Phenotypic Mutation 'toffee'

• Allele: toffee
• Mutation Type: intron (2 bp from exon)
• Chromosome: 7
• Coordinate: 46,777,075 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Hps5
• Gene Name: HPS5, biogenesis of lysosomal organelles complex 2 subunit 2
• Synonym(s): Hermansky-Pudlak syndrome 5, ru-2, ru2, ruby eye 2
• Chromosomal Location: 46,409,890-46,445,488 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes have hypopigmented eyes and hair, impaired secretion of lysosomal enzymes by renal proximal tubules and reduced clotting due to a platelet dense granule defect. Homozygotes for one allele are less susceptible to diet-induced atherosclerosis. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P59438
• SMART Domains: Protein: ENSMUSP00000014562; Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1jjub_	44	192	3e-8	SMART
Blast:WD40	63	103	7e-21	BLAST
Blast:WD40	111	151	1e-19	BLAST
low complexity region	429	449	N/A	INTRINSIC
low complexity region	775	786	N/A	INTRINSIC
low complexity region	989	998	N/A	INTRINSIC
low complexity region	1021	1033	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000103280; Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1jjub_	44	192	3e-8	SMART
Blast:WD40	63	103	6e-21	BLAST
Blast:WD40	111	151	1e-19	BLAST
low complexity region	396	416	N/A	INTRINSIC
low complexity region	742	753	N/A	INTRINSIC
low complexity region	956	965	N/A	INTRINSIC
low complexity region	988	1000	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000103281; Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1jjub_	44	192	3e-8	SMART
Blast:WD40	63	103	7e-21	BLAST
Blast:WD40	111	151	1e-19	BLAST
low complexity region	429	449	N/A	INTRINSIC
low complexity region	775	786	N/A	INTRINSIC
low complexity region	989	998	N/A	INTRINSIC
low complexity region	1021	1033	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000122887; Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1jjub_	44	192	8e-8	SMART
Blast:WD40	63	103	9e-20	BLAST
Blast:WD40	111	151	2e-19	BLAST
low complexity region	429	449	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000119876; Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
low complexity region	241	252	N/A	INTRINSIC
low complexity region	417	426	N/A	INTRINSIC
low complexity region	449	461	N/A	INTRINSIC

• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.113)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, Sperm, gDNA
• Last Updated: 2019-06-25 6:31 PM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2008-01-18
• Science Writers: Alyson Mack, Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Celine Eidenschenk, Sophie Rutschmann, Amanda L. Blasius, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001005247; MGI: 2180307

Alleles Listed at MGI

All alleles(62) : Gene trapped(53) Spontaneous(6) Chemically induced(3)

Repository

none

Phenotypic Description

The toffee phenotype was identified among ENU-mutagenized G3 mutant mice by their hypopigmented fur. Toffee mice have gray fur, dark red eyes, and pink feet, tails and ears (Figure 1). Like the souris, sooty, salt and pepper and bullet gray strains, toffee mice display enhanced susceptibility to infection with mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen) or Listeria monocytogenes. Toffee mice resemble mice of the ruby-eye 2 (ru2) strain; toffee is allelic to ru2 (1;2).

Toffee mice also display reduced type I interferon (IFN) responses to CpG DNA challenge in vivo (Figure 2) (3). This screen is designed to identify mutations that specifically affect plasmacytoid dendritic cell (pDC) development and function as pDCs are the primary type I IFN producing cell type in response to Toll-like receptor 9 (TLR9), which senses CpG DNA. 

Nature of Mutation

The toffee mutation corresponds to a T to C transition in the donor splice site of intron 9 (GTAATT->GCAATT) of the Hps5 gene on Chromosome 7 (position 16609 in the Genbank genomic region NC_000073 for linear DNA sequence of Hps5). The mutation destroys the splice site and results in the usage of a downstream sequence within intron 9 for splicing. Thus, 23 aberrant nucleotides from the 5’ sequence of intron 9 are inserted into the Hps5 transcript, also destroying the reading frame of the sequence following the insertion. Hps5 contains 23 exons.

 

       <--exon 9 intron 9-->                   exon 10-->

16599 gaagtcaagg gtaattatatttttctttctaaggtaact……ATATTCAGGATGTAG 17480

326   -E--V--K-- G--N--Y--I--F--L--S--K-        -I--F--R--M--*  340

         correct     inserted sequence               aberrant

 

The donor splice site of intron 9 is indicated in blue lettering; the mutated nucleotide is indicated in red lettering; the new splice site is highlighted in gray.

Protein Prediction

Figure 3. A, Predicted domains of HPS5. HPS5 contains two putative WD40 domains located at amino acids 65-105 and 113-153. The toffee mutation, located in intron 9, causes the insertion of aberrant sequence after amino acid 328 and a frameshift resulting in premature truncation. Click on the image to view other mutations found in HPS5. Click on each mututation for more specific information. B, Components of the biogenesis of lysosomal-related organelle complex 2 (BLOC-2). All three proteins have been shown to co-immunoprecipitate, but only HSP5 and HSP6 bind together in two-hybrid studies suggesting the presence of unknown components of the complex (?). Figure is adapted from (34). This image is interactive.

HPS5 is an 1126 amino acid protein that forms part of the biogenesis of lysosome-related organelle complex 2 (BLOC-2; see Figure 2 and Background). Mouse and human HPS5 are 81% identical. Lower eukaryotes such as yeast do not have an apparent homologous protein (4). The Drosophila homolog of Hps5 was recently demonstrated to be the gene pink (p), a member of the “granule group” of genes that affect eye color by controlling protein trafficking to pigment granules in the fly eye (5;6). Other than the putative presence (with low statistical likelihood) of two WD40 domains at amino acids 65-105 and 113-153, sequence analysis of HPS5 reveals no known protein domains (4). WD40 domains, typically occurring in sets of 4-8 in a single protein, are protein interaction motifs that generally form antiparallel β sheets arranged like the blades of a propeller.

 

At least three alternatively spliced HPS5 transcripts have been reported and confirmed in humans (4;7). The full length isoform consists of 23 exons, with its start codon in exon 2, and encodes an 1129 amino acid protein designated HPS5A. The second and third splice variants both encode HPS5B, lacking the first 114 amino acids, but otherwise identical to HPS5A. Exon 2 is missing from the second splice variant, while exon 2 and part of exon 1 are missing from the third splice variant; in both variants the start codon is found in exon 5 (7). It is unclear whether these alternatively splice transcripts are expressed.

 

The toffee mutation results in the insertion of 23 aberrant nucleotides after the normal exon 9 sequence, and destroys the reading frame of the transcript following the insertion. Several mutations in human HPS5 resulting in frameshifts 3’ to the toffee mutation, and at least two point mutations, cause disease in humans (4;7). The bulk of the protein encoded by the toffee allele is altered, and probably results in a completely non-functional protein.

Expression/Localization

Northern blot analysis reveals Hps5 transcript in all tissues examined, including heart, brain, placenta, spleen, lung, liver, skeletal muscle, kidney, pancreas and testes (4;7).

 

Using primers spanning all three human HPS5 variants, RT-PCR analysis demonstrates expression of each variant in all tissues tested (heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas) (7). However, expression patterns appear to differ for each transcript, with variant 1 highly expressed in lung and testis, variant 2 in placenta, kidney, testis and ovary, and variant 3 in placenta, lung and thymus (7).

 

Because HPS6, an HPS5 interactor, can be immunoprecipitated from both membrane-associated and soluble fractions of cell lysates, it has been inferred that all components of the BLOC-2 complex including HPS5 may be both cytosolic and membrane-associated (8).

Background

HPS5 was originally identified in two independent screens. One screen searched a human brain cDNA library for cDNA clones predicted to encode proteins larger than 50kD. Among 100 cDNA clones, KIAA1017 (HPS5) was 4147 bp in length and was predicted to encode a protein of 1015 amino acids, encoded by a gene located on human Chromosome 11 (9). A second screen used yeast two-hybrid testing of a human placental cDNA library to search for interactors of a conserved region of the cytoplasmic domain of the integrin a3A subunit, and identified four cDNAs (10). One of these, designated clone 63, contained the partial sequence of HPS5. Sequence analysis of clone 63 cDNA and protein revealed several putative phosphorylation sites for PKA, PKC and CK2, several putative myristoylation sites, but no similarity or homology to any known motif (10).

 

Several years after these discoveries, mutations of HPS5 were identified as the cause of the ruby-eye 2 (ru2) phenotype in mice and Hermansky-Pudlak syndrome 5 (HPS5) in humans. HPS (OMIM #203300) was first described in 1959, and is now known to be a heterogeneous disorder with an array of clinical symptoms caused by alterations at numerous independent loci. HPS is characterized by oculocutaneous albinism (OCA), prolonged bleeding, and pulmonary fibrosis, conditions that arise from defects in the biogenesis and/or function of so-called lysosome-related organelles, such as melanosomes and platelet dense granules (11). These organelles are cell-type specific modifications of the post-Golgi endomembrane system, and may share various characteristics with lysosomes, such as integral membrane proteins and an acidic intralumenal pH (12).

 

At least eight types of human HPS have been described, and mutations affecting at least 15 loci in mice create HPS-like disease. The human HPS loci and their mouse equivalents are as follows: HPS1/pale ear (13); HPS2/pearl (mutated in bullet gray) (14); HPS3/cocoa (mutated in pam gray) (15); HPS4/light ear (16); HPS5/ruby-eye 2 (4); HPS6/ruby-eye (mutated in stamper-coat) (4); HPS7/sandy (mutated in salt and pepper) (17); and HPS8/putatively reduced pigmentation (18). While all HPS patients suffer from OCA and prolonged bleeding, different subtypes of HPS are now recognized by their distinct clinical features. HPS5 (OMIM *607521) patients, of which five have been reported, exhibit decreased visual acuity, nystagmus and a lack of platelet dense bodies, but variable pigment dilution and only mild extra-ocular symptoms such as bruising (4;7). No pulmonary dysfunction is observed. Notably, all of the patients displayed elevated cholesterol levels, although the relation of this symptom to HPS5 mutation is unknown (7).

 

The mutant ruby-eye 2 phenotype in mice was named for its resemblance to the ruby-eye phenotype, characterized by diluted coat color that darkens with age, colorless eyes that darken with age to a ruby or maroon color, and platelet storage pool deficiency that causes prolonged bleeding time (3;19;20). Although platelet numbers are normal, platelets are unable to accumulate dense granule contents resulting in decreased serotonin  (34). Melanosomes are decreased in number and some have aberrant morphology in both ru and ru2 eye and skin cells (4;21). In addition, mutant melanosomes are generally more spherical than oval in shape, probably indicating a block at more immature stages of melanosome maturation (21;22). Both ru and ru2 mice have abnormally high concentrations of kidney lysosomal enzymes due to a decreased rate of lysosomal enzyme secretion from kidney to urine, despite normal kidney lysosome morphology (23). In contrast, lysosomal secretion from ru skin fibroblasts is normal (8). Finally, ru and ru2 mice exhibit reduced susceptibility to atherosclerosis compared to control mice after 14 weeks of maintenance on an atherogenic diet (24), an interesting finding in light of the increased serum cholesterol levels in human HPS5 patients (7). The Hps5^ru2 allele contains a 1.0 kb insertion of the histone H2A sequence into exon 18, and an eight-nucleotide duplication 3’ of the insertion (4).

 

Most of the genes associated with HPS encode subunits of protein complexes involved in intracellular trafficking. Based on biochemical studies, it has been proposed that HPS proteins assemble into four stable complexes, BLOCs 1, 2, and 3, and the adaptor protein 3 (AP-3) complex (Figure 3). BLOC-2 has an approximate mass of 350 kD and has been shown to consist of HPS3, HPS5 and HPS6 by yeast two-hybrid and coimmunoprecipitation analysis (4;8;25). This interaction is supported by the similarity of phenotypes of ru and ru2 mice, and HPS3, -5, and -6 patients. In addition, it has been shown that the three-amino acid deletion in the Hps6^ru allele abolishes the interaction of HPS6 with HPS5 (25). However, in one yeast two-hybrid test, neither HPS5 nor HPS6 interacted with HPS3 (4).

Putative Mechanism

The precise molecular function of the BLOC-2 complex remains unknown. In addition to a yet undefined role in regulating lysosome and lysosome-related organelle secretion, a recent study suggests that HPS5 may also regulate protein trafficking during the maturation of melanosomes (26). Both tyrosinase (mutated in ghost) and Tyrp1 (tyrosinase-related protein-1) are reduced in HPS5 mutant melanocyte dendrites as measured by immunofluorescence and immunoelectron microscopy. In addition, HPS5 mutant melanosomes are predominantly in the early stages of maturation, suggesting that improper trafficking of melanosome proteins impairs the normal maturation of this organelle (27). In agreement with this hypothesis, BLOC-1 has been shown to physically interact with BLOC-2 to facilitate Tyrp1 trafficking (28). Another study demonstrates that BLOC-1 regulates Tyrp1 exit from early endosomes toward melanosomes, but interestingly, BLOC-2 affects Tyrp1 trafficking to melanosomes from an endosomal compartment distinct and downstream from that regulated by BLOC-1 (29). Thus, accumulating evidence suggests a role for BLOC-2, and presumably HPS5, in regulating selective cargo trafficking from endosomes to melanosomes. The step(s) at which BLOC-2 functions and the compartments between which cargo is transferred remain to be more precisely defined.

 

Mutations in some HPS proteins cause immunodeficiency, as observed in toffee and spp mice (which harbor a mutation in dysbindin, a BLOC-1 complex component). In HPS2, mutation of the β3A subunit of the AP-3 complex results in immunodeficiency because of defects in NK cells, cytotoxic T lymphocytes (CTLs) and neutrophils (see bullet gray) (30-34). Interestingly, BLOC-1 complex mutant mice pallid, muted and sandy have normal CTL function, as measured by ability to kill targets (35). The cause of susceptibility to MCMV and Listeria monocytogenes infections in toffee mice has not been investigated. Immune functions have not been tested in ru2 mice, but CTL function is normal in ru mice (35).

 

The defect in type I IFN response to CpG displayed by toffee mice suggest a specific defect in pDCs, which are the primary type I IFN producing cells in vivo during most viral infections (36). As components of the innate immune system, these cells express endosomally-localized TLR7  and TLR9, which enable the detection of internalized viral and bacterial nucleic acids, such as ssRNA (via TLR7) or CpG DNA (via TLR9).  TLR7 and 9 signaling occurs via the adaptor protein myeloid differentiation (MyD) 88 (see pococurante and lackadaisical) resulting in the activation of the NF-κB pathway and production of proinflammatory cytokines such as TNF-α (see panr1), as well as the production of large amounts of type I IFN.  Type I IFNs are pleiotropic anti-viral proteins mediating a wide range of effects. Both TNF-α and type I IFN production by pDCs depends on components of the MyD88 signaling pathway including interleukin receptor associated kinase (IRAK)-1 and IRAK-4 (see otiose), interferon response factor (IRF) 5, TNF receptor–associated factor 6 (TRAF6), inhibitor of kappa-B kinase-α (IKKα), osteopontin, and IRF7 (see the record for inept) [reviewed in (37;38)].  The multispanning ER membrane protein UNC93B (mutated in 3d), which is required for trafficking of TLRs 3, 7, and 9 to the endosomal compartment (39), is also necessary for pDCs to sense nucleic acids. pDCs from TLR9-deficient or TLR7-deficient mice (see records for CpG1 and rsq1) fail to produce type I IFN in response to various viral and bacterial pathogens [reviewed by (40)].  An acidic endosomal environment has been shown to be essential for appropriate TLR7 and TLR9 signaling (41-43).

 

LROs share various characteristics with lysosomes and endolysosomes, such as an acidic intralumenal pH (44), and it is possible that trafficking and biogenesis of the endosomal or similar compartment in pDCs is also dependent on HPS proteins. Indeed, mice with mutations in the β3A subunit of the AP-3 complex, and HPS5 also display a defect in pDC function (2), and analysis of DC generated from pearl homozygous mice with a mutation in Ap3b1 suggests that AP-3 is required for the type I IFN response by trafficking TLR9 to a specialized subcellular compartment  (44).  (45). Interestingly, the pDC-specific phenotypes identified in mice with mutations in HPS genes parallel those found in mice homozygous for a mutation in Slc15a4 (see the record for feeble), which encodes PHT1, a proton-dependent oligopeptide transporter (2). PHT1 contains a typical acidic di-leucine motif required for AP-3 transport. PHT1 may regulate endosomal TLR7 and TLR9 signaling either by transporting a critical component into or out of the endosome, or by maintaining the appropriate pH necessary for TLR activation. Thus,  the HPS proteins, including HPS5, may be required to transport multiple proteins required for TLR signaling to their appropriate subcellular location.

Primers

Primers cannot be located by automatic search.

Genotyping

Toffee genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.  This protocol has not been tested.

 

Primers for PCR amplification

toffee (F): 5’- GAATACTGCCTTTCCTGATGGGGAC -3’

toffee (R): 5’-GAAAACGCTGTGGATCAATGATGACC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

toffee_seq(F): 5’- CTTCCTCTAGAAACTACGTGAGTGAG -3’

toffee_seq(R): 5’- TCAAGGAACTGTCTTAGCAGC -3’

 

The following sequence of 788 nucleotides (from Genbank genomic region NC_000073 for linear genomic sequence of Hps5) is amplified:

 

16082  gaatactgc ctttcctgat ggggactcct gctgctctgt ttaaatgagt gtctgtgtgt

16141 tatatctgag aagctgagag aagctgagta agtgtcatgt aagtccctct tatgggtatt

16201 tctttttcca gataccagcc ttttcttcct ctagaaacta cgtgagtgag tgtgtgtgtg

16261 tgtgtgtgtg tgtgtgtgtg tgtgtgtgtc taaatcttcc catttagcac catttgatgc

16321 tgtgttttta ttgggcttaa aaaggagatg gtaaggtttg ttcagctggg tcattgctgt

16381 attttctttt actttaatag tcagtgagag attgagccca gggaatcata aagtactata

16441 ctataggaaa cctgagggtt tggttgttgt tggtttggtt tggtttggtt atttgacttc

16501 ttttactttc ttttccagtg aacactgtgt gctgacttgg acagaaaagg gaatttatat

16561 tttcattcct cagaatgttc aagttcttct ttggagtgaa gtcaagggta attatatttt

16621 tctttctaag gtaacttagt ctcataatta tgtgtgaaaa ttaattgtat ggtgattctt

16681 ttataatgag agaagttgaa aatgcaggga ataattgtgt gtgactaaca cagagaaaat

16741 cagtccttgc gctcttggtt aaaaccagac gcacgggaaa gtttgccacc gctgctaaga

16801 cagttccttg acgttggctt tggggtcttc tgagaaagga gggggtcatc attgatccac

16861 agcgttttc

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

   1.  Eicher, E. M. (1970) The Position of ru-2 and qv with Respect to the FLECKED Translocation in the Mouse, Genetics 64, 495-510.

   2.  Lilly, F. (1966) The genetic basis of susceptibility and resistance of mice to the Gross and Friend leukemia viruses, Mouse News Lett 34, 14.

   3. Blasius, A. L., Arnold, C. N., Georgel, P., Rutschmann, S., Xia, Y., Lin, P., Ross, C., Li, X., Smart, N. G., and Beutler, B. (2010) Slc15a4, AP-3, and Hermansky-Pudlak Syndrome Proteins are Required for Toll-Like Receptor Signaling in Plasmacytoid Dendritic Cells. Proc. Natl. Acad. Sci. U. S. A.. epub Nov. 2.

   4.  Zhang, Q., Zhao, B., Li, W., Oiso, N., Novak, E. K., Rusiniak, M. E., Gautam, R., Chintala, S., O'Brien, E. P., Zhang, Y., Roe, B. A., Elliott, R. W., Eicher, E. M., Liang, P., Kratz, C., Legius, E., Spritz, R. A., O'Sullivan, T. N., Copeland, N. G., Jenkins, N. A., and Swank, R. T. (2003) Ru2 and Ru encode mouse orthologs of the genes mutated in human Hermansky-Pudlak syndrome types 5 and 6, Nat. Genet. 33, 145-153.

   5.  Syrzycka, M., McEachern, L. A., Kinneard, J., Prabhu, K., Fitzpatrick, K., Schulze, S., Rawls, J. M., Lloyd, V. K., Sinclair, D. A., and Honda, B. M. (2007) The pink gene encodes the Drosophila orthologue of the human Hermansky-Pudlak syndrome 5 (HPS5) gene, Genome 50, 548-556.

   6.  Falcon-Perez, J. M., Romero-Calderon, R., Brooks, E. S., Krantz, D. E., and Dell'angelica, E. C. (2007) The Drosophila pigmentation gene pink (p) encodes a homologue of human Hermansky-Pudlak syndrome 5 (HPS5), Traffic. 8, 154-168.

   7.  Huizing, M., Hess, R., Dorward, H., Claassen, D. A., Helip-Wooley, A., Kleta, R., Kaiser-Kupfer, M. I., White, J. G., and Gahl, W. A. (2004) Cellular, molecular and clinical characterization of patients with Hermansky-Pudlak syndrome type 5, Traffic. 5, 711-722.

   8.  Di Pietro, S. M., Falcon-Perez, J. M., and Dell'angelica, E. C. (2004) Characterization of BLOC-2, a complex containing the Hermansky-Pudlak syndrome proteins HPS3, HPS5 and HPS6, Traffic. 5, 276-283.

   9.  Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Hirosawa, M., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1999) Prediction of the coding sequences of unidentified human genes. XIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro, DNA Res. 6, 63-70.

 10.  Wixler, V., Laplantine, E., Geerts, D., Sonnenberg, A., Petersohn, D., Eckes, B., Paulsson, M., and Aumailley, M. (1999) Identification of novel interaction partners for the conserved membrane proximal region of alpha-integrin cytoplasmic domains, FEBS Lett 445, 351-355.

 11.  Di Pietro, S. M. and Dell'angelica, E. C. (2005) The cell biology of Hermansky-Pudlak syndrome: recent advances, Traffic. 6, 525-533.

 12.  Cutler, D. F. (2002) Introduction: lysosome-related organelles, Semin. Cell Dev. Biol. 13, 261-262.

 13.  Oh, J., Bailin, T., Fukai, K., Feng, G. H., Ho, L., Mao, J. I., Frenk, E., Tamura, N., and Spritz, R. A. (1996) Positional cloning of a gene for Hermansky-Pudlak syndrome, a disorder of cytoplasmic organelles, Nat. Genet. 14, 300-306.

 14.  Dell'angelica, E. C., Shotelersuk, V., Aguilar, R. C., Gahl, W. A., and Bonifacino, J. S. (1999) Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor, Mol. Cell 3, 11-21.

 15.  Anikster, Y., Huizing, M., White, J., Shevchenko, Y. O., Fitzpatrick, D. L., Touchman, J. W., Compton, J. G., Bale, S. J., Swank, R. T., Gahl, W. A., and Toro, J. R. (2001) Mutation of a new gene causes a unique form of Hermansky-Pudlak syndrome in a genetic isolate of central Puerto Rico, Nat. Genet. 28, 376-380.

 16.  Suzuki, T., Li, W., Zhang, Q., Karim, A., Novak, E. K., Sviderskaya, E. V., Hill, S. P., Bennett, D. C., Levin, A. V., Nieuwenhuis, H. K., Fong, C. T., Castellan, C., Miterski, B., Swank, R. T., and Spritz, R. A. (2002) Hermansky-Pudlak syndrome is caused by mutations in HPS4, the human homolog of the mouse light-ear gene, Nat. Genet. 30, 321-324.

 17.  Li, W., Zhang, Q., Oiso, N., Novak, E. K., Gautam, R., O'Brien, E. P., Tinsley, C. L., Blake, D. J., Spritz, R. A., Copeland, N. G., Jenkins, N. A., Amato, D., Roe, B. A., Starcevic, M., Dell'angelica, E. C., Elliott, R. W., Mishra, V., Kingsmore, S. F., Paylor, R. E., and Swank, R. T. (2003) Hermansky-Pudlak syndrome type 7 (HPS-7) results from mutant dysbindin, a member of the biogenesis of lysosome-related organelles complex 1 (BLOC-1), Nat. Genet. 35, 84-89.

 18.  Morgan, N. V., Pasha, S., Johnson, C. A., Ainsworth, J. R., Eady, R. A., Dawood, B., McKeown, C., Trembath, R. C., Wilde, J., Watson, S. P., and Maher, E. R. (2006) A germline mutation in BLOC1S3/reduced pigmentation causes a novel variant of Hermansky-Pudlak syndrome (HPS8), Am. J Hum. Genet. 78, 160-166.

 19.  Dunn, L. C. (1945) A New Eye Color Mutant in the Mouse with Asymmetrical Expression, Proc. Natl. Acad. Sci. U. S. A 31, 343-346.

 20.  Novak, E. K., Hui, S. W., and Swank, R. T. (1984) Platelet storage pool deficiency in mouse pigment mutations associated with seven distinct genetic loci, Blood 63, 536-544.

 21.  Markert, C. L. and Silvers, W. K. (1956) The Effects of Genotype and Cell Environment on Melanoblast Differentiation in the House Mouse, Genetics 41, 429-450.

 22.  Nguyen, T., Novak, E. K., Kermani, M., Fluhr, J., Peters, L. L., Swank, R. T., and Wei, M. L. (2002) Melanosome morphologies in murine models of hermansky-pudlak syndrome reflect blocks in organelle development, J Invest Dermatol. 119, 1156-1164.

 23.  Novak, E. K., Wieland, F., Jahreis, G. P., and Swank, R. T. (1980) Altered secretion of kidney lysosomal enzymes in the mouse pigment mutants ruby-eye, ruby-eye-2-J, and maroon, Biochem. Genet. 18, 549-561.

 24.  Paigen, B., Holmes, P. A., Novak, E. K., and Swank, R. T. (1990) Analysis of atherosclerosis susceptibility in mice with genetic defects in platelet function, Arteriosclerosis 10, 648-652.

 25.  Gautam, R., Chintala, S., Li, W., Zhang, Q., Tan, J., Novak, E. K., Di Pietro, S. M., Dell'angelica, E. C., and Swank, R. T. (2004) The Hermansky-Pudlak syndrome 3 (cocoa) protein is a component of the biogenesis of lysosome-related organelles complex-2 (BLOC-2), J Biol. Chem. 279, 12935-12942.

 26.  Helip-Wooley, A., Westbroek, W., Dorward, H. M., Koshoffer, A., Huizing, M., Boissy, R. E., and Gahl, W. A. (2007) Improper trafficking of melanocyte-specific proteins in Hermansky-Pudlak syndrome type-5, J Invest Dermatol. 127, 1471-1478.

 27.  Di Pietro, S. M., Falcon-Perez, J. M., Tenza, D., Setty, S. R., Marks, M. S., Raposo, G., and Dell'angelica, E. C. (2006) BLOC-1 interacts with BLOC-2 and the AP-3 complex to facilitate protein trafficking on endosomes, Mol. Biol. Cell 17, 4027-4038.

 28.  Setty, S. R., Tenza, D., Truschel, S. T., Chou, E., Sviderskaya, E. V., Theos, A. C., Lamoreux, M. L., Di Pietro, S. M., Starcevic, M., Bennett, D. C., Dell'angelica, E. C., Raposo, G., and Marks, M. S. (2007) BLOC-1 is required for cargo-specific sorting from vacuolar early endosomes toward lysosome-related organelles, Mol. Biol. Cell 18, 768-780.

 29.  Kotzot, D., Richter, K., and Gierth-Fiebig, K. (1994) Oculocutaneous albinism, immunodeficiency, hematological disorders, and minor anomalies: a new autosomal recessive syndrome?, Am. J. Med. Genet. 50, 224-227.

 30.  Jung, J., Bohn, G., Allroth, A., Boztug, K., Brandes, G., Sandrock, I., Schaffer, A. A., Rathinam, C., Kollner, I., Beger, C., Schilke, R., Welte, K., Grimbacher, B., and Klein, C. (2006) Identification of a homozygous deletion in the AP3B1 gene causing Hermansky-Pudlak syndrome, type 2, Blood 108, 362-369.

 31.  Huizing, M., Scher, C. D., Strovel, E., Fitzpatrick, D. L., Hartnell, L. M., Anikster, Y., and Gahl, W. A. (2002) Nonsense mutations in ADTB3A cause complete deficiency of the beta3A subunit of adaptor complex-3 and severe Hermansky-Pudlak syndrome type 2, Pediatr. Res. 51, 150-158.

 32.  Enders, A., Zieger, B., Schwarz, K., Yoshimi, A., Speckmann, C., Knoepfle, E. M., Kontny, U., Muller, C., Nurden, A., Rohr, J., Henschen, M., Pannicke, U., Niemeyer, C., Nurden, P., and Ehl, S. (2006) Lethal hemophagocytic lymphohistiocytosis in Hermansky-Pudlak syndrome type II, Blood 108, 81-87.

 33.  Bossi, G., Booth, S., Clark, R., Davis, E. G., Liesner, R., Richards, K., Starcevic, M., Stinchcombe, J., Trambas, C., Dell'angelica, E. C., and Griffiths, G. M. (2005) Normal lytic granule secretion by cytotoxic T lymphocytes deficient in BLOC-1, -2 and -3 and myosins Va, VIIa and XV, Traffic. 6, 243-251.

 34.  Reddington, M., Novak, E. K., Hurley, E., Medda, C., McGarry, M. P., and Swank, R. T. (1987) Immature dense granules in platelets from mice with platelet storage pool disease, Blood 69, 1300-1306.

 35.  Wei, M. L. (2006) Hermansky-Pudlak syndrome: a disease of protein trafficking and organelle function, Pigment Cell Res. 19, 19-42.

 36. Kaisho, T. (2008) Type I interferon production by nucleic acid-stimulated dendritic cells, Front Biosci. 13, 6034-6042.

 37. Beutler, B., Jiang, Z., Georgel, P., Crozat, K., Croker, B., Rutschmann, S., Du, X., and Hoebe, K. (2006) Genetic analysis of host resistance: Toll-Like receptor signaling and immunity at large, Annu. Rev. Immunol. 24, 353-389.

 38. Kawai, T. and Akira, S. (2006) Innate immune recognition of viral infection, Nat. Immunol. 7, 131-137.

 39. Brinkmann, M. M., Spooner, E., Hoebe, K., Beutler, B., Ploegh, H. L., and Kim, Y. M. (2007) The interaction between the ER membrane protein UNC93B and TLR3, 7, and 9 is crucial for TLR signaling, J. Cell Biol. 177, 265-275.

 40. Gilliet, M., Cao, W., and Liu, Y. J. (2008) Plasmacytoid Dendritic Cells: Sensing Nucleic Acids in Viral Infection and Autoimmune Diseases. Nat. Rev. Immunol. 8, 594-606.

 41. Hacker, H., Mischak, H., Miethke, T., Liptay, S., Schmid, R., Sparwasser, T., Heeg, K., Lipford, G. B., and Wagner, H. (1998) CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation, EMBO J. 17, 6230-6240.

 42. Diebold, S. S., Kaisho, T., Hemmi, H., Akira, S., and Reis y Sousa, C. (2004) Innate Antiviral Responses by Means of TLR7-Mediated Recognition of Single-Stranded RNA, Science 303, 1529-1531.

 43. Park, B., Brinkmann, M. M., Spooner, E., Lee, C. C., Kim, Y. M., and Ploegh, H. L. (2008) Proteolytic cleavage in an endolysosomal compartment is required for activation of Toll-like receptor 9, Nat. Immunol. 9, 1407-1414.

 44. Cutler, D. F. (2002) Introduction: Lysosome-Related Organelles. Semin. Cell Dev. Biol.. 13, 261-262.

 45. Sasai, M., Linehan, M. M., and Iwasaki, A. (2010) Bifurcation of Toll-like receptor 9 signaling by adaptor protein 3. Science. 329,1530-1534.