracellular and intracellular regions of the DSG proteins are targeted by matrix metalloproteinases and cysteine proteases, respectively. ADAM10, ADAM17, and MMP9 promote the shedding of the ectodomain of DSG2 (13-15). In a colonic epithelial cell line, several DSG2 proteolytic products were identified, including a shed extracellular domain, a cell-associated extracellular domain-containing product, and fragments containing the DSG repeat domains and DTD (16). The DSG cleavage products regulate several processes, including apoptosis, tissue homeostasis, and differentiation (16-19).

The weg mutation results in substitution of tyrosine 226 for a premature stop codon (Y226*); Tyr226 is within the second EC repeat.

Expression/Localization

DSG2 is predominantly expressed in heart, intestine, epidermis, testis and epithelia (simple and complex) (1). DSG2 is also expressed on epithelial precursor cells and on immature hematopoietic progenitor cells from human bone marrow (20). In myeloid lineages, DSG2 is expressed on common myeloid progenitors (CD34⁺CD45^dimCD117⁺CD33⁺CD13⁺) and on pro-myelocytes. DSG2 is also expressed on pro-erythrocytes (CD34⁺CD45^dimCD117⁺CD71⁺CD235a⁻) and B cell lineage progenitors. DSG2 expression progressively decreased as differentiation progressed and was absent on all mature cell types in the bone marrow. DSG2 was also expressed on induced pluripotent stem (iPS) cells.

Dsg2 localizes to desmosomes.

Background

Figure 5. DSG2-specific desmosome structure. The components of the desmosome include DSG2, desmocollins, plakoglobin, plakophilins, and desmoplakin. Desmoplakin interacts with intermediate filaments, tethering the intermediate filaments to the plasma membrane.

Desmosomes are multiprotein complexes that link cadherin to the intermediate filament, providing structural support for tissues that undergo mechanical stress. The desmocollins (DSC1 to DSC3) and DSGs are the adhesion molecules of desmosomes, and are collectively known as desmosomal cadherins. Within desmosomes, the extracellular domains of DSCs and DSGs from neighboring cells form heterophilic interactions in the extracellular space, while intracellularly they are linked to plakoglobin, plakophilins, and desmoplakin (Figure 5).  Desmoplakin binds to keratin intermediate filaments, thereby tethering the intermediate filaments to the plasma membrane to physically strengthen the junction.

DSG2 has several known functions. (i) DSG2 promotes tight junction integrity in the intestine, which is required for intestinal epithelial barrier integrity (21). (ii) DSG2 regulates intestinal epithelial cell apoptosis during differentiation and inflammation by facilitating the removal of cells after cell-cell adhesion has been compromised (22). Exposure of the epithelium to the cleaved ectodomain of DSG2 resulted in compromised intercellular adhesion, but increased cellular proliferation to promote repair in the inflamed intestine (15). (iii) DSG2 functions in vasculogenic mimicry in melanoma (23). Vasculogenic mimicry is the formation of vascular networks directly by tumor cells, which promotes cancer growth and metastasis. DSG2 regulates tube formation by melanoma cells through promoting cell-cell adhesion, subsequently stabilizing and strengthening vasculogenic mimicry networks (23). (iv) DSG2 functions in cardiomyocyte cohesion and function (24).

Mutations in human DSG2 are associated with arrhythmogenic right ventricular dysplasia-10 [ARVD10; OMIM: #610193; (25-27)]. ARVD10 is a myocardial disease characterized by progressive fibrofatty replacement of the cardiac myocytes of the right ventricular wall, resulting in reentrant arrhythmias and sudden death. Mutations in DSG2 have also been linked to cases of dilated cardiomyopathy-1BB [OMIM: #612877; (28)].

DSG2 expression is reduced in the mucosa of patients with Crohn’s disease (29). In contrast, DSG2 is upregulated in several malignancies, including head and neck squamous cell carcinoma (30), prostate cancer (31;32), hepatocellular carcinoma (33), and melanoma (23). DSG2 overexpression predicts poor prognosis in the cancers. In pancreatic adenocarcinoma cells, loss of DSG2 expression results in loss of cell cohesion, increased migration, and invasion (34).

Dsg2-deficient mice exhibited embryonic lethality at implantation (35). Dsg2 hypomorph (Dsg2^lo/lo) mice expressing reduced amounts of DSG2 were overtly normal, viable, and fertile (20). However, the Dsg2^lo/lo mice showed enlarged hearts with fibrotic lesions. The Dsg2^lo/lo mice showed greater endothelial cell vascular wall widths compared to control mice. Bone marrow-derived endothelial cells from the Dsg2^lo/lo mice showed reduced formation of tube-like structures on Matrigel compared with bone marrow-derived endothelial cells from wild-type mice. Aortic rings from Dsg2^lo/lo mice produced significantly fewer vascular sprouts in response to VEGF compared to aortic rings from wild-type mice. Dsg2 mutant mice lacking a portion of the extracellular adhesive domain of DSG2 showed fibrotic lesions in the heart followed by ventricular dilation and premature death (36). Mice expressing a DSG2 mutant with deletion of the extracellular domain showed ventricular dilation, fibrosis, and arrhythmia (37). Conditional villin-Cre DSG2 knockout mice showed increased intestinal permeability, a wider desmosomal space, and alterations in desmosomal and tight junction components (38). Treatment of the conditional knockout mice with DSS resulted in susceptibility to colitis and increased intestinal epithelial barrier disruption (38). Cardiomyocyte-specific Dsg2 knockout mice showed progressive arrhythmogenic cardiomyopathy, chamber dilation, cardiomyocyte necrosis, and interstitial fibrosis (39). Transgenic mice overexpressing mutant DSG2 (Asn271Ser) in the heart showed intracellular space widening at the desomsomes/adherens junctions (intercalated disc), conduction slowing, and reduced sodium current density before cardiomyopathic changes (40).

Putative Mechanism

The intestinal epithelial barrier is maintained by a junctional complex consisting of tight junctions, adherens junctions, and desmosomes. Inflammatory bowel disease is marked by defects in permeability and alterations in  junction morphology. DSG2 has known functions in regulating the intestinal epithelial barrier. The phenotype of the weg mice is similar to that of the conditional villin-Cre DSG2 knockout mice (38), suggesting a loss of DSG2-mediated maintenance of tight junction/desmosome integrity of the intestinal epithelial barrier.

Primers

PCR Primer
weg_pcr_F: AAGAGTACTTACCTCAGATACCTTC
weg_pcr_R: ACTGCTCATATTCCAAGAGCTG

Sequencing Primer
weg_seq_F: CGTTCCTAATGGCAGATACACTTGTG
weg_seq_R: TGCTAGTAACTGCCATATTGGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 404 nucleotides is amplified (chromosome 18, + strand):

1   aagagtactt acctcagata ccttcgttcc taatggcaga tacacttgtg atgaaaatca
61  ccgccacaga tgcagatgac ccggagactc tgaatgctaa agtctcctac agaattgtct
121 ctcaggagcc tgcaaatagt catatgttct acctaaataa agacacgggg gagatctata
181 cgaccagttt tactttggac agagaggtaa gttaaggtca cctgtcactc tcttttctta
241 accctctcta gtttctccac tccctcgatt tttatgttct aattttaatt tgctctgtat
301 tcctcactca tggaataact ctaggaatta ttgtgtaggg atgtgctgcc caatatggca
361 gttactagca acatatgcta tccagctctt ggaatatgag cagt

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Whittock, N. V. (2003) Genomic Sequence Analysis of the Mouse Desmoglein Cluster Reveals Evidence for Six Distinct Genes: Characterization of Mouse DSG4, DSG5, and DSG6. J Invest Dermatol. 120, 970-980.

  2. Koch, P. J., Walsh, M. J., Schmelz, M., Goldschmidt, M. D., Zimbelmann, R., and Franke, W. W. (1990) Identification of Desmoglein, a Constitutive Desmosomal Glycoprotein, as a Member of the Cadherin Family of Cell Adhesion Molecules. Eur J Cell Biol. 53, 1-12.

  3. Pokutta, S., and Weis, W. I. (2007) Structure and Mechanism of Cadherins and Catenins in Cell-Cell Contacts. Annu Rev Cell Dev Biol. 23, 237-261.

  4. Di Palma, F., Pellegrino, R., and Noben-Trauth, K. (2001) Genomic Structure, Alternative Splice Forms and Normal and Mutant Alleles of Cadherin 23 (Cdh23). Gene. 281, 31-41.

  5. Elledge, H. M., Kazmierczak, P., Clark, P., Joseph, J. S., Kolatkar, A., Kuhn, P., and Muller, U. (2010) Structure of the N Terminus of Cadherin 23 Reveals a New Adhesion Mechanism for a Subset of Cadherin Superfamily Members. Proc Natl Acad Sci U S A. 107, 10708-10712.

  6. Sotomayor, M., Weihofen, W. A., Gaudet, R., and Corey, D. P. (2010) Structural Determinants of Cadherin-23 Function in Hearing and Deafness. Neuron. 66, 85-100.

  7. Harrison, O. J., Brasch, J., Lasso, G., Katsamba, P. S., Ahlsen, G., Honig, B., and Shapiro, L. (2016) Structural Basis of Adhesive Binding by Desmocollins and Desmogleins. Proc Natl Acad Sci U S A. 113, 7160-7165.

  8. Dusek, R. L., Godsel, L. M., and Green, K. J. (2007) Discriminating Roles of Desmosomal Cadherins: Beyond Desmosomal Adhesion. J Dermatol Sci. 45, 7-21.

  9. Troyanovsky, S. M., Troyanovsky, R. B., Eshkind, L. G., Leube, R. E., and Franke, W. W. (1994) Identification of Amino Acid Sequence Motifs in Desmocollin, a Desmosomal Glycoprotein, that are Required for Plakoglobin Binding and Plaque Formation. Proc Natl Acad Sci U S A. 91, 10790-10794.

  10. Chen, J., Nekrasova, O. E., Patel, D. M., Klessner, J. L., Godsel, L. M., Koetsier, J. L., Amargo, E. V., Desai, B. V., and Green, K. J. (2012) The C-Terminal Unique Region of Desmoglein 2 Inhibits its Internalization Via Tail-Tail Interactions. J Cell Biol. 199, 699-711.

  11. Rutman, A. J., Buxton, R. S., and Burdett, I. D. (1994) Visualisation by Electron Microscopy of the Unique Part of the Cytoplasmic Domain of a Desmoglein, a Cadherin-Like Protein of the Desmosome Type of Cell Junction. FEBS Lett. 353, 194-196.

  12. Roberts, B. J., Svoboda, R. A., Overmiller, A. M., Lewis, J. D., Kowalczyk, A. P., Mahoney, M. G., Johnson, K. R., and Wahl, J. K.,3rd. (2016) Palmitoylation of Desmoglein 2 is a Regulator of Assembly Dynamics and Protein Turnover. J Biol Chem. 291, 24857-24865.

  13. Klessner, J. L., Desai, B. V., Amargo, E. V., Getsios, S., and Green, K. J. (2009) EGFR and ADAMs Cooperate to Regulate Shedding and Endocytic Trafficking of the Desmosomal Cadherin Desmoglein 2. Mol Biol Cell. 20, 328-337.

  14. Bech-Serra, J. J., Santiago-Josefat, B., Esselens, C., Saftig, P., Baselga, J., Arribas, J., and Canals, F. (2006) Proteomic Identification of Desmoglein 2 and Activated Leukocyte Cell Adhesion Molecule as Substrates of ADAM17 and ADAM10 by Difference Gel Electrophoresis. Mol Cell Biol. 26, 5086-5095.

  15. Kamekura, R., Nava, P., Feng, M., Quiros, M., Nishio, H., Weber, D. A., Parkos, C. A., and Nusrat, A. (2015) Inflammation-Induced Desmoglein-2 Ectodomain Shedding Compromises the Mucosal Barrier. Mol Biol Cell. 26, 3165-3177.

  16. Kolegraff, K., Nava, P., Laur, O., Parkos, C. A., and Nusrat, A. (2011) Characterization of Full-Length and Proteolytic Cleavage Fragments of Desmoglein-2 in Native Human Colon and Colonic Epithelial Cell Lines. Cell Adh Migr. 5, 306-314.

  17. Getsios, S., Simpson, C. L., Kojima, S., Harmon, R., Sheu, L. J., Dusek, R. L., Cornwell, M., and Green, K. J. (2009) Desmoglein 1-Dependent Suppression of EGFR Signaling Promotes Epidermal Differentiation and Morphogenesis. J Cell Biol. 185, 1243-1258.

  18. Nava, P., Laukoetter, M. G., Hopkins, A. M., Laur, O., Gerner-Smidt, K., Green, K. J., Parkos, C. A., and Nusrat, A. (2007) Desmoglein-2: A Novel Regulator of Apoptosis in the Intestinal Epithelium. Mol Biol Cell. 18, 4565-4578.

  19. Yulis, M., Quiros, M., Hilgarth, R., Parkos, C. A., and Nusrat, A. (2018) Intracellular Desmoglein-2 Cleavage Sensitizes Epithelial Cells to Apoptosis in Response to Pro-Inflammatory Cytokines. Cell Death Dis. 9, 389-018-0380-9.

  20. Ebert, L. M., Tan, L. Y., Johan, M. Z., Min, K. K., Cockshell, M. P., Parham, K. A., Betterman, K. L., Szeto, P., Boyle, S., Silva, L., Peng, A., Zhang, Y., Ruszkiewicz, A., Zannettino, A. C., Gronthos, S., Koblar, S., Harvey, N. L., Lopez, A. F., Shackleton, M., and Bonder, C. S. (2016) A Non-Canonical Role for Desmoglein-2 in Endothelial Cells: Implications for Neoangiogenesis. Angiogenesis. 19, 463-486.

  21. Schlegel, N., Meir, M., Heupel, W. M., Holthofer, B., Leube, R. E., and Waschke, J. (2010) Desmoglein 2-Mediated Adhesion is Required for Intestinal Epithelial Barrier Integrity. Am J Physiol Gastrointest Liver Physiol. 298, G774-83.

  22. Nava, P., Laukoetter, M. G., Hopkins, A. M., Laur, O., Gerner-Smidt, K., Green, K. J., Parkos, C. A., and Nusrat, A. (2007) Desmoglein-2: A Novel Regulator of Apoptosis in the Intestinal Epithelium. Mol Biol Cell. 18, 4565-4578.

  23. Tan, L. Y., Mintoff, C., Johan, M. Z., Ebert, B. W., Fedele, C., Zhang, Y. F., Szeto, P., Sheppard, K. E., McArthur, G. A., Foster-Smith, E., Ruszkiewicz, A., Brown, M. P., Bonder, C. S., Shackleton, M., and Ebert, L. M. (2016) Desmoglein 2 Promotes Vasculogenic Mimicry in Melanoma and is Associated with Poor Clinical Outcome. Oncotarget. 7, 46492-46508.

  24. Schlipp, A., Schinner, C., Spindler, V., Vielmuth, F., Gehmlich, K., Syrris, P., Mckenna, W. J., Dendorfer, A., Hartlieb, E., and Waschke, J. (2014) Desmoglein-2 Interaction is Crucial for Cardiomyocyte Cohesion and Function. Cardiovasc Res. 104, 245-257.

  25. Pilichou, K., Nava, A., Basso, C., Beffagna, G., Bauce, B., Lorenzon, A., Frigo, G., Vettori, A., Valente, M., Towbin, J., Thiene, G., Danieli, G. A., and Rampazzo, A. (2006) Mutations in Desmoglein-2 Gene are Associated with Arrhythmogenic Right Ventricular Cardiomyopathy. Circulation. 113, 1171-1179.

  26. Awad, M. M., Dalal, D., Cho, E., Amat-Alarcon, N., James, C., Tichnell, C., Tucker, A., Russell, S. D., Bluemke, D. A., Dietz, H. C., Calkins, H., and Judge, D. P. (2006) DSG2 Mutations Contribute to Arrhythmogenic Right Ventricular dysplasia/cardiomyopathy. Am J Hum Genet. 79, 136-142.

  27. Syrris, P., Ward, D., Asimaki, A., Evans, A., Sen-Chowdhry, S., Hughes, S. E., and McKenna, W. J. (2007) Desmoglein-2 Mutations in Arrhythmogenic Right Ventricular Cardiomyopathy: A Genotype-Phenotype Characterization of Familial Disease. Eur Heart J. 28, 581-588.

  28. Posch, M. G., Posch, M. J., Geier, C., Erdmann, B., Mueller, W., Richter, A., Ruppert, V., Pankuweit, S., Maisch, B., Perrot, A., Buttgereit, J., Dietz, R., Haverkamp, W., and Ozcelik, C. (2008) A Missense Variant in Desmoglein-2 Predisposes to Dilated Cardiomyopathy. Mol Genet Metab. 95, 74-80.

  29. Spindler, V., Meir, M., Vigh, B., Flemming, S., Hutz, K., Germer, C. T., Waschke, J., and Schlegel, N. (2015) Loss of Desmoglein 2 Contributes to the Pathogenesis of Crohn's Disease. Inflamm Bowel Dis. 21, 2349-2359.

  30. Overmiller, A. M., Pierluissi, J. A., Wermuth, P. J., Sauma, S., Martinez-Outschoorn, U., Tuluc, M., Luginbuhl, A., Curry, J., Harshyne, L. A., Wahl, J. K.,3rd, South, A. P., and Mahoney, M. G. (2017) Desmoglein 2 Modulates Extracellular Vesicle Release from Squamous Cell Carcinoma Keratinocytes. FASEB J. 31, 3412-3424.

  31. Barber, A. G., Castillo-Martin, M., Bonal, D. M., Rybicki, B. A., Christiano, A. M., and Cordon-Cardo, C. (2014) Characterization of Desmoglein Expression in the Normal Prostatic Gland. Desmoglein 2 is an Independent Prognostic Factor for Aggressive Prostate Cancer. PLoS One. 9, e98786.

  32. Brennan, D., and Mahoney, M. G. (2009) Increased Expression of Dsg2 in Malignant Skin Carcinomas: A Tissue-Microarray Based Study. Cell Adh Migr. 3, 148-154.

  33. Han, C. P., Yu, Y. H., Wang, A. G., Tian, Y., Zhang, H. T., Zheng, Z. M., and Liu, Y. S. (2018) Desmoglein-2 Overexpression Predicts Poor Prognosis in Hepatocellular Carcinoma Patients. Eur Rev Med Pharmacol Sci. 22, 5481-5489.

  34. Hutz, K., Zeiler, J., Sachs, L., Ormanns, S., and Spindler, V. (2017) Loss of Desmoglein 2 Promotes Tumorigenic Behavior in Pancreatic Cancer Cells. Mol Carcinog. 56, 1884-1895.

  35. Eshkind, L., Tian, Q., Schmidt, A., Franke, W. W., Windoffer, R., and Leube, R. E. (2002) Loss of Desmoglein 2 Suggests Essential Functions for Early Embryonic Development and Proliferation of Embryonal Stem Cells. Eur J Cell Biol. 81, 592-598.

  36. Krusche, C. A., Holthofer, B., Hofe, V., van de Sandt, A. M., Eshkind, L., Bockamp, E., Merx, M. W., Kant, S., Windoffer, R., and Leube, R. E. (2011) Desmoglein 2 Mutant Mice Develop Cardiac Fibrosis and Dilation. Basic Res Cardiol. 106, 617-633.

  37. Kant, S., Krull, P., Eisner, S., Leube, R. E., and Krusche, C. A. (2012) Histological and Ultrastructural Abnormalities in Murine Desmoglein 2-Mutant Hearts. Cell Tissue Res. 348, 249-259.

  38. Gross, A., Pack, L. A. P., Schacht, G. M., Kant, S., Ungewiss, H., Meir, M., Schlegel, N., Preisinger, C., Boor, P., Guldiken, N., Krusche, C. A., Sellge, G., Trautwein, C., Waschke, J., Heuser, A., Leube, R. E., and Strnad, P. (2018) Desmoglein 2, but Not Desmocollin 2, Protects Intestinal Epithelia from Injury. Mucosal Immunol. .

  39. Kant, S., Holthofer, B., Magin, T. M., Krusche, C. A., and Leube, R. E. (2015) Desmoglein 2-Dependent Arrhythmogenic Cardiomyopathy is Caused by a Loss of Adhesive Function. Circ Cardiovasc Genet. 8, 553-563.

  40. Rizzo, S., Lodder, E. M., Verkerk, A. O., Wolswinkel, R., Beekman, L., Pilichou, K., Basso, C., Remme, C. A., Thiene, G., and Bezzina, C. R. (2012) Intercalated Disc Abnormalities, Reduced Na(+) Current Density, and Conduction Slowing in Desmoglein-2 Mutant Mice Prior to Cardiomyopathic Changes. Cardiovasc Res. 95, 409-418.