Allele | nerkkod | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 11 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 78,063,885 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ G (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Nek8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | NIMA (never in mitosis gene a)-related expressed kinase 8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | 4632401F23Rik, b2b1449Clo | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 78,056,932-78,067,501 bp (-) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: This gene encodes a NIMA-related kinase. Members of this serine/threonine protein kinase family are structurally-related to NIMA (never in mitosis, gene A) which controls mitotic signaling in Aspergillus nidulans. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygous mutant mice display kidney cysts primarily in the cortex, progressive kidney enlargement, increased serum creatinine levels, impaired maternal nurturing, and premature death. Heterotaxy with congenital heart disease such as hypoplastic right ventricle and small tricuspid valve is seen. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Methionine changed to Threonine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000017549] [ENSMUSP00000127554] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q91ZR4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000017549 Gene: ENSMUSG00000017405 AA Change: M40T
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000127554 Gene: ENSMUSG00000017405
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.2704 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably essential (E-score: 0.903) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(9) : Chemically induced (ENU)(1) Chemically induced (other)(1) Gene trapped(4) Spontaneous(1) Targeted(2) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:37 PM by Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2018-03-02 9:29 PM by Roberto Pontes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-11-05 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The nerkkod phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5921, some of which showed elevated mean (Figure 1), systolic (Figure 2), and diastolic blood pressures (Figure 3) compared to wild-type littermates. Some mice showed susceptibility to dextran sulfate sodium (DSS)-induced colitis at day 7 (Figure 4) and 10 (Figure 5) after DSS treatment. The mice showed increased CD4 to CD8 T cell ratios (Figure 6) as well as reduced frequencies of CD8+ T cells in CD3+ T cells (Figure 7), effector memory CD4 T cells in CD4 T cells (Figure 8), and effector memory CD8 T cells in CD8 T cells (Figure 9) with concomitant increased frequencies of CD4+ T cells in CD3+ T cells (Figure 10), all in the peripheral blood. Expression of B220 was reduced on peripheral blood B cells (Figure 11). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Nek8: a T to C transition at base pair 78,173,059 (v38) on chromosome 11, or base pair 3,641 in the GenBank genomic region NC_000077. The strongest association was found with a recessive model of inheritance to the normalized average mean blood pressure, wherein 16 variant homozygotes departed phenotypically from 32 homozygous reference mice and 41 heterozygous mice with a P value of 6.673 x 10-17 (Figure 12). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive. The mutation corresponds to residue 179 in the mRNA sequence NM_080849 within exon 2 of 15 total exons.
The mutated nucleotide is indicated in red. The mutation results in a methionine to threonine substitution at position 40 (M40T) in the NEK8 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
NEK8 (alternatively, NPHP9 [nephrocystin protein-9]) is a member of the NEK family of serine/threonine kinases. The NEK kinases are related to the Aspergillus nidulans kinase NIMA (never in mitosis a), a kinase that functions in several aspects of mitosis including chromatin condensation, spindle organization, and nuclear envelope breakdown (1-6). NEK8 has an N-terminal protein kinase domain, five RCC1 [regulator of chromosome condensation-1]-like domains, and a C-terminal coiled-coil (Figure 13) (7). The catalytic domains of NIMA and the mammalian NEK proteins differ in length, sequence, and organization, but they share 40-50% amino acid sequence identity (5;8). Phosphorylation of NEK8 at Thr162 within the catalytic domain is required for its function (9). The function of the RCC1-like domains is unknown. RCC1 is a guanine nucleotide exchange factor that is required for chromosome condensation; however, NEK8 does not exhibit guanine nucleotide exchange factor activity. Autophosphorylation of the RCC1-like region is required for NEK8 localization to centrosomes and cilia (9). The RCC1-like region is a seven-bladed β-propeller. One or more nuclear localization sequences are within the RCC1-like region (9). All of the NEK C-terminal domains contain a coiled-coil oligomerization motif that promotes autophosphorylation and activation of the protein (5). The nerkkod mutation results in a methionine to threonine substitution at position 40 (M40T) in the NEK8 protein; Met40 is within the kinase domain. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | NEK8 is highly expressed in the thyroid, adrenal gland, and skin and at lower levels in the spleen, colon, and uterus; NEK8 was not expressed in any other tissues examined (10). NEK8 localizes to the proximal segment of primary cilia of collecting tubules and collecting ducts, but NEK8 was not detected in cilia of proximal tubules, instead localizing to the cytoplasm (11). NEK8 also localizes to the nucleus (9). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
Eleven members of the NEK family of kinases have been identified to date (12). The NEK kinases have diverse functions including roles in ciliary development (NEK1 and NEK8) (13;14), regulation of the centrosome (NEK2 and NEK7 [see the record for Cuties]) (15), control of mitotic spindle formation (NEK9, Nercc1, and NEK7) (16), regulation of mitosis (NEK6 and NEK7) (17;18), and NLRP3 inflammasome function (NEK7) (19). NEK8 is a ciliary kinase that functions during organogenesis to promote renal and cardiovascular development as well as left-right patterning (Figure 14) (20). Almost every cell in the body carries a single primary cilium at a certain stage of its life cycle. Primary cilia are required for planar cell polarity, phototransduction, olfaction, adipocyte differentiation, and Hedgehog signaling. NEK8 putatively regulates ciliary biogenesis through targeting of proteins to the cilia (21). Several events occur to facilitate transport of membrane proteins to the cilia: (a) sorting and packaging into carrier vesicles, (b) docking and fusion of vesicles with the base of the cilium, and (c) intraflagellar transport (IFT) from the cilia base to cilia tip. NEK8 regulates the expression and localization of the ciliary proteins polycystin-1 (PC-1) and PC-2 (see the record for Nephro) (11). The PC proteins are calcium-permeable nonselective cation channels that function at several locations including the primary cilia, basolateral membrane, and the endoplasmic reticulum to subsequently mediate proliferation, apoptosis, tubulogenesis, and fluid secretion through the regulation of calcium transport and calcium signaling. PC-2, often together with PC-1, responds to physical or chemical stimuli (e.g., fluid flow) to stimulate calcium influx through PC-2, subsequently resulting in calcium release from intracellular stores. ANKS6 (ankyrin repeat and SAM domain-containing protein 6) is a target and activator of NEK8 (22;23). NEK8 phosphorylates ANKS6 and promotes the proper localization of ANKS6 to the ciliary inversin compartment (23). ANKS6-mediated activation of NEK8 is essential for embryonic situs determination and organ patterning. ANKS3, cortactin, α-tubulin 1A, myosin Va, ribosomal protein L12, and ARP5-like were also identified as NEK8 protein interactors, but are not predicted to be substrates of NEK8. NEK8 has several functions in addition to its function as a ciliary kinase: (i) NEK8 putatively regulates the cytoskeletal structure in kidney tubule epithelial cells. (ii) NEK8 regulates the cell cycle through the Hippo signaling pathway (24). The Hippo pathway restricts cell proliferation and promotes apoptosis during development, growth, repair, and homeostasis by inducing the expression of target genes involved in cell proliferation, cell death, and cell migration. Please see the record hallon for more information about Hippo signaling. (iii) NEK8 functions in ATR-mediated replication stress responses to suppress DNA double-strand breaks (DSB) (25). NEK8 promotes replication fork progression, suppresses aberrant origin firing, and stabilizes stalled forks. NEK8-deficient cells form spontaneous DNA double-strand breaks, exhibit reduced fork rates, and increased replication fork collapse. NEK8 suppresses DSBs by limiting cyclin A-associated CDK activity. NEK8 interacts with cyclin A-CDK complexes and regulates their protein levels. NEK8 also mediates DNA damage-induced RAD51 foci formation (26). NEK8 was also required for proper replication fork protection following replication stall with hydroxyurea. (iv) NEK8 promotes the nuclear delivery and activation of the oncogenic transcriptional regulator TAZ (27). NEK8 and 14-3-3 compete in binding to TAZ, with 14-3-3 promoting cytoplasmic retention and NEK8 promoting nuclear transport. Downregulation of NEK8 expression inhibited TAZ-associated proliferation of normal epithelial and breast cancer cells. Mutations in NEK8 are associated with nephronophthisis-9 [OMIM: #613824; (21)] and renal-hepatic-pancreatic dysplasia-2 [OMIM: #615415; (22;28;29)]. Nephronophthisis-9 is an autosomal recessive kidney disease that leads to kidney cyst formation and progressive renal failure. Renal-hepatic-pancreatic dysplasia-2 is a multisystemic disorder that often results in fetal death or death in infancy. Renal-hepatic-pancreatic dysplasia-2 is caused by loss of NEK8-mediated regulation of the Hippo signaling effector YAP and expression of its target genes (22). NEK8 mutations are also putatively linked to pancreatic cancer (30), and NEK8 is overexpressed in human breast cancer (31). Nek8-deficient (and Nek8 mutant) mice exhibited death by 20 weeks of age (32;33). Other Nek8-/- models died shortly after birth (34). The mice also showed enlarged kidneys, kidney cysts, dilated kidney collecting ducts, edema, dilated proximal convoluted tubules, heart right ventricle hypoplasia, heterotaxia, right pulmonary isomerism, and situs inversus [(32-35) and MGI]. The kidneys from the Nek8-/- mice were functional (34). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The links between the phenotypes observed in the nerkkod mice and the Nek8 mutation are undetermined. Left-right asymmetry in the nerkkod mice has not been examined, but the heart/blood pressure-related phenotypes may be due to aberrant left-right symmetry. Nek8-/- mice showed edema, heart right ventricle hypoplasia, right pulmonary isomerism, and situs inversus [(32-35) and MGI]. The immune cell-associated phenotype may be due to deficient NEK8-associated Hippo signaling. Mice deficient in STK4 (see the record for hallon), a factor associated with Hippo signaling, show progressive loss of T and B cells due to excessive apoptosis (36;37). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer nerkkod_pcr_F: AACTCTGTACGTCTGGCCTC nerkkod_pcr_R: GCCCCGCTTAATCATCTCAG Sequencing Primer nerkkod_seq_F: AATGGTGTCCGGCTCTCCTG nerkkod_seq_R: ATCATCTCAGAACTGTGTGGC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 418 nucleotides is amplified (chromosome 11, - strand): 1 gccccgctta atcatctcag aactgtgtgg ctctgggccg ctctaatcta acgtgtggct Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Roberto Pontes and Bruce Beutler |