Phenotypic Mutation 'angie'

• Allele: angie
• Mutation Type: missense
• Chromosome: 14
• Coordinate: 70,805,273 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Hr
• Gene Name: lysine demethylase and nuclear receptor corepressor
• Synonym(s): rh-bmh, rh, N, bldy, ba
• Chromosomal Location: 70,789,652-70,810,988 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014] ; PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000022691] [ENSMUSP00000124816] [ENSMUSP00000124042]
• AlphaFold: Q61645
• SMART Domains: Protein: ENSMUSP00000022691; Gene: ENSMUSG00000022096; AA Change: D1005G

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000022691)
• SMART Domains: Protein: ENSMUSP00000124816; Gene: ENSMUSG00000022096; AA Change: D1005G

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000161069)
• SMART Domains: Protein: ENSMUSP00000124042; Gene: ENSMUSG00000022096; AA Change: D1034G

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Blast:JmjC	83	878	N/A	BLAST
JmjC	968	1179	5.23e-38	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
  (Using ENSMUST00000163060)
• Meta Mutation Damage Score: 0.8539
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:38 PM by Anne Murray
• Record Created: 2018-01-08 7:55 AM by Brittney Roy
• Record Posted: 2018-03-07
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Brittney Roy, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM­_021877; MGI: 96223

Alleles Listed at MGI

All Mutations and Alleles(33) : Chemically induced (ENU)(10) Chemically induced (other)(1) Spontaneous(17) Targeted(3) Transgenic(2)

Phenotypic Description

Figure 1. Representative images of angie mice.

Figure 2. Angie mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Angie mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Angie mice exhibit increased CD44 expression on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The angie phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R6000, some of which showed variable hair loss (Figure 1). Some mice also showed reduced frequencies of B cells (Figure 2) and increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 3) in the peripheral blood. CD44 expression was increased on peripheral blood CD8+ T cells (Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of increased peripheral central memory CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R0304. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations on chromosome 14: Gucy1b2 and Hr. The mutation in Hr was presumed to be causative because the angie hair loss phenotype mimics other known alleles of Hr (see MGI for a list of Hr alleles as well as the entries for prune, Kaburo, and mister_clean). The Hr mutation is an A to G transition at base pair 70,567,833 (v38) on chromosome 14, or base pair 13,778 in the GenBank genomic region NC_000080 encoding Hr. The mutation corresponds to residue 3,708 in the mRNA sequence NM_021877 within exon 16 of 20 total exons. The strongest association was found with a recessive model of inheritance to the normalized frequency of central memory CD8 T cells in CD8 T cells, wherein three variant homozygotes departed phenotypically from 16 homozygous reference mice and 23 heterozygous mice with a P value of 2.491 x 10^-9 (Figure 5).  

3692 TGCGTGGAGGTGTCTGACCTAATCAGTATCCTG 1000 -C--V--E--V--S--D--L--I--S--I--L-

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at position 1,005 (D1005G) in the HR protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.973).

The causative mutation for the immune phenotypes was validated to be in Hr by CRISPR/Cas9-mediated targeting of Hr (Table 1).

Table 1. CRISPR/Cas9 results

Screen	p-value
FACS B cells	3.002 x 10-34
FACS CD44+ CD8 MFI	4.32 x 10-8
FACS central memory CD8 T cells in CD8 T cells	2.863 x 10-18

Protein Prediction

Figure 6. HR functional domains. The N-terminal domain varies between the two isoforms of HR; only the longer isoform is shown. The position of the angie mutation is indiated in red and results in an aspartic acid to glycine substitution at position 1,005. NMTS, nuclear matrix targeting signal; RD, repression domain; NLS, nuclear localization signal; ID, interacting domain; ZF, zinc finger domain; ROR, retinoic acid receptor related orphan receptor; TR, thyroid hormone receptor. Click on the image to view other mutations found in HR. Click on each mutation for more specific information.

The mouse HR protein contains 1211 amino acids (a shorter 1182 amino acid isoform differs only at the N-terminus) (Figure 6). The HR protein contains a potential DNA-binding zinc finger domain consisting of a highly conserved six cysteine motif located within a loop region at amino acids 585-620 (for mouse HR). A novel bipartite nuclear localization signal (NLS) was identified at amino acids 409-427 consisting of the sequence KRA(X13)PKR (1). A novel nuclear matrix targeting signal (NMTS) at amino acids 111-156 is also necessary for its nuclear sub-localization (2). Repressive domains (RD) are located at amino acids 210-423 (RD1), 725-839 (RD2), and 839-956 (RD3). The RD2 domain contains regions that interact with the thyroid hormone receptor (TR), the retinoic acid receptor related orphan receptor α (RORα) and the vitamin D receptor (VDR) (3-5).  Domains that have been shown to interact with TR are located at amino acids 792-805 (TR-ID1 for TR interacting domain 1) and amino acids 1001-1013 (TR-ID2) (3). RORα-interacting domains (ROR-ID) are located at amino acids 561-565 and 753-757 (4). HR contains two LXXLL motifs known as nuclear receptor (NR) boxes that are present in nuclear receptor coactivators, and are known to interact with the α-helical AF-2 motif present in the ligand binding domain (LBD) of nuclear receptors (1;6). The HR protein also contains a JmjC domain at amino acids 968-1179. The angie mutation results in an aspartic acid to glycine substitution at position 1,005 (D1005G) in the JmjC domain.

Please see the record for prune for more information about hairless.

Putative Mechanism

HR is a nuclear receptor corepressor that is thought to regulate hair cell cycling by interacting with and repressing nuclear hormone receptors to control gene expression. Mutations and deletions at the C-terminus of human HR can cause Alopecia Universalis Congenita [(7); OMIM: #203655], atrichia with popular lesions [(8-10); OMIM: #209500], and/or hypotrichosis 4 (OMIM: #146550). Patients with these conditions are normally born with hair that subsequently falls out resulting in a complete or nearly complete absence of all hair. In the mouse, the classical hairless (hr) and rhino (hr^rh) homozygous mutants with mutations in the hr gene develop a normal first coat, but do not reinitiate subsequent hair cycles resulting in alopecia (11-13). Histologically, the skin of hairless and rhino mice are normal until the first hair cycle is nearly complete. Just before the normal loss of the first coat, the hair follicles of these mutants appear altered. As the mutant animals age there is hypertrophy of the sebaceous glands, loss of adipose tissue, and the development of various types of cysts from the hyperkeratotic upper part of the hair canals, and the sheaths of the abnormal follicles stranded in the dermis (13-15). Toward the end of HF morphogenesis, the proximal hair bulb undergoes premature and massive apoptosis associated with a lack of coordination of cell proliferation in defined HF compartments (14). Although the hair follicle defects in both hairless and rhino mutants are similar, animals homozygous for rhino alleles also develop thickened and severely wrinkled skin (12). The angie phenotype mirrored other phenotypes attributed to mutations in Hr (see prune, Kaburo, and mister_clean as well as alleles listed at MGI), indicating loss of HR function.

Primers

PCR Primer
angie_pcr_F: CCTATGGTGAGTGCCTTTCCAC
angie_pcr_R: GGAACACATGCCACACAGTG

Sequencing Primer
angie_seq_F: TGTCCACCCCACACCTCTG
angie_seq_R: ATGCCACACAGTGCTGGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 425 nucleotides is amplified (chromosome 14, + strand):

1   cctatggtga gtgcctttcc actcctgtcc accccacacc tctgcctcac ctaccatctt
61  aggacacatg cgcctctgtg cctaggtttg ggagccgaga atacatttct tatttaactt
121 ccaaatgttc ttcctttacc tacacatagg tgtgaactca caccgtggac acctggggac
181 caagaatcta tgcgtggagg tgtctgacct aatcagtatc ctggtgcacg ccgaggccca
241 gctgcctccc tggtatcgag cacagaaagg tgggtccttg gccagtcaag cagtcgctga
301 tgtctgcctc tgcctaccct gggctcacct gagccatttt tctcctgcag atttcctctc
361 aggcctggat ggggaaggac tctggtctcc agggagccag accagcactg tgtggcatgt
421 gttcc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Djabali, K., Aita, V. M., and Christiano, A. M. (2001) Hairless is Translocated to the Nucleus Via a Novel Bipartite Nuclear Localization Signal and is Associated with the Nuclear Matrix. J Cell Sci. 114, 367-376.

  2. Djabali, K., and Christiano, A. M. (2004) Hairless Contains a Novel Nuclear Matrix Targeting Signal and Associates with Histone Deacetylase 3 in Nuclear Speckles. Differentiation. 72, 410-418.

  3. Potter, G. B., Beaudoin, G. M.,3rd, DeRenzo, C. L., Zarach, J. M., Chen, S. H., and Thompson, C. C. (2001) The Hairless Gene Mutated in Congenital Hair Loss Disorders Encodes a Novel Nuclear Receptor Corepressor. Genes Dev. 15, 2687-2701.

  4. Moraitis, A. N., Giguere, V., and Thompson, C. C. (2002) Novel Mechanism of Nuclear Receptor Corepressor Interaction Dictated by Activation Function 2 Helix Determinants. Mol Cell Biol. 22, 6831-6841.

  5. Hsieh, J. C., Sisk, J. M., Jurutka, P. W., Haussler, C. A., Slater, S. A., Haussler, M. R., and Thompson, C. C. (2003) Physical and Functional Interaction between the Vitamin D Receptor and Hairless Corepressor, Two Proteins Required for Hair Cycling. J Biol Chem. 278, 38665-38674.

  6. Glass, C. K., Rose, D. W., and Rosenfeld, M. G. (1997) Nuclear Receptor Coactivators. Curr Opin Cell Biol. 9, 222-232.

  7. Cichon, S., Anker, M., Vogt, I. R., Rohleder, H., Putzstuck, M., Hillmer, A., Farooq, S. A., Al-Dhafri, K. S., Ahmad, M., Haque, S., Rietschel, M., Propping, P., Kruse, R., and Nothen, M. M. (1998) Cloning, Genomic Organization, Alternative Transcripts and Mutational Analysis of the Gene Responsible for Autosomal Recessive Universal Congenital Alopecia. Hum Mol Genet. 7, 1671-1679.

  8. Sprecher, E., Bergman, R., Szargel, R., Friedman-Birnbaum, R., and Cohen, N. (1999) Identification of a Genetic Defect in the Hairless Gene in Atrichia with Papular Lesions: Evidence for Phenotypic Heterogeneity among Inherited Atrichias. Am J Hum Genet. 64, 1323-1329.

  9. Zlotogorski, A., Ahmad, W., and Christiano, A. M. (1998) Congenital Atrichia in Five Arab Palestinian Families Resulting from a Deletion Mutation in the Human Hairless Gene. Hum Genet. 103, 400-404.

  10. Henn, W., Zlotogorski, A., Lam, H., Martinez-Mir, A., Zaun, H., and Christiano, A. M. (2002) Atrichia with Papular Lesions Resulting from Compound Heterozygous Mutations in the Hairless Gene: A Lesson for Differential Diagnosis of Alopecia Universalis. J Am Acad Dermatol. 47, 519-523.

  11. Cachon-Gonzalez, M. B., Fenner, S., Coffin, J. M., Moran, C., Best, S., and Stoye, J. P. (1994) Structure and Expression of the Hairless Gene of Mice. Proc Natl Acad Sci U S A. 91, 7717-7721.

  12. Cachon-Gonzalez, M. B., San-Jose, I., Cano, A., Vega, J. A., Garcia, N., Freeman, T., Schimmang, T., and Stoye, J. P. (1999) The Hairless Gene of the Mouse: Relationship of Phenotypic Effects with Expression Profile and Genotype. Dev Dyn. 216, 113-126.

  13. Panteleyev, A. A., Paus, R., Ahmad, W., Sundberg, J. P., and Christiano, A. M. (1998) Molecular and Functional Aspects of the Hairless (Hr) Gene in Laboratory Rodents and Humans. Exp Dermatol. 7, 249-267.

  14. Panteleyev, A. A., Botchkareva, N. V., Sundberg, J. P., Christiano, A. M., and Paus, R. (1999) The Role of the Hairless (Hr) Gene in the Regulation of Hair Follicle Catagen Transformation. Am J Pathol. 155, 159-171.

  15. Zarach, J. M., Beaudoin, G. M.,III, Coulombe, P. A., and Thompson, C. C. (2004) The Co-Repressor Hairless has a Role in Epithelial Cell Differentiation in the Skin. Development. 131, 4189-4200.