Phenotypic Mutation 'Edinburg' (pdf version)
AlleleEdinburg
Mutation Type nonsense
Chromosome13
Coordinate20,290,383 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Elmo1
Gene Name engulfment and cell motility 1
Synonym(s) C230095H21Rik, 6330578D22Rik, CED-12
Chromosomal Location 20,090,596-20,608,353 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired Sertoli cell phagocytosis of apoptotic male germ cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_198093, NM_080288; MGI:2153044

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000072334] [ENSMUSP00000152595]
SMART Domains Protein: ENSMUSP00000072334
Gene: ENSMUSG00000041112
AA Change: E326*

DomainStartEndE-ValueType
Pfam:DUF3361 115 280 3.8e-64 PFAM
Pfam:ELMO_CED12 303 481 2.8e-42 PFAM
PH 555 676 2.32e0 SMART
low complexity region 704 717 N/A INTRINSIC
Predicted Effect probably null
Predicted Effect probably null
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
FACS B1 cells - increased
FACS B220 MFI - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD8+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - increased
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(20) : Gene trapped(16) Radiation induced(1) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Elmo1 APN 13 20261579 missense probably benign
IGL00814:Elmo1 APN 13 20286724 missense probably damaging 0.97
IGL00849:Elmo1 APN 13 20582323 nonsense probably null
IGL01417:Elmo1 APN 13 20251175 critical splice donor site probably null
IGL01994:Elmo1 APN 13 20342464 missense probably damaging 0.99
IGL02435:Elmo1 APN 13 20589656 missense probably damaging 1.00
IGL02605:Elmo1 APN 13 20605202 missense probably damaging 1.00
IGL02716:Elmo1 APN 13 20449502 missense probably damaging 0.98
IGL03389:Elmo1 APN 13 20342426 missense probably damaging 0.98
debil UTSW 13 20373161 missense probably damaging 1.00
sesame UTSW 13 20600212 nonsense probably null
H8562:Elmo1 UTSW 13 20280863 missense probably damaging 1.00
R0360:Elmo1 UTSW 13 20564493 nonsense probably null
R0364:Elmo1 UTSW 13 20564493 nonsense probably null
R0372:Elmo1 UTSW 13 20572459 critical splice donor site probably null
R0975:Elmo1 UTSW 13 20251137 missense probably damaging 0.98
R1167:Elmo1 UTSW 13 20185455 missense probably damaging 1.00
R1511:Elmo1 UTSW 13 20290477 missense possibly damaging 0.60
R1671:Elmo1 UTSW 13 20287884 splice site probably benign
R1677:Elmo1 UTSW 13 20589671 missense probably benign 0.22
R1868:Elmo1 UTSW 13 20589653 missense possibly damaging 0.78
R2941:Elmo1 UTSW 13 20600212 nonsense probably null
R3508:Elmo1 UTSW 13 20605232 missense probably damaging 1.00
R4344:Elmo1 UTSW 13 20261552 splice site probably null
R4378:Elmo1 UTSW 13 20373116 missense possibly damaging 0.96
R4423:Elmo1 UTSW 13 20600212 nonsense probably null
R4425:Elmo1 UTSW 13 20600212 nonsense probably null
R4516:Elmo1 UTSW 13 20282914 missense probably benign 0.11
R4862:Elmo1 UTSW 13 20449512 missense probably benign
R4990:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4991:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4992:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R5197:Elmo1 UTSW 13 20564437 missense probably benign 0.20
R5269:Elmo1 UTSW 13 20449486 missense probably benign 0.00
R5386:Elmo1 UTSW 13 20600210 missense probably benign 0.01
R5471:Elmo1 UTSW 13 20572385 missense probably benign 0.01
R5922:Elmo1 UTSW 13 20605169 missense probably damaging 1.00
R5947:Elmo1 UTSW 13 20290383 nonsense probably null
R6512:Elmo1 UTSW 13 20373161 missense probably damaging 1.00
R6531:Elmo1 UTSW 13 20572446 missense possibly damaging 0.91
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-01-05 8:26 AM by Diantha La Vine
Record Created 2018-02-16 12:46 PM by Anne Murray
Record Posted 2018-08-08
Phenotypic Description
Figure 1. Edinburg mice exhibit decreased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Edinburg mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Edinburg mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Edinburg mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Edinburg mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Edinburg mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Edinburg mice exhibit reduced B220 expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Edinburg phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5947, some of which showed reduced CD4 to CD8 T cell ratios (Figure 1) as well as reduced frequencies of B cells (Figure 2) and CD4+ T cells in CD3+ T cells (Figure 3) with concomitant increased frequencies of B1 cells (Figure 4), CD8+ T cells (Figure 5), and CD8+ T cells in CD3+ T cells (Figure 6), all in the peripheral blood. The expression of B220 on peripheral blood B cells was also reduced (Figure 7).

Nature of Mutation

Figure 8. Linkage mapping of the reduced B220 MFI phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 63 mutations (X-axis) identified in the G1 male of pedigree R5947. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the R4425 grandsire identified 63 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Elmo1:  a G to T transversion at base pair 20,290,383 (v38) on chromosome 13, or base pair 199,877 in the GenBank genomic region NC_000079. The strongest association was found with a recessive model of inheritance to the B220 expression on B cells phenotype, wherein seven variant homozygotes departed phenotypically from 12 homozygous reference mice and 21 heterozygous mice with a P value of 7.22 x 10-9 (Figure 8). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 1,314 in the mRNA sequence NM_080288 within exon 13 of 22 total exons.

 

1299 AGGGACATCATATTTGAACTTCGAAGAATTGCT

321  -R--D--I--I--F--E--L--R--R--I--A-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamic acid 326 for a premature stop codon (E326*) in the ELMO1 protein.

Protein Prediction
Figure 9. Domain organization of ELMO1. The location of the Edinburg mutation is indicated. Mutations found in the ELMO1 protein are shown in red. Click on each mutation for more information. Abbreviations: PH, pleckstrin homology domain; SH3, SH3-binding motif.

ELMO1 (engulfment and cell motility protein 1; alternatively, CED-12) has an ELMO domain (amino acids 391 to 492), a pleckstrin homology (PH) domain (amino acids 555 to 676), and a Pro-rich SH3-binding motif (amino acids 707 to 714) (Figure 9). Amino acids 536 to 557 and amino acids 679 to 697 are predicted to be α-helical regions. Amino acids 1 to 280 do not comprise a specific domain, but bind to RhoG (1), ezrin/radixin/moesin (ERM) proteins (2), and Salmonella IpgB1 (3).

 

The function of the ELMO domain is unknown. PH domains bind proteins such as the beta/gamma subunits of heterotrimeric G proteins and protein kinase C as well as phosphatidylinositol within biological membranes. PH domains recruit proteins to different membranes, thus targeting them to appropriate cellular compartments or enabling them to interact with other components of the signal transduction pathways. The ELMO domain, PH domain, SH3-binding motif, and the α-helical extension of the PH domain all mediate interaction between ELMO1 and DOCK180 (4-6). The interaction of ELMO1 with the DOCK180/Rac1 complex in trans stabilizes Rac1 in a nucleotide-free transition state (7).

 

ELMO1 is phosphorylated at several tyrosine residues. Src phosphorylates ELMO1 on tyrosine 724 (8). Src-mediated ELMO1 phosphorylation promotes cell spreading through Rac1 activation. Tyr18, Tyr216, Tyr511, Tyr395, and Tyr720 are phosphorylated by the Src family kinase Hck (9). Hck-mediated phosphorylation of ELMO1 promotes Rac1 activation.

 

The Edinburg mutation results in substitution of glutamic acid 326 for a premature stop codon (E326*) in the ELMO1 protein; residue 326 is within the ELMO domain. 

Expression/Localization

ELMO1 is ubiquitously expressed and localizes to the cytoplasm (NCBI).

Background
Figure 10. ELMO1 is an adaptor protein that interacts with several proteins, including DOCK180 and DOCK2. ELMO1 functions downstream of BAI1. BAI1 is able to interact with apoptotic cells directly as well as through accessory reseptors such as integrins and CD36. The interation triggers RHO-associated activities as well as activation of ELMO/DOCK pathway which subsequently leads to RAC-mediated reogranzation of actin filaments that assist phagocytosis of apoptotic cells. ELMO1 is essential for DOCK2-dependent lymphocyte migration. ELMO1 interacts with the ERM (ezrin/radixin/moesin) proteins. ERM proteins are involved in the generation of the migrating T cell uropod and in the anchoring of various transmembrane proteins (e.g., ICAMs, CD43, CD44, PSGL-1, and CD95/Fas) to the uropod.

ELMO1 is an adaptor protein that interacts with members of the DOCK family (see the records frazz, moonlight, and snowdrop for information about DOCK2, DOCK7, and DOCK8, respectively) to promote the activation of the small GTPase RAC, phagocytosis, and cell migration (Figure 10) (10-13).

 

ELMO1 functions downstream of the phagocytic receptor BAI1 (see the record for bunting) during apoptotic cell clearance (14;15). BAI1 functions in the recognition and subsequent internalization of apoptotic cells (15). In macrophages, BAI1 functions as a pattern recognition receptor in the phagocytic uptake of Gram-negative bacteria (15). BAI1 interacts with ELMO1, which subsequently activates DOCK180 (16). ELMO proteins engage DOCK180 in at least three different ways: (i) an ELMO proline-rich motif interacts with the DOCK180 SH3 domain (ii) the ELMO PH domain interacts with the nucleotide free Rac–DOCK complex; and (iii) elements within the last 100 residues of ELMO (distinct from the proline-rich motif) interact with elements within the first 357 residues of DOCK180 (distinct from the SH3 domain) (5;10;17). Interaction of ELMO with the SH3 domain relieves a steric inhibition within DOCK180 in which the SH3 domain interacts with the DOCK180 DHR-2 (DOCK homology region 2) domain to block Rac binding (17). ELMO1 also inhibits the ubiquitination of DOCK180, subsequently resulting in increased levels of DOCK180 (18).

 

ELMO1 is essential for DOCK2-dependent lymphocyte migration (19;20). In human T cells, the human immunodeficiency virus (HIV) Nef protein binds to the DOCK2-ELMO1 complex and inhibits T cell chemotaxis by promoting generalized instead of polarized Rac activation (21). CD4+ T cells from Elmo1-deficient (Elmo1-/-) mice exhibited impaired polarization, Rac activation, and chemotaxis in response to CCR7 and CXCR4 stimulation (19;20). After undergoing a selection process in primary lymphoid organs such as bone marrow and thymus, naive lymphocytes continually home from blood to secondary lymphoid organs (SLO), such as peripheral and mesenteric lymph nodes (PLN and MLN, respectively), spleen and gut-associated lymphoid tissue including Peyer's patches (PP). Inside SLO, T and B cells localize in T cell area and B cell follicles, respectively, where they screen antigen (Ag)-presenting cells for specific surface Ag complexes. Upon activation with cognate Ag in presence of costimulatory molecules, T and B cells undergo specific changes in microenvironmental positioning. These changes allow T–B cell interactions at the T cell area–B cell follicle border and in germinal center (GC) light zones to occur. Activated T and B cells eventually leave SLO to accumulate at sites of inflammation or other effector sites.  Lymphocyte migration is regulated by chemokines, integrins and adhesion receptors. DOCK2 mediates CCR7- and CXCR4-dependent Rac activation and chemotaxis.

 

ELMO1 functions in G-protein coupled receptor (GPCR)-mediated chemotaxis upon stimulation of CXCR4 (22). Activation of chemokine receptors [see the record for lanzhou for information about CCR7] promotes an interaction between ELMO1 and Gβγ, which causes translocation of ELMO1 to the membrane. ELMO1/DOCK180 subsequently activates Rac1.

 

ELMO1 mediates bacteria internalization and intestinal inflammation as well as autophagy induction and bacterial clearance during enteric infection (23;24). Elmo1-deficient macrophages showed reduced release of pro-inflammatory cytokines, reduced Rac1 activation, and impaired activation of NF-κB (see the record for Finlay), ERK1/2 (see the record for wabasha), and p38 MAP kinases (see the record for Wanzhou) after Salmonella infection (23). After Salmonella infection, ELMO1 regulates the acidification of phagolysosomes as well as the enzymatic activity of lysosomal enzymes (24).

 

ELMO1 interacts with the ERM (ezrin/radixin/moesin) proteins (2), which function in cell migration, cell adhesion, cell shape maintenance, and microvilli formation by cross-linking the plasma membrane with the actin cytoskeleton. ERM proteins are important players in signaling pathways regulated by Rho-family GTPases. These pathways control cell morphogenesis, adhesion, motility and proliferation in response to a variety of cellular stimuli. ERM proteins regulate B cell membrane raft dynamics and BCR clustering (25). ERM proteins are involved in cell cortex organization at two important stages of T lymphocyte physiology: during the polarization and migration in response to chemokines, and during the formation of the immunological synapse upon antigen recognition. During the formation of the immunological, the ERM proteins function in cell polarity during lymphocyte migration and in T cell-APC interactions. The ERM proteins also are critical for cell polarization during T lymphocyte migration. ERM proteins are involved in the generation of the migrating T cell uropod and in the anchoring of various transmembrane proteins (e.g., ICAMs, CD43, CD44 [see the record for Jialin], PSGL-1 and the death receptor CD95/Fas [see the record for cherry]) to the uropod.

 

The Mediator complex bridges the general transcription machinery with gene-specific regulatory proteins. ELMO1 interacts with the Mediator complex subunit Med31 and promotes the cytoplasmic localization of Med31 as well as Med31 ubiquitination (26). During Salmonella infection, ELMO1 and Med31 affect the expression of Il10 and Il33.

 

ELMO1 protects renal structure and ultrafiltration by reducing apoptosis during kidney development in the zebrafish (27). During the pathogenesis of chronic renal injury, ELMO1 dysregulates extracellular matrix (ECM) metabolism as well as reduces the cell adhesive properties of ECMs (28). Mutations in ELMO1 are associated with susceptibility to diabetic nephropathy (29-31). In type 1 diabetic Ins2Akita mice, reduced levels of ELMO1 alleviated albuminuria and caused changes to the glomerular histology, while increased levels of ELMO1 resulted in increased levels of oxidative stress markers and increased expression of fibrogenic genes (29).

 

Elmo1-deficient (Elmo1-/-; Elmo1tm1.2Ravi/tm1.2Ravi) mice are overtly normal (14). Elmo1-/- mice exhibited disrupted seminiferous epithelium, multinucleated giant cells, uncleared apoptotic germ cells, and decreased sperm output (14). A second Elmo1-/- mouse model (Elmo1tm1a(EUCOMM)Wtsi/tm1a(EUCOMM)Wtsi) exhibited reduced numbers of mature B cells, natural killer T cells, and CD4+ CD25+ regulatory T cells with concomitant increased numbers of effector memory CD4+ T cells. Some mice also exhibited decreased fasted circulating glucose levels.

Putative Mechanism

The immune phenotypes observed in the Edinburg mice indicate loss of ELMO1Edinburg function. The Edinburg mutation may alter the ability of ELMO1Edinburg to interact with the ERM proteins, namely during formation of the immunologial synapse after antigen recognition. Also, the interaction between ELMO1Edinburg and DOCK2 may be affected.

Primers PCR Primer
Edinburg(F):5'- GAGAGAGGCCTGAGTTCTAAC -3'
Edinburg(R):5'- TTCTGCAAAGCACAAGAGGAC -3'

Sequencing Primer
Edinburg_seq(F):5'- GTTCTAACTCAGGACACGACTTG -3'
Edinburg_seq(R):5'- ACACGTTCGATGCGACTGAG -3'
References
Science Writers Anne Murray
AuthorsXue Zhong, Jin Huk Choi, Evan Nair-Gill, Jianhui Wang, and Bruce Beutler