Phenotypic Mutation 'sposh'

• Allele: sposh
• Mutation Type: missense
• Chromosome: 14
• Coordinate: 104,059,150 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Ednrb
• Gene Name: endothelin receptor type B
• Synonym(s): ETR-b, Sox10m1, ETb
• Chromosomal Location: 104,052,061-104,081,838 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013] ; PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Phenylalanine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000022718] [ENSMUSP00000126057] [ENSMUSP00000154806]
• AlphaFold: P48302
• SMART Domains: Protein: ENSMUSP00000022718; Gene: ENSMUSG00000022122; AA Change: F292S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:7TM_GPCR_Srx	109	329	2.3e-6	PFAM
Pfam:7TM_GPCR_Srsx	112	401	7.3e-11	PFAM
Pfam:7tm_1	118	387	8.5e-44	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000022718)
• SMART Domains: Protein: ENSMUSP00000126057; Gene: ENSMUSG00000022122; AA Change: F292S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:7TM_GPCR_Srx	109	328	1.9e-6	PFAM
Pfam:7TM_GPCR_Srsx	112	401	7.3e-11	PFAM
Pfam:7tm_1	118	387	4.2e-40	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000172237)
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000227824)
• Meta Mutation Damage Score: 0.7425
• Is this an essential gene?: Possibly essential (E-score: 0.716)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:38 PM by Anne Murray
• Record Created: 2018-01-30 2:48 PM by Jamie Russell
• Record Posted: 2018-03-28
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Lauren Prince, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007904.4, NM_001276296.1, NM_001136061.2; MGI: 102720

Alleles Listed at MGI

All mutations/alleles(48) : Chemically and radiation induced(2) Chemically induced (ENU)(2) Chemically induced (other)(11) Radiation induced(18) Spontaneous(4) Targeted(11)

Phenotypic Description

Figure 1. Sposh mice exhibited variable white belly spotting.

The sposh phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R5802, some of which showed variable white belly spotting (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the pigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 63 mutations (X-axis) identified in the G1 male of pedigree R5802. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. The pigmentation phenotype was linked to a mutation in Ednrb: a T to C transition at base pair 103,821,714 (v38) on chromosome 14, or base pair 22,763 in the GenBank genomic region NC_000080 encoding Ednrb. Linkage was found with a recessive model of inheritance (P = 0.000234), wherein six affected mice were homozygous (N = 5) or heterozygous (N = 1) for the variant allele, and 31 unaffected mice were either heterozygous (N = 22) or homozygous for the reference allele (N = 9) (Figure 2).

The mutation corresponds to residue 1,286 in the mRNA sequence NM_001136061.2 within exon 5 of 8 total exons.

1270 GCCATCACTGCAGTCTTTTATACCCTGATGACC 287  -A--I--T--A--V--F--Y--T--L--M--T-

The mutated nucleotide is indicated in red.  The mutation results in a phenylalanine to serine substitution at amino acid 292 (F292S) in both endothelin receptor type B (ET_BR) isoforms.

Protein Prediction

Figure 3. The topography and domain structure of ET_BR. (A) ET_BR is a G-protein coupled receptor with seven transmembrane (TM) domains. Shown are the locations of the signal peptide and ET-1-induced cleavages of the N-terminus. The post-translational modifications that occur on ET_BR are also shown: N-linked glycosyaltion at N60, disulfide bond formation between C174 and C255, palmitoylation at C402, C403, and C405, the 13 phosphorylation (Ps) sites, and the location of G_i coupling. (B) The domain structure of ET_BR. Abbreviations: TM, transmembrane domain; SP, signal peptide; CT, C-terminus, Ps, phosphorylation.

Ednrb encodes endothelin receptor type B (ET_BR), a member of the endothelin (ET) receptor family of rhodopsin-like G protein-coupled receptors (GPCRs; see the record for Bemr3) (1;2). The rhodopsin-like GPCRs have seven helical transmembrane domains, three extracellular and three intracellular loops, an extracellular N-terminus, and a cytoplasmic C-terminus (Figure 3). The sposh mutation results in a phenylalanine to serine substitution at amino acid 292 in both endothelin receptor type B (ET_BR) isoforms; amino acid 292 is within the fifth transmembrane domain.

Please see the record gus-gus for more information on Ednrb.

Putative Mechanism

ET-associated signaling (ET-1/ET_AR and ET-3/ET_BR) is essential for neural crest (NC) cell proliferation, migration, differentiation, and transformation (3-5). The embryonic NC gives rise to pluripotent cells that migrate to different locations within the embryo during development (6). The NC cells subsequently differentiate into several cell types including adrenomedullary cells, craniofacial skeletal tissue, glia and some neurons of the peripheral nervous system, enteric neurons and glia, and melanocytes of the skin, hair and inner ear. ET-3/ET_BR-associated signaling is required between embryonic day (E)10-E12.5 in the mouse for the survival and migration of enteric ganglion neurons and melanocytes derived from trunk/vagal NC cells (4;5;7-11). Other studies indicate that ET_BR signaling may also stimulate melanocyte proliferation in the epidermis (11). Mice homozygous for targeted as well as naturally occurring Ednrb null mutations (e.g., MGI:1856148, MGI:1856149, MGI:1857161, and MGI:3795226) exhibit a piebald appearance due to the absence of NC-derived melanocytes in the epidermis (7;9;12-14). Ednrb null mice also exhibit an absence of choroidal melanocytes; neuroectoderm-derived pigment epithelium melanocytes develop normally (7). Ednrb null mice display early postnatal lethality [from ~postnatal day 15 to up to seven weeks after birth; (7;12;14)]. The sposh mice exhibit variable white belly spotting. The Ednrb knockout mouse models have established that the observed pigmentation defects are due to the absence of NC-derived melanocytes in the hair bulbs of non-pigmented areas (7;9;12-14).

Primers

PCR Primer
sposh_pcr_F: CCTAGGCTAATCGAGATTCCATC
sposh_pcr_R: GTAGATATGGCCCACGAAACC

Sequencing Primer
sposh_seq_F: GCTAATCGAGATTCCATCTTAAAAGG
sposh_seq_R: TAGATATGGCCCACGAAACCCTATAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 564 nucleotides is amplified (chromosome 14, - strand):

1   gtagatatgg cccacgaaac cctatacagt acatatatgg aagatgttac aaaataattg
61  tcctttgatg aatatggcat ttgtaattga catttgatac atatggggtt ttttaaagca
121 gaagatatta atcataaaaa ttctttcttc cccatagttt tacaagacag ccaaagattg
181 gtggctgttc agtttctact tctgcttgcc gctagccatc actgcagtct tttataccct
241 gatgacctgc gaaatgctca ggaagaagag cggtatgcag attgctttga atgatcactt
301 aaagcaggta agagaatgga agaagctagt agagtatagc cataattatg gtcagatcta
361 agtcatgatg atgatgatga catgatgatg atatgatgag ctaattttac acactagaac
421 atattttcac tttcttcatt ctgttcctgt aacaaaaaaa ttttatatta cttacttaga
481 gagtatatca tctataatga tctagagaga atcattgact tttgttgttg attcctttta
541 agatggaatc tcgattagcc tagg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Nakamuta, M., Takayanagi, R., Sakai, Y., Sakamoto, S., Hagiwara, H., Mizuno, T., Saito, Y., Hirose, S., Yamamoto, M., and Nawata, H. (1991) Cloning and Sequence Analysis of a cDNA Encoding Human Non-Selective Type of Endothelin Receptor. Biochem Biophys Res Commun. 177, 34-39.

  2. Arai, H., Hori, S., Aramori, I., Ohkubo, H., and Nakanishi, S. (1990) Cloning and Expression of a cDNA Encoding an Endothelin Receptor. Nature. 348, 730-732.

  3. Pla, P., and Larue, L. (2003) Involvement of Endothelin Receptors in Normal and Pathological Development of Neural Crest Cells. Int J Dev Biol. 47, 315-325.

  4. Shin, M. K., Levorse, J. M., Ingram, R. S., and Tilghman, S. M. (1999) The Temporal Requirement for Endothelin Receptor-B Signalling during Neural Crest Development. Nature. 402, 496-501.

  5. Kurihara, H., Kurihara, Y., Nagai, R., and Yazaki, Y. (1999) Endothelin and Neural Crest Development. Cell Mol Biol (Noisy-le-grand). 45, 639-651.

  6. Stanchina, L., Baral, V., Robert, F., Pingault, V., Lemort, N., Pachnis, V., Goossens, M., and Bondurand, N. (2006) Interactions between Sox10, Edn3 and Ednrb during Enteric Nervous System and Melanocyte Development. Dev Biol. 295, 232-249.

  7. Hosoda, K., Hammer, R. E., Richardson, J. A., Baynash, A. G., Cheung, J. C., Giaid, A., and Yanagisawa, M. (1994) Targeted and Natural (Piebald-Lethal) Mutations of Endothelin-B Receptor Gene Produce Megacolon Associated with Spotted Coat Color in Mice. Cell. 79, 1267-1276.

  8. Baynash, A. G., Hosoda, K., Giaid, A., Richardson, J. A., Emoto, N., Hammer, R. E., and Yanagisawa, M. (1994) Interaction of Endothelin-3 with Endothelin-B Receptor is Essential for Development of Epidermal Melanocytes and Enteric Neurons. Cell. 79, 1277-1285.

  9. Lee, H. O., Levorse, J. M., and Shin, M. K. (2003) The Endothelin Receptor-B is Required for the Migration of Neural Crest-Derived Melanocyte and Enteric Neuron Precursors. Dev Biol. 259, 162-175.

  10. Zaitoun, I., Erickson, C. S., Barlow, A. J., Klein, T. R., Heneghan, A. F., Pierre, J. F., Epstein, M. L., and Gosain, A. (2013) Altered Neuronal Density and Neurotransmitter Expression in the Ganglionated Region of Ednrb Null Mice: Implications for Hirschsprung's Disease. Neurogastroenterol Motil. 25, e233-44.

  11. Yoshida, H., Kunisada, T., Kusakabe, M., Nishikawa, S., and Nishikawa, S. I. (1996) Distinct Stages of Melanocyte Differentiation Revealed by Anlaysis of Nonuniform Pigmentation Patterns. Development. 122, 1207-1214.

  12. Matsushima, Y., Shinkai, Y., Kobayashi, Y., Sakamoto, M., Kunieda, T., and Tachibana, M. (2002) A Mouse Model of Waardenburg Syndrome Type 4 with a New Spontaneous Mutation of the Endothelin-B Receptor Gene. Mamm Genome. 13, 30-35.

  13. Dunn, L. C., and Charles, D. R. (1937) Studies on Spotting Patterns I. Analysis of Quantitative Variations in the Pied Spotting of the House Mouse. Genetics. 22, 14-42.

  14. Lane, P. W. (1966) Association of Megacolon with Two Recessive Spotting Genes in the Mouse. J Hered. 57, 29-31.