Phenotypic Mutation 'Shenandoah'

• Allele: Shenandoah
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 43,058,226 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Siglecg
• Gene Name: sialic acid binding Ig-like lectin G
• Synonym(s): A630096C01Rik, mSiglec-G
• Chromosomal Location: 43,057,623-43,067,773 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002] ; PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Phenylalanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000005592]
• AlphaFold: Q80ZE3
• SMART Domains: Protein: ENSMUSP00000005592; Gene: ENSMUSG00000030468; AA Change: I38F

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	27	139	5.21e-2	SMART
IG_like	148	232	8.97e0	SMART
IGc2	262	325	3.38e-10	SMART
IGc2	366	427	8.26e-5	SMART
low complexity region	473	480	N/A	INTRINSIC
transmembrane domain	545	564	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
  (Using ENSMUST00000005592)
• Meta Mutation Damage Score: 0.2470
• Is this an essential gene?: Probably nonessential (E-score: 0.058)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:38 PM by Diantha La Vine
• Record Created: 2018-01-29 10:16 PM
• Record Posted: 2018-07-30
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, Evan Nair-Gill, Bruce Beutler

Accession Number

NCBI RefSeq: NM_172900; MGI:2443630

Alleles Listed at MGI

All Mutations and Alleles(6) : Gene trapped(3) Targeted(3)

Phenotypic Description

Figure 1. Shenandoah mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Shenandoah phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5713, some of which showed increased frequencies of B1 cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased B1 cell frequency phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R5713. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. The increased B1 cell frequency phenotype was linked by continuous variable mapping to a mutation in Siglecg:  an A to T transversion at base pair 43,408,802 (v38) on chromosome 7, or base pair 610 in the GenBank genomic region NC_000073. Linkage was found with an additive model of inheritance, wherein three variant homozygotes and 25 heterozygous mice departed phenotypically from 23 homozygous reference mice with a P value of 2.433 x 10^-13 (Figure 2). 

The mutation corresponds to residue 257 in the mRNA sequence NM_172900 within exon 3 of 12 total exons.

242 CAGGAGGGTCTGTGCATCTTCGTGCCCTGCTCC 33  -Q--E--G--L--C--I--F--V--P--C--S-

The mutated nucleotide is indicated in red. The mutation results in an isoleucine to phenylalanine substitution at position 38 (I38F) in the Siglec-G protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.987).

Protein Prediction

Figure 3. Domain organization of Siglec-G. The Shenandoah mutation results in an isoleucine to phenylalanine substitution at position 38. Other mutations found in the Siglec-G protein are shown in red. Click on each mutation for more information.

Siglec-G (Siglec-10 in humans) is a member of the CD33-related Siglec (sialic acid–binding immunoglobulin‐like lectin) family of adhesion molecules. Siglecs specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates; Siglec-G preferentially binds α2,3-linked or α2,6-linked sialic acid (α2,3Sia or α2,6Sia). Sialylated IgM is a known target of Siglec-G (1).

Siglec-C is a type 1 transmembrane protein with a signal peptide, a sialic-binding V-set Ig-like domain, three C2-set Ig-like domains, a transmembrane domain, and a cytoplasmic tail with two putative immune receptor tyrosine-based inhibitory motifs (ITIMs) and a Grb-2 binding motif (Figure 3) (2). X-ray and NMR studies showed that Ig-like domains form Greek-key β-sandwich structures with the varying types differing in the number of strands in the β-sheets as well as in their sequence patterns. By convention, the strands are labeled a to g in sequence with the two strands present between the c and d strands in V domains being labeled c' and c″.  One β-sheet consists of strands a, b, e and possibly d while the other contains strands c, f, g and possibly c' and c″.  In addition, the C-terminal ends of strands a and g may form a small stretch of parallel β-sheet, disrupting the original strands and giving rise to strands a' and/or g' (3). Ig-like domains are classified into V-type having all strands, C-type (for the C1-set) lacking the c' and c″ strands, S-type (for the C2-set) having the c' strand but not the c″ or d strands and the H-type, which lacks the c″ strand.  Ig-like domains usually contain a structural motif composed of cysteine residues generally located in the b and f strands that form a disulfide bridge, and a tryptophan residue located in the c strand (4).

The Shenandoah mutation results in an isoleucine to phenylalanine substitution at position 38 (I38F) in the Siglec-G protein; amino acid 38 is within the V-set Ig-like domain.

Expression/Localization

Siglec-G is highly expressed on the cell surface all B cell types, with highest expression on B1 cells and conventional B2 cells (2). Siglec-G is also expressed on dendritic cells. In humans, Siglec-10 is expressed on all B cells as well as on eosinophils, monocytes, and a subpopulation of natural killer cells (5).

Background

Figure 4. BCR signaling is regulated by Siglecs CD22 and Siglec-G. Following aggregation and localization of BCR molecules, the cytoplasmic tails of CD22 is phosphorylated by Lyn which recruits SHP-1. The association of Lyn with SHP-1 leads to the dephosphorylation of a number of BCR signaling components that dampens the BCR signal and Ca²⁺ mobilization such as Vav-1, CD19 and BLNK. The mechanism by which Siglec-G functions as an inhibitory receptor is unknown. The ITIMs of Siglec-G/ are phosphorylated by Src family kinases, creating binding sites for several SH2 domain-containing signaling molecules (e.g., SHP1 [see the record for spin] and SHP2). PMCA4 is activated by CD22 and promotes Ca²⁺ efflux further attenuating the BCR signaling. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Siglec-G/-10 is one of two Siglecs expressed by B cells (the other being CD22; see the record for well), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [Figure 4; reviewed by (6)]. Siglec-G/-10 is a B1 cell inhibitory receptor that inhibits B cell receptor-associated NF-κB and calcium signaling, subsequently controlling the expansion and survival of B1 cells (1;2;7;8). The mechanism by which Siglec-G/-10 functions as an inhibitory receptor is unknown. The ITIMs of Siglec-G/-10 are phosphorylated by Src family kinases, creating binding sites for several SH2 domain-containing signaling molecules (e.g., SHP1 [see the record for spin] and SHP2). SHP1 typically promotes the dephosphorylation of intracellular substrates (e.g., PLCγ [see the record for queen], Btk, or SLP65/BLNK [see the record for busy]) and inhibition of several signaling pathways; however phosphorylation of downstream signaling proteins was not changed in B1 or B2 cells from Siglecg-deficient (Siglecg^-/-) mice (2). Siglecg^-/- B1 cells showed increased expression of the transcription factor NFATc1. The increased calcium signaling in the Siglecg^-/- B1 cells putatively causes the increased NFATc1 expression.

Siglec-G inhibits dendritic cell cross-presentation by impairing MHC class I-peptide complex formation (9). Siglecg^-/- mice generated more antigen-specific cytotoxic T lymphocytes (9). CD8α⁺ dendritic cells from the Siglecg^-/- mice exhibited more MHC class I-peptide complexes than wild-type CD8α⁺ dendritic cells (9). The increased number of complexes was due to SHP1-mediated dephosphorylation of the NADPH oxidase component p47(phox) and inhibition of NOX2 activation on phagosomes. Subsequently, exogenous antigens showed excessive hydrolysis and reduced MHC class I-peptide complex formation.

Siglec-G on host antigen-presenting cells negatively regulates graft-versus-host disease (GVHD) through an interaction with CD24 on donor T cells (10).

Siglec-G is essential during RNA virus infection. Siglec-G induces the recruitment of SHP2 and the E3 ubiquitin ligase c-Cbl to the RNA virus sensor RIG-I (11). SHP2 and c-Cbl subsequently promote RIG-I degradation. Inactivation of Siglec-G protects mice against RNA virus infection due to increased type I interferon production.

Putative Mechanism

Siglecg^-/- mice have increased levels of serum IgM and produce more IgM autoantibodies than wild-type mice (2;7). Over time, the Siglecg^-/- mice develop B-cell lymphoproliferative disorders, including diffuse large B-cell lymphoma, follicular lymphoma, medium-to-large B-cell monomorphic lymphoma and atypical lymphoproliferations (12). Older Siglecg^-/- mice also exhibited an autoimmune phenotype with increased autoantibody levels and mild glomerulonephritis as well as increased numbers of plasma cells, germinal center B cells, and activated CD4 T cells (13;14).

Siglecg^-/- mice exhibited increased numbers of B-1 (B-1a and B-1b) B cells due to reduced spontaneous apoptosis and increased life spans of the cells (1;2;7;8).

The phenotype of the Shenandoah mice indicate loss of Siglec-G^Shenandoah function.

Primers

PCR Primer
Shenandoah_pcr_F: GATGTCACTGCTGCTGTTCC
Shenandoah_pcr_R: TTGAGTCTCCCCACTGAACATC

Sequencing Primer
Shenandoah_seq_F: CCAGAGTGGCTCAAATTGGG
Shenandoah_seq_R: TTTAGAGATATCCCCCAAGAGCTGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 475 nucleotides is amplified (chromosome 7, + strand):

1   gatgtcactg ctgctgttcc tgctgtcctt cctgttggat ggtgagtggg tccaaggcca
61  gagtggctca aattggggct ggggctgggg ctggggctgg ggctggggct ggggctgggg
121 ctggggctgg ggctggggct ggggctaaag cttatgcctc tgtctccgac agggcctcaa
181 ggtcagatgg agagctactt cctacaggtg cagagaattg tgaaggcaca ggagggtctg
241 tgcatcttcg tgccctgctc cttctcctcc cctgagggaa aatggcttaa ccgttcccca
301 ctttatggct actggttcaa aggcatcaga aaaccatcac tttcatttcc agtggccaca
361 aataacaaag ataaagtgtt agaatgggaa gcccgagggc gcttccagct cttgggggat
421 atctctaaaa agaactgttc cttgctaatc aaagatgttc agtggggaga ctcaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Hutzler, S., Ozgor, L., Naito-Matsui, Y., Klasener, K., Winkler, T. H., Reth, M., and Nitschke, L. (2014) The Ligand-Binding Domain of Siglec-G is Crucial for its Selective Inhibitory Function on B1 Cells. J Immunol. 192, 5406-5414.

  2. Hoffmann, A., Kerr, S., Jellusova, J., Zhang, J., Weisel, F., Wellmann, U., Winkler, T. H., Kneitz, B., Crocker, P. R., and Nitschke, L. (2007) Siglec-G is a B1 Cell-Inhibitory Receptor that Controls Expansion and Calcium Signaling of the B1 Cell Population. Nat Immunol. 8, 695-704.

  3. Bork, P., Holm, L., and Sander, C. (1994) The Immunoglobulin Fold. Structural Classification, Sequence Patterns and Common Core. J Mol Biol. 242, 309-320.

  4. Smith, D. K., and Xue, H. (1997) Sequence Profiles of Immunoglobulin and Immunoglobulin-Like Domains. J Mol Biol. 274, 530-545.

  5. Munday, J., Kerr, S., Ni, J., Cornish, A. L., Zhang, J. Q., Nicoll, G., Floyd, H., Mattei, M. G., Moore, P., Liu, D., and Crocker, P. R. (2001) Identification, Characterization and Leucocyte Expression of Siglec-10, a Novel Human Sialic Acid-Binding Receptor. Biochem J. 355, 489-497.

  6. Nitschke, L. (2009) CD22 and Siglec-G: B-Cell Inhibitory Receptors with Distinct Functions. Immunol Rev. 230, 128-143.

  7. Ding, C., Liu, Y., Wang, Y., Park, B. K., Wang, C. Y., Zheng, P., and Liu, Y. (2007) Siglecg Limits the Size of B1a B Cell Lineage by Down-Regulating NFkappaB Activation. PLoS One. 2, e997.

  8. Jellusova, J., Duber, S., Guckel, E., Binder, C. J., Weiss, S., Voll, R., and Nitschke, L. (2010) Siglec-G Regulates B1 Cell Survival and Selection. J Immunol. 185, 3277-3284.

  9. Ding, Y., Guo, Z., Liu, Y., Li, X., Zhang, Q., Xu, X., Gu, Y., Zhang, Y., Zhao, D., and Cao, X. (2016) The Lectin Siglec-G Inhibits Dendritic Cell Cross-Presentation by Impairing MHC Class I-Peptide Complex Formation. Nat Immunol. 17, 1167-1175.

  10. Toubai, T., Hou, G., Mathewson, N., Liu, C., Wang, Y., Oravecz-Wilson, K., Cummings, E., Rossi, C., Evers, R., Sun, Y., Wu, J., Choi, S. W., Fang, D., Zheng, P., Liu, Y., and Reddy, P. (2014) Siglec-G-CD24 Axis Controls the Severity of Graft-Versus-Host Disease in Mice. Blood. 123, 3512-3523.

  11. Chen, W., Han, C., Xie, B., Hu, X., Yu, Q., Shi, L., Wang, Q., Li, D., Wang, J., Zheng, P., Liu, Y., and Cao, X. (2013) Induction of Siglec-G by RNA Viruses Inhibits the Innate Immune Response by Promoting RIG-I Degradation. Cell. 152, 467-478.

  12. Simonetti, G., Bertilaccio, M. T., Rodriguez, T. V., Apollonio, B., Dagklis, A., Rocchi, M., Innocenzi, A., Casola, S., Winkler, T. H., Nitschke, L., Ponzoni, M., Caligaris-Cappio, F., and Ghia, P. (2014) SIGLEC-G Deficiency Increases Susceptibility to Develop B-Cell Lymphoproliferative Disorders. Haematologica. 99, 1356-1364.

  13. Muller, J., Lunz, B., Schwab, I., Acs, A., Nimmerjahn, F., Daniel, C., and Nitschke, L. (2015) Siglec-G Deficiency Leads to Autoimmunity in Aging C57BL/6 Mice. J Immunol. 195, 51-60.

  14. Bokers, S., Urbat, A., Daniel, C., Amann, K., Smith, K. G., Espeli, M., and Nitschke, L. (2014) Siglec-G Deficiency Leads to More Severe Collagen-Induced Arthritis and Earlier Onset of Lupus-Like Symptoms in MRL/lpr Mice. J Immunol. 192, 2994-3002.