Phenotypic Mutation 'flybase'

• Allele: flybase
• Mutation Type: start codon destroyed
• Chromosome: 15
• Coordinate: 78,376,048 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Il2rb
• Gene Name: interleukin 2 receptor, beta chain
• Synonym(s): IL-15Rbeta, IL-15 receptor beta chain, IL-2/15Rbeta, IL15Rbeta, Il-2Rbeta, CD122
• Chromosomal Location: 78,363,456-78,379,471 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Methionine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000086820] [ENSMUSP00000127006]
• AlphaFold: P16297
• SMART Domains: Protein: ENSMUSP00000086820; Gene: ENSMUSG00000068227; AA Change: M1T

Domain	Start	End	E-Value	Type
low complexity region	6	19	N/A	INTRINSIC
FN3	133	219	9.48e-3	SMART
transmembrane domain	246	268	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC

• Predicted Effect: probably null ; PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
  (Using ENSMUST00000089398)
• SMART Domains: Protein: ENSMUSP00000127006; Gene: ENSMUSG00000068227; AA Change: M1T

Domain	Start	End	E-Value	Type
low complexity region	6	19	N/A	INTRINSIC
FN3	133	219	9.48e-3	SMART
transmembrane domain	246	268	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC

• Predicted Effect: probably null ; PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
  (Using ENSMUST00000163494)
• Meta Mutation Damage Score: 0.9612
• Is this an essential gene?: Probably nonessential (E-score: 0.086)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:38 PM by Diantha La Vine
• Record Created: 2018-01-10 11:05 PM by Xue Zhong
• Record Posted: 2018-12-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, Evan Nair-Gill, Jianhui Wang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_008368; MGI:96550

Alleles Listed at MGI

All Mutations and Alleles(15) : Chemically induced (other)(1) Radiation induced(2) Targeted(8) Transgenic(4)

Phenotypic Description

Figure 1. Flybase mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Flybase mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Flybase mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Flybase mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Flybase mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Flybase mice exhibit reduced frequencies of peripheral naïve CD4 T cells in CD4 T cells . Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Flybase mice exhibit reduced frequencies of peripheral naïve CD4 T cells in CD4 T cells . Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Flybase mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Flybase mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Flybase mice exhibit increased expression of CD44 on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The flybase phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5713, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2) and IgM+ B cells (Figure 3) with concomitant increased frequencies of effector memory CD4 T cells in CD4 T cells (Figure 4) and effector memory CD8 T cells in CD8 T cells (Figure 5) as well as reduced frequencies of naïve CD4 T cells in CD4 T cells (Figure 6), and naïve CD8 T cells in CD8 T cells (Figure 7), all in the peripheral blood. The expression of CD44 on peripheral T cells (Figure 8), including CD4 (Figure 9) and CD8 (Figure 10) T cells was increased.

Nature of Mutation

Figure 11. Linkage mapping of the increased frequency of effector memory CD8 T cells in CD8 T cells phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R5713. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 15: Phf20l1 and Il2rb. The mutation in Il2rb was presumed causative as the immune cell phenotypes mimic those of other Il2rb alleles (see MGI). The Il2rb mutation is a T to C transition at base pair 78,491,848 (v38) on chromosome 15, or base pair 19,774 in the GenBank genomic region NC_000081 encoding Il2rb. The strongest association was found with a recessive model of inheritance to the normalized effector memory CD4 T cell frequency phenotype, wherein 2 variant homozygotes departed phenotypically from 22 homozygous reference mice and 27 heterozygous mice with a P value of 4.415 x 10^-22 (Figure 11).   

The mutation corresponds to residue 151 in the mRNA sequence NM_008368 within exon 2 of 10 total exons.

135 CTCCTCTCAGCTGTGATGGCTACCATAGCTCTT 1                  -M--A--T--I--A--L-

The mutated nucleotide is indicated in red. The mutation results in a methionine to threonine substitution at position 1 (M1T) in the IL2RB protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.663). The next putative initiator methionine is at position 47.

Protein Prediction

Figure 12. Quaternary structure of interleukin-2 with its α, β (CD122), and γ_c receptors. UCSF Chimera model is based on PDB 2B5I, Wang et al. Science 310, 1159-1163 (2005). Click on the 3D structure to view it rotate.

Figure 13. Domain organization of CD122. The flybase mutation results in a methionine to threonine substitution at position 1. Abbreviations: SP, signal peptide; FN3, fibronectin type-III; TM, transmembrane domain; SS, sorting signal. This image is interactive. Other mutations found in CD122 are noted in red. Click on each muation for more information.

Il2rb encodes CD122 (alternatively, IL2Rβ), the beta chain of the IL-2 and IL-15 receptors (1). The IL-2 receptor has three subunits: c subunits together form an intermediate affinity receptor (3). Upon co-expression of the α subunit, the receptor is converted to a high affinity receptor [Figure 12; PDB:2B5I; (4;5)].

CD122 is a single-pass transmembrane protein, with an extracellular N-terminus and a cytoplasmic C-terminus (Figure 13). Amino acids 1 to 26 are a signal peptide. IL2RB has a single fibronectin type-III domain (FN3; amino acids 135 to 235), a WSXWS motif (amino acids 221 to 225), and a box 1 motif (amino acids 281 to 289). The FN3 domain mediates interactions between CD122 and the γ_c IL-2/-15 receptor subunit [(4). The FN3 domain folds into a β-sandwich sheet consisting of seven antiparallel strands arranged in a three-on-four topology (4). The WSXWS motif promotes proper folding and subsequent intracellular transport of CD122. The box 1 motif mediates interaction with and/or activation of JAK3 (see the record for mount_tai; see the Background section for more information about CD122 and JAK3) (6;7).

Ser132, His133, and Tyr134 are required for IL-2 binding (8). The C-terminal 147 amino acids are required for STAT5 activation, but not for IL-2-induced cell proliferation (9). A sorting signal motif in the CD122 cytosolic tail (amino acids 289 to 296) targets CD122 to degradation compartments (10;11). Upon binding of IL-2 to the IL-2R, the receptor is internalized (12;13). Once endocytosed, the receptor subunits are sorted: the α chain recycles to the plasma membrane, whereas the β and γ chains are targeted to late endosomes/lysosomes (14). The ubiquitin proteasome system promotes the sorting of CD122 to late endosomes/lysosomes (15).

CD122 is phosphorylated by LCK (see the record for iconoclast) at Tyr355, Tyr358, Tyr361, Tyr392, and Tyr510 (16). CD122 phosphorylation of Tyr338, Tyr392, and Tyr510 promotes IL-2-induced proliferation, while Tyr392 and Tyr510 phosphorylation is required for IL-2-induced receptor activation and downstream signaling (17). CD122 can also be phosphorylated at Thr450 (18). Thr450 phosphorylation regulates IL-2 receptor complex formation, recruitment of JAK3, and downstream signaling. CIS interacts with CD122 at the “A region” (amino acids 313 to 382). CIS binding inhibits IL-2-associated signaling by preventing binding of CD122 with LCK and JAK3, subsequently preventing LCK-mediated phosphorylation of CD122 and JAK3-mediated activation of STAT5 (19;20).

CD122 is cleaved, which generates a 37-kDa fragment (termed 37βic) containing the C-terminal tail and transmembrane domains (21). The CD122 fragment is functional and associates with STAT5 to promote cell proliferation.

The flybase mutation results in a methionine to threonine substitution at position 1 (M1T); Met1 is within the signal peptide.

Expression/Localization

A CD122/γ_c complex is expressed on NK cells, macrophages, and resting T cells (22). The high-affinity IL-2Rα, CD122, and γ_c receptor complex is expressed on activated T cells (23).

In embryonic day 12 (E12) livers, CD122 is expressed on Sca1+Lin- hematopoietic stem cells and on B220+ cells (24). In the E12 thymus, Sca1+ intrathymic T-cell progenitors expressed CD122 (24).

Background

Figure 14. IL-2Rβ-associated signaling. CD122 mediates both IL-2 and IL-15 signaling. Upon receptor stimulation, JAK proteins phosphorylate the receptor cytoplasmic domains. STAT proteins are recruited to the receptor, tyrosine phosphorylated by JAKs, and dimerize for translocation to the nucleus with the assistance of importin-α5 (associated with importin-β). Once STAT1 binds to its DNA target, importin-α5 is recycled to the cytoplasm by the cellular apoptosis susceptibility protein (CAS) export receptor.

IL-2/IL-15 receptor-associated signaling functions in antigen-driven T cell-expansion, maintains peripheral T cell homeostasis, and promotes the differentiation and function of NK cells and B cells. Stimulation of the IL-2 and IL-15 receptors (containing a γ_c subunit) results in activation of JAK1 and JAK3 (Figure 14). Activated JAK3 phosphorylates the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT1 and STAT3. Once recruited to the receptor, STAT5 is also tyrosine phosphorylated by JAK3. STAT5 phosphorylation putatively allows formation and/or conformational reorganization of an activated STAT5 dimer, involving reciprocal SH2 domain-phosphotyrosine interactions between STAT5 monomers. Phosphorylated, activated STAT5 enters the nucleus where it accumulates to promote transcription.

In the mouse, CD8⁺CD122⁺CXCR3⁺ (CD44^high, CD62L^high CCR7⁺) T cells exhibit a central memory phenotype, regulate T cell homeostasis, and function as regulatory T cells by suppressing autoimmune and alloimmune responses [(25;26); reviewed in (27)]. The percentage of CD122+ T cells in CD8+ cells is high in young age and increases with age (25). IL-15 promotes the generation and survival of memory CD8+ T cells (28).

In humans, IL2RB is a putative candidate gene for psoriasis susceptibility in a Turkish cohort (29) and inflammatory bowel disease in a Tunisia cohort (30).

Il2rb-deficient (Il2rb^-/-) mice exhibited reduced numbers of regulatory T cells in the thymus and lymph nodes, enlarged spleens, increased sizes of spleen periarteriolar lymphoid sheaths, aberrant T cell responses to inflammatory cytokines, increased percentages of CD4 and CD8 T cells that express high levels of activation markers, reduced T cell proliferation, enlarged lymph nodes, increased levels of anti-DNA antibodies, and increased susceptibility to autoimmune hemolytic anemia (31;32). In addition, Il2rb^-/- mice showed reduced numbers of double-positive T cells, B cells, and memory T cells; increased numbers of plasma cells, CD4+ T cells and CD8+ T cells in the thymus, erythroid progenitors in the blood, and neutrophils in the lymph nodes, and increased levels of IgE and IgG1 in the sera (32). Il2rb^-/- mice also showed premature death, weight loss, slow movements, fuzzy hair, and poorly developed genitalia (32).

Putative Mechanism

The expression of CD122^flybase has not been examined to determine if the mutant protein is expressed; however, the immune phenotypes observed in the flybase mice indicates aberrant CD122-associated function.

Primers

PCR Primer
flybase_pcr_F: ATGGATCTCCTCCCTGAAGCAG
flybase_pcr_R: CCACCAGTTTCTTGTGATGGG

Sequencing Primer
flybase_seq_F: CAGGAATCTGGGATGTGACCTC
flybase_seq_R: GGGTTGGTCATTTATAGTGAAAACAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 248 nucleotides is amplified (chromosome 15, - strand):

1   ggtagagtgg ggtggggttt ctgacttgtt ctttccttct ccacttaggg tttgcatcct
61  cagctcctct cagctgtgat ggctaccata gctcttccct ggagcctgtc cctctacgtc
121 ttcctcctgc tcctggctac accttgggca tctgcagcag tgaaaagtga gcatctggca
181 ttttgatgtc catactttcc ccagtgggag gtcacatccc agattcctgc ttcagggagg
241 agatccat

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Gnarra, J. R., Otani, H., Wang, M. G., McBride, O. W., Sharon, M., and Leonard, W. J. (1990) Human Interleukin 2 Receptor Beta-Chain Gene: Chromosomal Localization and Identification of 5' Regulatory Sequences. Proc Natl Acad Sci U S A. 87, 3440-3444.

  2. Giri, J. G., Ahdieh, M., Eisenman, J., Shanebeck, K., Grabstein, K., Kumaki, S., Namen, A., Park, L. S., Cosman, D., and Anderson, D. (1994) Utilization of the Beta and Gamma Chains of the IL-2 Receptor by the Novel Cytokine IL-15. EMBO J. 13, 2822-2830.

  3. Takeshita, T., Ohtani, K., Asao, H., Kumaki, S., Nakamura, M., and Sugamura, K. (1992) An Associated Molecule, p64, with IL-2 Receptor Beta Chain. its Possible Involvement in the Formation of the Functional Intermediate-Affinity IL-2 Receptor Complex. J Immunol. 148, 2154-2158.

  4. Wang, X., Rickert, M., and Garcia, K. C. (2005) Structure of the Quaternary Complex of Interleukin-2 with its Alpha, Beta, and Gammac Receptors. Science. 310, 1159-1163.

  5. Arima, N., Kamio, M., Okuma, M., Ju, G., and Uchiyama, T. (1991) The IL-2 Receptor Alpha-Chain Alters the Binding of IL-2 to the Beta-Chain. J Immunol. 147, 3396-3401.

  6. Howard, O. M., Kirken, R. A., Garcia, G. G., Hackett, R. H., and Farrar, W. L. (1995) Structural Domains of Interleukin-2 Receptor Beta Critical for Signal Transduction: Kinase Association and Nuclear Complex-Formation. Biochem J. 306 ( Pt 1), 217-224.

  7. Goldsmith, M. A., Xu, W., Amaral, M. C., Kuczek, E. S., and Greene, W. C. (1994) The Cytoplasmic Domain of the Interleukin-2 Receptor Beta Chain Contains both Unique and Functionally Redundant Signal Transduction Elements. J Biol Chem. 269, 14698-14704.

  8. Imler, J. L., Miyajima, A., and Zurawski, G. (1992) Identification of Three Adjacent Amino Acids of Interleukin-2 Receptor Beta Chain which Control the Affinity and the Specificity of the Interaction with Interleukin-2. EMBO J. 11, 2047-2053.

  9. Fujii, H., Nakagawa, Y., Schindler, U., Kawahara, A., Mori, H., Gouilleux, F., Groner, B., Ihle, J. N., Minami, Y., and Miyazaki, T. (1995) Activation of Stat5 by Interleukin 2 Requires a Carboxyl-Terminal Region of the Interleukin 2 Receptor Beta Chain but is Not Essential for the Proliferative Signal Transmission. Proc Natl Acad Sci U S A. 92, 5482-5486.

  10. Subtil, A., Delepierre, M., and Dautry-Varsat, A. (1997) An Alpha-Helical Signal in the Cytosolic Domain of the Interleukin 2 Receptor Beta Chain Mediates Sorting Towards Degradation After Endocytosis. J Cell Biol. 136, 583-595.

  11. Subtil, A., Rocca, A., and Dautry-Varsat, A. (1998) Molecular Characterization of the Signal Responsible for the Targeting of the Interleukin 2 Receptor Beta Chain Toward Intracellular Degradation. J Biol Chem. 273, 29424-29429.

  12. Hemar, A., Lieb, M., Subtil, A., DiSanto, J. P., and Dautry-Varsat, A. (1994) Endocytosis of the Beta Chain of Interleukin-2 Receptor Requires neither Interleukin-2 nor the Gamma Chain. Eur J Immunol. 24, 1951-1955.

  13. Subtil, A., Hemar, A., and Dautry-Varsat, A. (1994) Rapid Endocytosis of Interleukin 2 Receptors when Clathrin-Coated Pit Endocytosis is Inhibited. J Cell Sci. 107 ( Pt 12), 3461-3468.

  14. Hemar, A., Subtil, A., Lieb, M., Morelon, E., Hellio, R., and Dautry-Varsat, A. (1995) Endocytosis of Interleukin 2 Receptors in Human T Lymphocytes: Distinct Intracellular Localization and Fate of the Receptor Alpha, Beta, and Gamma Chains. J Cell Biol. 129, 55-64.

  15. Rocca, A., Lamaze, C., Subtil, A., and Dautry-Varsat, A. (2001) Involvement of the ubiquitin/proteasome System in Sorting of the Interleukin 2 Receptor Beta Chain to Late Endocytic Compartments. Mol Biol Cell. 12, 1293-1301.

  16. Delespine-Carmagnat, M., Bouvier, G., Allee, G., Fagard, R., and Bertoglio, J. (1999) Biochemical Analysis of Interleukin-2 Receptor Beta Chain Phosphorylation by p56(Lck). FEBS Lett. 447, 241-246.

  17. Friedmann, M. C., Migone, T. S., Russell, S. M., and Leonard, W. J. (1996) Different Interleukin 2 Receptor Beta-Chain Tyrosines Couple to at Least Two Signaling Pathways and Synergistically Mediate Interleukin 2-Induced Proliferation. Proc Natl Acad Sci U S A. 93, 2077-2082.

  18. Ruiz-Medina, B. E., Ross, J. A., and Kirken, R. A. (2015) Interleukin-2 Receptor Beta Thr-450 Phosphorylation is a Positive Regulator for Receptor Complex Stability and Activation of Signaling Molecules. J Biol Chem. 290, 20972-20983.

  19. Aman, M. J., Migone, T. S., Sasaki, A., Ascherman, D. P., Zhu, M., Soldaini, E., Imada, K., Miyajima, A., Yoshimura, A., and Leonard, W. J. (1999) CIS Associates with the Interleukin-2 Receptor Beta Chain and Inhibits Interleukin-2-Dependent Signaling. J Biol Chem. 274, 30266-30272.

  20. Gaffen, S. L., Lai, S. Y., Xu, W., Gouilleux, F., Groner, B., Goldsmith, M. A., and Greene, W. C. (1995) Signaling through the Interleukin 2 Receptor Beta Chain Activates a STAT-5-Like DNA-Binding Activity. Proc Natl Acad Sci U S A. 92, 7192-7196.

  21. Montes de Oca, P., Malarde, V., Proust, R., Dautry-Varsat, A., and Gesbert, F. (2010) Ectodomain Shedding of Interleukin-2 Receptor Beta and Generation of an Intracellular Functional Fragment. J Biol Chem. 285, 22050-22058.

  22. Nelson, B. H., and Willerford, D. M. (1998) Biology of the Interleukin-2 Receptor. Adv Immunol. 70, 1-81.

  23. Takeshita, T., Asao, H., Ohtani, K., Ishii, N., Kumaki, S., Tanaka, N., Munakata, H., Nakamura, M., and Sugamura, K. (1992) Cloning of the Gamma Chain of the Human IL-2 Receptor. Science. 257, 379-382.

  24. Reya, T., Yang-Snyder, J. A., Rothenberg, E. V., and Carding, S. R. (1996) Regulated Expression and Function of CD122 (Interleukin-2/interleukin-15R-Beta) during Lymphoid Development. Blood. 87, 190-201.

  25. Rifa'i, M., Kawamoto, Y., Nakashima, I., and Suzuki, H. (2004) Essential Roles of CD8+CD122+ Regulatory T Cells in the Maintenance of T Cell Homeostasis. J Exp Med. 200, 1123-1134.

  26. Li, S., Xie, Q., Zeng, Y., Zou, C., Liu, X., Wu, S., Deng, H., Xu, Y., Li, X. C., and Dai, Z. (2014) A Naturally Occurring CD8(+)CD122(+) T-Cell Subset as a Memory-Like Treg Family. Cell Mol Immunol. 11, 326-331.

  27. Liu, J., Chen, D., Nie, G. D., and Dai, Z. (2015) CD8(+)CD122(+) T-Cells: A Newly Emerging Regulator with Central Memory Cell Phenotypes. Front Immunol. 6, 494.

  28. Kennedy, M. K., Glaccum, M., Brown, S. N., Butz, E. A., Viney, J. L., Embers, M., Matsuki, N., Charrier, K., Sedger, L., Willis, C. R., Brasel, K., Morrissey, P. J., Stocking, K., Schuh, J. C., Joyce, S., and Peschon, J. J. (2000) Reversible Defects in Natural Killer and Memory CD8 T Cell Lineages in Interleukin 15-Deficient Mice. J Exp Med. 191, 771-780.

  29. Gulel, A., Inaloz, H. S., Nursal, A. F., Sever, T., and Pehlivan, S. (2018) Association of the TNF-Alpha, IL-2, and IL-2RB Gene Variants with Susceptibility to Psoriasis in a Turkish Cohort. Cent Eur J Immunol. 43, 50-57.

  30. Bouzid, D., Amouri, A., Fourati, H., Marques, I., Abida, O., Tahri, N., Goncalves, C. P., and Masmoudi, H. (2013) Polymorphisms in the IL2RA and IL2RB Genes in Inflammatory Bowel Disease Risk. Genet Test Mol Biomarkers. 17, 833-839.

  31. Malek, T. R., Yu, A., Vincek, V., Scibelli, P., and Kong, L. (2002) CD4 Regulatory T Cells Prevent Lethal Autoimmunity in IL-2Rbeta-Deficient Mice. Implications for the Nonredundant Function of IL-2. Immunity. 17, 167-178.

  32. Suzuki, H., Kundig, T. M., Furlonger, C., Wakeham, A., Timms, E., Matsuyama, T., Schmits, R., Simard, J. J., Ohashi, P. S., and Griesser, H. (1995) Deregulated T Cell Activation and Autoimmunity in Mice Lacking Interleukin-2 Receptor Beta. Science. 268, 1472-1476.