Phenotypic Mutation 'homer'

• Allele: homer
• Mutation Type: nonsense
• Chromosome: 9
• Coordinate: 96,022,709 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Gk5
• Gene Name: glycerol kinase 5
• Synonym(s): G630067D24Rik, C330018K18Rik
• Chromosomal Location: 96,001,415-96,066,661 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygous knockout does not result in an obvious skin phenotype and does not lead to alopecia. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000082313] [ENSMUSP00000112717] [ENSMUSP00000123594]
• AlphaFold: Q8BX05
• SMART Domains: Protein: ENSMUSP00000082313; Gene: ENSMUSG00000041440; AA Change: Q182*

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
Pfam:FGGY_N	25	287	9e-50	PFAM
Pfam:FGGY_C	296	485	7.7e-35	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000112717; Gene: ENSMUSG00000041440; AA Change: Q182*

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
Pfam:FGGY_N	25	287	1.9e-49	PFAM
Pfam:FGGY_C	296	485	1.8e-35	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000123594; Gene: ENSMUSG00000041440

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
SCOP:d1bu6o1	24	56	1e-5	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:38 PM by Anne Murray
• Record Created: 2018-01-09 1:07 PM by Jamie Russell
• Record Posted: 2018-04-11
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Lauren Prince, Duanwu Zhang, Jamie Russell, Xue Zhong, and Bruce Beutler

Accession Number

NCBI Refseq: NM_177352.4; MGI: 2443336

Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (other)(1) Gene trapped(17) Targeted(2)

Phenotypic Description

Figure 1. Homer mice showed hair loss.

Figure 2. Homer mice exhibit increased frequencies of peripheral CD44+ CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homer mice exhibit increased frequencies of central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Homer mice exhibit increased expression of CD44 on peripheral blood CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The homer phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5643, some of which showed hair loss (Figure 1). Some mice also showed increased frequencies of CD44+ CD8 T cells (Figure 2), and central memory CD8 T cells in CD8 T cells (Figure 3) in the peripheral blood as well as increased expression of CD44 on peripheral blood CD8 T cells (Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of the hair loss phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 111 mutations (X-axis) identified in the G1 male of pedigree R5643. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 111 mutations. All of the above anomalies were linked to a mutation in Gk5: a C to T transition at base pair 96,140,656 (v38) on chromosome 9, or base pair 21,313 in the GenBank genomic region NC_000075. The strongest association was found with a recessive model of inheritance to the hair loss phenotype (P = 5.939 x 10^-9), wherein 10 affected mice were homozygous (N = 9) for the variant allele (genotyping failed for one affected mouse at all sites tested), and 34 unaffected mice were either heterozygous (N = 13) or homozygous for the reference allele (N = 21) (Figure 5).  

The mutation corresponds to residue 566 in the mRNA sequence NM_177352.4 within exon 5 of 17 total exons.

551 TTGACCTGGATTTTACAAAACCTATCTGAGGTG 177 -L--T--W--I--L--Q--N--L--S--E--V-

The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine 182 for a premature stop codon (Q182*) in the GK5 protein.

Protein Prediction

Figure 6. Domain organization of GK5. The location of the homer mutation is indicated. Domain information is from SMART and UniProt. Additional mutations in GK5 are noted. Click on each mutation to view more information.

The glycerol kinase 5 (putative) (Gk5) gene encodes the 534 amino acid (aa) GK5 protein. The protein domains and function of GK5 have not been documented. SMART predicts that this uncharacterized protein contains two domains that are found in the FGGY family of carbohydrate kinases. The FGGY kinases contain conserved motifs at both the N- and C-termini (Figure 6; aa 25-287 and aa 396-416 in GK5, respectively; SMART). The FGGY_N and FGGY_C termini are structurally similar and adopt a ribonuclease H-like fold (1;2). Between the FGGY_N and FGGY_C domains is a catalytic cleft where the sugar substrate and ATP bind (3).  The mutation results in substitution of glutamine 182 for a premature stop codon (Q182*) in the GK5 protein; amino acid 182 is within the FGGY_N domain.

For more information about Gk5, please see the entry for toku.

Putative Mechanism

The over 4,000 members of the FGGY family phosphorylate sugar substrates in an ATP-dependent manner (3). Similar to glycerol kinase, GK5 is proposed to be involved in ATP binding, phosphotransferase activity, and glycerol kinase activity. GK5 is necessary for hair growth, and functions in the regulation of SREBP-1/-2-mediated cholesterol production in the skin (4). The buildup of sterol precursors in the sebocytes results in defects in hair follicle development and homeostasis as observed in the homer mice (4).

Primers

PCR Primer
homer_pcr_F: CCCAAGTGCCCTTAAATGTATTTC
homer_pcr_R: TGGATGTAGCCCAGGTTAGC

Sequencing Primer
homer_seq_F: GTGCCCTTAAATGTATTTCCTTAAAG
homer_seq_R: GATGTAGCCCAGGTTAGCTTCAAAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 9, + strand):

1   cccaagtgcc cttaaatgta tttccttaaa gatctctttt gtttttaaaa cagctattgc
61  atggggccac ccgagtcctt catttcttca gtagaagtaa agtaatgcta acggtcagcc
121 gcttcaattt cagcacccag catgccacct taagattgac ctggatttta caaaacctat
181 ctgaggtaag agaagattgt gtgtgtggag aggggatcat gactgtgggg aagaaaaatt
241 taaagagtaa gaacaataat ccagcctttt ggggaagtga ccagtactcc tgggctagaa
301 gacagagttt tcaattggtt cctgtgttta aagtctttgt gttatgtcat aacacaaaaa
361 agattgacag taagtttgaa gctaacctgg gctacatcca 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Hurley, J. H., Faber, H. R., Worthylake, D., Meadow, N. D., Roseman, S., Pettigrew, D. W., and Remington, S. J. (1993) Structure of the Regulatory Complex of Escherichia Coli IIIGlc with Glycerol Kinase. Science. 259, 673-677.

  2. Ormo, M., Bystrom, C. E., and Remington, S. J. (1998) Crystal Structure of a Complex of Escherichia Coli Glycerol Kinase and an Allosteric Effector Fructose 1,6-Bisphosphate. Biochemistry. 37, 16565-16572.

  3. Zhang, Y., Zagnitko, O., Rodionova, I., Osterman, A., and Godzik, A. (2011) The FGGY Carbohydrate Kinase Family: Insights into the Evolution of Functional Specificities. PLoS Comput Biol. 7, e1002318.

  4. 1. Zhang, D., Tomisato, W., Su, L., Sun, L., Choi, J. H., Zhang, Z., Wang, K., Zhan, X., Choi, M., Li, X., Castro-Perez, J. M., Hildebrand, S., Murray, A. R., Moresco, E. M. Y., and Beutler, B. (2017) Skin-Specific Regulation of SREBP Processing and Lipid Biosynthesis by Glycerol Kinase 5. Proc Natl Acad Sci USA. 114, E5197-E5206.