Phenotypic Mutation 'sheer'

• Allele: sheer
• Mutation Type: critical splice donor site
• Chromosome: 18
• Coordinate: 38,029,146 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Diaph1
• Gene Name: diaphanous related formin 1
• Synonym(s): p140mDia, Dia1, mDia1, D18Wsu154e, Diap1, Drf1
• Chromosomal Location: 37,976,654-38,068,529 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016] ; PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000025337 ^†] [ENSMUSP00000078942 ^†] [ENSMUSP00000111292 ^†] [ENSMUSP00000111294 ^†] [ENSMUSP00000111297 ^†] † probably from a misspliced transcript
• AlphaFold: O08808
• SMART Domains: Protein: ENSMUSP00000025337; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Drf_GBD	84	268	1.07e-57	SMART
Drf_FH3	274	466	2.06e-68	SMART
coiled coil region	471	571	N/A	INTRINSIC
Pfam:Drf_FH1	609	756	6.1e-43	PFAM
FH2	761	1206	2.46e-182	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000025337; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Drf_GBD	84	268	1.07e-57	SMART
Drf_FH3	274	466	2.06e-68	SMART
coiled coil region	471	571	N/A	INTRINSIC
Pfam:Drf_FH1	609	756	6.1e-43	PFAM
FH2	761	1206	2.46e-182	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000078942; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Drf_GBD	75	259	1.07e-57	SMART
Drf_FH3	265	457	2.06e-68	SMART
coiled coil region	462	562	N/A	INTRINSIC
Pfam:Drf_FH1	589	747	7.9e-52	PFAM
FH2	752	1197	3.73e-182	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000078942; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Drf_GBD	75	259	1.07e-57	SMART
Drf_FH3	265	457	2.06e-68	SMART
coiled coil region	462	562	N/A	INTRINSIC
Pfam:Drf_FH1	589	747	7.9e-52	PFAM
FH2	752	1197	3.73e-182	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000111292; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
Drf_GBD	40	224	1.07e-57	SMART
Drf_FH3	230	422	2.06e-68	SMART
coiled coil region	427	527	N/A	INTRINSIC
Pfam:Drf_FH1	554	712	7.6e-52	PFAM
FH2	717	1162	3.73e-182	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000111292; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
Drf_GBD	40	224	1.07e-57	SMART
Drf_FH3	230	422	2.06e-68	SMART
coiled coil region	427	527	N/A	INTRINSIC
Pfam:Drf_FH1	554	712	7.6e-52	PFAM
FH2	717	1162	3.73e-182	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000111294; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
Drf_GBD	40	224	1.07e-57	SMART
Drf_FH3	230	422	2.06e-68	SMART
coiled coil region	427	527	N/A	INTRINSIC
Pfam:Drf_FH1	554	712	1.1e-51	PFAM
FH2	717	1162	2.46e-182	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000111294; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
Drf_GBD	40	224	1.07e-57	SMART
Drf_FH3	230	422	2.06e-68	SMART
coiled coil region	427	527	N/A	INTRINSIC
Pfam:Drf_FH1	554	712	1.1e-51	PFAM
FH2	717	1162	2.46e-182	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000111297; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Drf_GBD	75	259	1.07e-57	SMART
Drf_FH3	265	457	2.06e-68	SMART
coiled coil region	462	562	N/A	INTRINSIC
Pfam:Drf_FH1	589	747	9.4e-52	PFAM
FH2	752	1197	2.46e-182	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000111297; Gene: ENSMUSG00000024456

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Drf_GBD	75	259	1.07e-57	SMART
Drf_FH3	265	457	2.06e-68	SMART
coiled coil region	462	562	N/A	INTRINSIC
Pfam:Drf_FH1	589	747	9.4e-52	PFAM
FH2	752	1197	2.46e-182	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.0878
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:38 PM by Diantha La Vine
• Record Created: 2017-10-06 2:05 PM by Bruce Beutler
• Record Posted: 2018-01-12
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001305980 (variant 1), NM_007858 (variant 2), NM_001305981 (variant 3); MGI:1194490

Alleles Listed at MGI

All Mutations and Alleles(112) : Gene trapped(107) Targeted(5)

Phenotypic Description

Figure 1. Sheer mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sheer mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sheer phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5623, some of which showed reduced frequencies of T cells (Figure 1) and CD8+ T cells (Figure 2) in the peripheral blood.

Nature of Mutation

Figure 3. Linkage mapping of the CD8+ T cell phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 82 mutations (X-axis) identified in the G1 male of pedigree R5623. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 82 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Diaph1: a T to A transversion at base pair 37,896,093 (v38) on chromosome 18, or base pair 39,542 in the GenBank genomic region NC_000084 within the donor splice site of intron 11. The strongest association was found with a recessive model of inheritance to the normalized CD8+ T cell frequency phenotype, wherein four variant homozygotes and 16 heterozygous mice departed phenotypically from 20 homozygous reference mice with a P value of 0.000185 (Figure 3). 

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 119-nucleotide exon 11 (out of 28 total exons). Skipping of exon 11 would cause a frame-shifted protein product after amino acid 348 and premature termination after amino acid 348.

<--exon 10    <--exon 11 intron 11-->      exon 12-->     ……CAGGTGTTGCAG ……ATGGAGATGGA atatccttttatgac…… TGACTTTGGTGA…… 345 ……-Q--V--L--Q- ……-M--E--M--D                   -*-         correct        deleted                     aberrant

The donor splice site of intron 11, which is destroyed by the Sheer mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 4. Domain and crystal structure of mDia1. (A) Dia consists of the formin homology domains 1 and 2 (FH1, FH2), Rho-binding domain (RBD), a Dia inhibitory domain (DID), dimerization domain (DD), a predicted coiled-coil region (CC) and a dia autoregulatory domain (DAD). The DID, DD, and CC are also referred to as FH3. The location of the sheer mutation is indicated. This image is interactive; click to view other mutations in Diaph1. (B) Crystal structure of the tetrameric N+C mDia1 complex. Selected domains and subdomains are labeled. The crystal structure was generated by UCSF Chimera and is modeled after PDB:3O4X and Nezami et al (2010). Click to rotate the crystal structure.

Diaph1 encodes mammalian diaphanous-related formin 1 (mDia1; alternatively, mDia or Drf1), a member of the mDia family of formins that is ubiquitously expressed. mDia1 has several domains, including a GTPase-binding domain (GBD), a formin homology 3 (FH3; alternatively, diaphanous inhibitory domain [DID]) domain, a dimerization domain (DD), a coiled-coil, a FH1 domain, a FH2 domain and a diaphanous autoregulatory domain (DAD) (Figure 4). The sheer mutation in intron 11 is predicted to result in skipping of the 119-nucleotide exon 11 and premature termination at amino acid 348, which is within the FH3/DID domain. The GBD and FH3 domains bind to the DAD domain to keep mDia1 in an inactive conformation (1;2).

For more information about Diaph1, please see the record for Guangzhou.

Putative Mechanism

The formins are Rho effectors that direct actin assembly in several processes, such as cytokinesis, cell migration, and establishment and maintenance of cell polarity. mDia1 specifically functions in actin assembly, stress fiber and filopodia formation, phagocytosis, activation of serum response factor, and formation of adherens juctions. mDia1 has several functions in actin assembly, including regulating de novo nucleation, the rate of filament elongation, and filament growth duration before capping (3).

Segregation of T and B cells in the spleen and lymph nodes were normal in the Diaph1^-/- mice, but the frequencies of both CD4 and CD8 T cells in the spleen and lymph nodes were reduced compared to wild-type mice. The frequencies of B cells, CD11c+ dendritic cells, and CD11b+ dendritic cells were not changed. The number of T cells was reduced in the peripheral blood; however, the numbers of CD4⁻CD8⁻, CD4⁺CD8⁺, CD4⁺CD8⁻, and CD4⁻CD8⁺ T cells in the thymus were similar to that in wild-type mice. The numbers of CD69^loCD62L^hi CD4 or CD8 single-positive T cells was higher indicating that there was an impaired egression of mature T cells from the thymus in the Diaph1^-/- mice. With age (greater than postnatal day 300), the Diaph1^-/ mice often developed dermatoses and/or alopecia (4). In addition, the Diaph1^-/ mice developed splenomegaly, fibrotic and hypercellular bone marrow, extramedullary hematopoiesis in both spleen and liver. Also, the Diaph1^-/ mice had immature myeloid progenitor cells with high nucleus-to-cytoplasm ratios. The immune phenotypes observed in the sheer mice indicate that mDia1^sheer exhibits loss of function.

Primers

PCR Primer
sheer_pcr_F: CTAGCTTTCCTAGTCTATGCTGAAG
sheer_pcr_R: CACTAGGTGGAAAGGCTTGG

Sequencing Primer
sheer_seq_F: CTGGCCTGGAGTTCACTATGAAAAC
sheer_seq_R: GGATTTGGGTTCTCTCACCAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 536 nucleotides is amplified (chromosome 18, - strand):

1   cactaggtgg aaaggcttgg atttgggttc tctcaccact tctgtgattg acaggagctt
61  cgagagattg aaaatgaaga tatgaaagta cagctgtgcg tgtttgatga acaaggggat
121 gaagatttct ttgatctgaa gggacggctg gatgatatcc gcatggagat ggaatatcct
181 tttatgactg atgattgagt tcaagacagg cggtgcattt acttatagac tgaatgtatg
241 gaatagtgtg gagagtgacg acttagagta gggcatagga ctgggagtag tggcactgcc
301 ttgagtttgt ctcctagcac tcaggaggca gacaggatct cttctgagtt tgatgccagc
361 ctggttttca tagtgaactc caggccagct aaggctatac agtgagtctg tcgcaaaaaa
421 aaaaaaaaaa aaatatatat atatatatat gtatatacat atacatatac atatatatat
481 tttacataaa taaagctgtt gtctttattt acttcagcat agactaggaa agctag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Rose, R., Weyand, M., Lammers, M., Ishizaki, T., Ahmadian, M. R., and Wittinghofer, A. (2005) Structural and Mechanistic Insights into the Interaction between Rho and Mammalian Dia. Nature. 435, 513-518.

  2. Li, F., and Higgs, H. N. (2003) The Mouse Formin mDia1 is a Potent Actin Nucleation Factor Regulated by Autoinhibition. Curr Biol. 13, 1335-1340.

  3. Bugyi, B., Papp, G., Hild, G., Lorinczy, D., Nevalainen, E. M., Lappalainen, P., Somogyi, B., and Nyitrai, M. (2006) Formins Regulate Actin Filament Flexibility through Long Range Allosteric Interactions. J Biol Chem. 281, 10727-10736.

  4. Peng, J., Kitchen, S. M., West, R. A., Sigler, R., Eisenmann, K. M., and Alberts, A. S. (2007) Myeloproliferative Defects Following Targeting of the Drf1 Gene Encoding the Mammalian Diaphanous Related Formin mDia1. Cancer Res. 67, 7565-7571.