Phenotypic Mutation 'nerkkod' (pdf version)
Allelenerkkod
Mutation Type missense
Chromosome11
Coordinate78,173,059 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Nek8
Gene Name NIMA (never in mitosis gene a)-related expressed kinase 8
Chromosomal Location 78,166,106-78,176,675 bp (-)
MGI Phenotype FUNCTION: This gene encodes a NIMA-related kinase. Members of this serine/threonine protein kinase family are structurally-related to NIMA (never in mitosis, gene A) which controls mitotic signaling in Aspergillus nidulans. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display kidney cysts primarily in the cortex, progressive kidney enlargement, increased serum creatinine levels, impaired maternal nurturing, and premature death. Heterotaxy with congenital heart disease such as hypoplastic right ventricle and small tricuspid valve is seen. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_080849; MGI:1890646

Mapped Yes 
Amino Acid Change Methionine changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000017549] [ENSMUSP00000096145] [ENSMUSP00000127554]
SMART Domains Protein: ENSMUSP00000017549
Gene: ENSMUSG00000017405
AA Change: M40T

DomainStartEndE-ValueType
S_TKc 4 258 1.59e-81 SMART
low complexity region 288 316 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Pfam:RCC1 415 464 4.1e-12 PFAM
Pfam:RCC1_2 451 480 9.2e-10 PFAM
Pfam:RCC1 467 516 9.9e-16 PFAM
Pfam:RCC1 585 634 4.4e-15 PFAM
Pfam:RCC1 637 687 2e-11 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000017549)
SMART Domains Protein: ENSMUSP00000127554
Gene: ENSMUSG00000017405

DomainStartEndE-ValueType
Pfam:Pkinase 1 103 4.1e-20 PFAM
Pfam:Pkinase_Tyr 1 103 3.2e-12 PFAM
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
Blood Pressure: DBP Average - increased
Blood Pressure: DBP Day 1 - increased
Blood Pressure: DBP Day 2 - increased
Blood Pressure: DBP Day 3 - increased
Blood Pressure: MBP Average - increased
Blood Pressure: MBP Day 1 - increased
Blood Pressure: MBP Day 2 - increased
Blood Pressure: MBP Day 3 - increased
Blood Pressure: SBP Average - increased
Blood Pressure: SBP Day 1 - increased
Blood Pressure: SBP Day 2 - increased
Blood Pressure: SBP Day 3 - increased
Body Weight (BP Male) - decreased
Body Weight (BP) - decreased
Body Weight (DSS Male) - decreased
Body Weight (DSS) - decreased
DSS: sensitive day 10
DSS: sensitive day 7
FACS B220 MFI - decreased
FACS CD4:CD8 - increased
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - decreased
FACS effector memory CD4 T cells in CD4 T cells - decreased
FACS effector memory CD8 T cells in CD8 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) :  Chemically induced (ENU)(1) Chemically induced (other)(1)  Gene trapped(4) Spontaneous(1) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nek8 APN 11 78167827 missense probably damaging 0.96
IGL00914:Nek8 APN 11 78173075 missense possibly damaging 0.80
R0136:Nek8 UTSW 11 78171207 missense probably benign 0.01
R0490:Nek8 UTSW 11 78167729 missense probably benign 0.01
R0657:Nek8 UTSW 11 78171207 missense probably benign 0.01
R1033:Nek8 UTSW 11 78171285 missense probably null 1.00
R2848:Nek8 UTSW 11 78168141 missense probably damaging 1.00
R3406:Nek8 UTSW 11 78170746 nonsense probably null
R4211:Nek8 UTSW 11 78170483 missense probably benign
R4810:Nek8 UTSW 11 78167803 missense probably benign 0.00
R4811:Nek8 UTSW 11 78167718 splice site probably null
R5108:Nek8 UTSW 11 78172527 missense probably damaging 0.96
R5124:Nek8 UTSW 11 78172939 missense probably damaging 1.00
R5177:Nek8 UTSW 11 78170471 nonsense probably null
R5212:Nek8 UTSW 11 78172516 start codon destroyed probably null 0.02
R5386:Nek8 UTSW 11 78170437 unclassified probably null
R5921:Nek8 UTSW 11 78173059 missense probably damaging 1.00
R5977:Nek8 UTSW 11 78167825 missense probably benign 0.01
X0026:Nek8 UTSW 11 78168105 missense probably damaging 0.97
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2018-11-05 9:39 AM by Anne Murray
Record Created 2018-03-02 9:29 PM by Roberto Pontes
Record Posted 2018-11-05
Phenotypic Description

Figure 1. Nerkkod mice exhibited elevated mean blood pressures. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Nerkkod mice exhibited elevated systolic blood pressures. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Nerkkod mice exhibited elevated diastolic blood pressures. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Nerkkod mice exhibited susceptibility to DSS-induced colitis at day 7 after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Nerkkod mice exhibited susceptibility to DSS-induced colitis at day 10 after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Nerkkod mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Nerkkod mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Nerkkod mice exhibit decreased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Nerkkod mice exhibit decreased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Nerkkod mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Nerkkod mice exhibit reduced B220 expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The nerkkod phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5921, some of which showed elevated mean (Figure 1), systolic (Figure 2), and diastolic blood pressures (Figure 3) compared to wild-type littermates. Some mice showed susceptibility to dextran sulfate sodium (DSS)-induced colitis at day 7 (Figure 4) and 10 (Figure 5) after DSS treatment. The mice showed increased CD4 to CD8 T cell ratios (Figure 6) as well as reduced frequencies of CD8+ T cells in CD3+ T cells (Figure 7), effector memory CD4 T cells in CD4 T cells (Figure 8), and effector memory CD8 T cells in CD8 T cells (Figure 9) with concomitant increased frequencies of CD4+ T cells in CD3+ T cells (Figure 10), all in the peripheral blood. Expression of B220 was reduced on peripheral blood B cells (Figure 11).

Nature of Mutation

Figure 12. Linkage mapping of the elevated average mean blood pressure using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 68 mutations (X-axis) identified in the G1 male of pedigree R5921. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Nek8:  a T to C transition at base pair 78,173,059 (v38) on chromosome 11, or base pair 3,641 in the GenBank genomic region NC_000077. The strongest association was found with a recessive model of inheritance to the normalized average mean blood pressure, wherein 16 variant homozygotes departed phenotypically from 32 homozygous reference mice and 41 heterozygous mice with a P value of 6.673 x 10-17 (Figure 12).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive.  

 

The mutation corresponds to residue 179 in the mRNA sequence NM_080849 within exon 2 of 15 total exons.


 

163 ATCCCAGTGGAACAGATGACCAAAGAAGAGAGG

35  -I--P--V--E--Q--M--T--K--E--E--R-

 

The mutated nucleotide is indicated in red.  The mutation results in a methionine to threonine substitution at position 40 (M40T) in the NEK8 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 13. Domain structure of NEK8. The nerkkod mutation results in a methionine to threonine substitution at position 40. Abbreviations: RCC1, regulator of chromosome condensation-1.

NEK8 (alternatively, NPHP9 [nephrocystin protein-9]) is a member of the NEK family of serine/threonine kinases. The NEK kinases are related to the Aspergillus nidulans kinase NIMA (never in mitosis a), a kinase that functions in several aspects of mitosis including chromatin condensation, spindle organization, and nuclear envelope breakdown (1-6).

 

NEK8 has an N-terminal protein kinase domain, five RCC1 [regulator of chromosome condensation-1]-like domains, and a C-terminal coiled-coil (Figure 13) (7). The catalytic domains of NIMA and the mammalian NEK proteins differ in length, sequence, and organization, but they share 40-50% amino acid sequence identity (5;8). Phosphorylation of NEK8 at Thr162 within the catalytic domain is required for its function (9). The function of the RCC1-like domains is unknown. RCC1 is a guanine nucleotide exchange factor that is required for chromosome condensation; however, NEK8 does not exhibit guanine nucleotide exchange factor activity. Autophosphorylation of the RCC1-like region is required for NEK8 localization to centrosomes and cilia (9). The RCC1-like region is a seven-bladed β-propeller. One or more nuclear localization sequences are within the RCC1-like region (9). All of the NEK C-terminal domains contain a coiled-coil oligomerization motif that promotes autophosphorylation and activation of the protein (5).

 

The nerkkod mutation results in a methionine to threonine substitution at position 40 (M40T) in the NEK8 protein; Met40 is within the kinase domain.

Expression/Localization

NEK8 is highly expressed in the thyroid, adrenal gland, and skin and at lower levels in the spleen, colon, and uterus; NEK8 was not expressed in any other tissues examined (10). NEK8 localizes to the proximal segment of primary cilia of collecting tubules and collecting ducts, but NEK8 was not detected in cilia of proximal tubules, instead localizing to the cytoplasm (11). NEK8 also localizes to the nucleus (9).

Background
Figure 14. Primary cilia structure and function. NEK8 is a ciliary kinase that functions during organogenesis to promote renal and cardiovascular development as well as left-right patterning. Primary cilia sense extracelluar stimuli and relay them to the cytoplasm to initiate cell cycle regulation, cytoskeleton development, and various cell-survival pathways. Cation channels composed of the polycystin proteins Pc1 and Pc2 in the ciliary membrane sense mechanical stress, while receptors such as the platelet-derived growth factor receptor α (Pdgfrα) sense extracellular ligands. Members of the nephronophthisis protein family [Nphp, inversin (Invs)] and proteins associated with Bardet-Biedl syndrome (BBS) process and transfer signaling information to the cell. The primary cilia-associated signals activate several signaling pathways, including the hedgehog, canonical Wnt, and non-canonical Wnt/planar cell polarity (PCP) pathways. Abbreviations: Dvl1, dishevelled; Nek8, NIMA-related kinase 8; Ofd1, oral-facial-digital type 1 protein; Pcm1, pericentriolar material protein 1. Figure and legend adapted from Bisgrove and Yost (2006). This image is interactive. Click on the image to view other mutations found in the structure. Click on each mutation for more information.

Eleven members of the NEK family of kinases have been identified to date (12). The NEK kinases have diverse functions including roles in ciliary development (NEK1 and NEK8) (13;14), regulation of the centrosome (NEK2 and NEK7 [see the record for Cuties]) (15), control of mitotic spindle formation (NEK9, Nercc1, and NEK7) (16), regulation of mitosis (NEK6 and NEK7) (17;18), and NLRP3 inflammasome function (NEK7) (19).

 

NEK8 is a ciliary kinase that functions during organogenesis to promote renal and cardiovascular development as well as left-right patterning (Figure 14) (20). Almost every cell in the body carries a single primary cilium at a certain stage of its life cycle. Primary cilia are required for planar cell polarity, phototransduction, olfaction, adipocyte differentiation, and Hedgehog signaling. NEK8 putatively regulates ciliary biogenesis through targeting of proteins to the cilia (21). Several events occur to facilitate transport of membrane proteins to the cilia: (a) sorting and packaging into carrier vesicles, (b) docking and fusion of vesicles with the base of the cilium, and (c) intraflagellar transport (IFT) from the cilia base to cilia tip. NEK8 regulates the expression and localization of the ciliary proteins polycystin-1 (PC-1) and PC-2 (see the record for Nephro) (11). The PC proteins are calcium-permeable nonselective cation channels that function at several locations including the primary cilia, basolateral membrane, and the endoplasmic reticulum to subsequently mediate proliferation, apoptosis, tubulogenesis, and fluid secretion through the regulation of calcium transport and calcium signaling. PC-2, often together with PC-1, responds to physical or chemical stimuli (e.g., fluid flow) to stimulate calcium influx through PC-2, subsequently resulting in calcium release from intracellular stores. ANKS6 (ankyrin repeat and SAM domain-containing protein 6) is a target and activator of NEK8 (22;23). NEK8 phosphorylates ANKS6 and promotes the proper localization of ANKS6 to the ciliary inversin compartment (23). ANKS6-mediated activation of NEK8 is essential for embryonic situs determination and organ patterning. ANKS3, cortactin, α-tubulin 1A, myosin Va, ribosomal protein L12, and ARP5-like were also identified as NEK8 protein interactors, but are not predicted to be substrates of NEK8.

 

NEK8 has several functions in addition to its function as a ciliary kinase: (i) NEK8 putatively regulates the cytoskeletal structure in kidney tubule epithelial cells. (ii) NEK8 regulates the cell cycle through the Hippo signaling pathway (24). The Hippo pathway restricts cell proliferation and promotes apoptosis during development, growth, repair, and homeostasis by inducing the expression of target genes involved in cell proliferation, cell death, and cell migration. Please see the record hallon for more information about Hippo signaling. (iii) NEK8 functions in ATR-mediated replication stress responses to suppress DNA double-strand breaks (DSB) (25). NEK8 promotes replication fork progression, suppresses aberrant origin firing, and stabilizes stalled forks. NEK8-deficient cells form spontaneous DNA double-strand breaks, exhibit reduced fork rates, and increased replication fork collapse. NEK8 suppresses DSBs by limiting cyclin A-associated CDK activity. NEK8 interacts with cyclin A-CDK complexes and regulates their protein levels. NEK8 also mediates DNA damage-induced RAD51 foci formation (26). NEK8 was also required for proper replication fork protection following replication stall with hydroxyurea. (iv) NEK8 promotes the nuclear delivery and activation of the oncogenic transcriptional regulator TAZ (27). NEK8 and 14-3-3 compete in binding to TAZ, with 14-3-3 promoting cytoplasmic retention and NEK8 promoting nuclear transport. Downregulation of NEK8 expression inhibited TAZ-associated proliferation of normal epithelial and breast cancer cells.

 

Mutations in NEK8 are associated with nephronophthisis-9 [OMIM: #613824; (21)] and renal-hepatic-pancreatic dysplasia-2 [OMIM: #615415; (22;28;29)]. Nephronophthisis-9 is an autosomal recessive kidney disease that leads to kidney cyst formation and progressive renal failure. Renal-hepatic-pancreatic dysplasia-2 is a multisystemic disorder that often results in fetal death or death in infancy. Renal-hepatic-pancreatic dysplasia-2 is caused by loss of NEK8-mediated regulation of the Hippo signaling effector YAP and expression of its target genes (22). NEK8 mutations are also putatively linked to pancreatic cancer (30), and NEK8 is overexpressed in human breast cancer (31).

 

Nek8-deficient (and Nek8 mutant) mice exhibited death by 20 weeks of age (32;33). Other Nek8-/- models died shortly after birth (34). The mice also showed enlarged kidneys, kidney cysts, dilated kidney collecting ducts, edema, dilated proximal convoluted tubules, heart right ventricle hypoplasia, heterotaxia, right pulmonary isomerism, and situs inversus [(32-35) and MGI]. The kidneys from the Nek8-/- mice were functional (34).

Putative Mechanism

The links between the phenotypes observed in the nerkkod mice and the Nek8 mutation are undetermined. Left-right asymmetry in the nerkkod mice has not been examined, but the heart/blood pressure-related phenotypes may be due to aberrant left-right symmetry. Nek8-/- mice showed edema, heart right ventricle hypoplasia, right pulmonary isomerism, and situs inversus [(32-35) and MGI]. The immune cell-associated phenotype may be due to deficient NEK8-associated Hippo signaling. Mice deficient in STK4 (see the record for hallon), a factor associated with Hippo signaling, show progressive loss of T and B cells due to excessive apoptosis (36;37).

Primers PCR Primer
nerkkod(F):5'- AACTCTGTACGTCTGGCCTC -3'
nerkkod(R):5'- GCCCCGCTTAATCATCTCAG -3'

Sequencing Primer
nerkkod_seq(F):5'- AATGGTGTCCGGCTCTCCTG -3'
nerkkod_seq(R):5'- ATCATCTCAGAACTGTGTGGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsRoberto Pontes and Bruce Beutler