Phenotypic Mutation 'Oregano2' (pdf version)
List [record 1 of 4] next >> last >|
AlleleOregano2
Mutation Type splice site
Chromosome11
Coordinate44,990,504 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Ebf1
Gene Name early B cell factor 1
Synonym(s) Olf1, O/E-1, Olf-1
Chromosomal Location 44,617,317-45,008,091 bp (+)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001290709 (variant 1), NM_007897 (variant 2), NM_001290710 (variant 3), NM_001290711 (variant 4); MGI:95275

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000080020] [ENSMUSP00000099857] [ENSMUSP00000104891]
PDB Structure
DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (crystal form II) [X-RAY DIFFRACTION]
DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (Crystal form I) [X-RAY DIFFRACTION]
Early B-cell Factor 1 (Ebf1) bound to DNA [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000080020
Gene: ENSMUSG00000057098

DomainStartEndE-ValueType
IPT 261 345 7.38e-8 SMART
HLH 346 395 5.4e-2 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000099857
Gene: ENSMUSG00000057098

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 8e-150 PFAM
IPT 262 346 7.38e-8 SMART
HLH 347 396 5.4e-2 SMART
low complexity region 527 545 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000104891
Gene: ENSMUSG00000057098

DomainStartEndE-ValueType
IPT 254 338 7.38e-8 SMART
HLH 339 388 5.4e-2 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - decreased 22431510 7542362
FACS T cells - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(28) : Chemically induced (other)(1) Gene trapped(21) Spontaneous(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ebf1 APN 11 44869100 missense probably damaging 1.00
IGL02228:Ebf1 APN 11 44972912 missense probably damaging 1.00
IGL02430:Ebf1 APN 11 44924576 critical splice donor site probably null
Catastrophic UTSW 11 44883885 missense
Crater_lake UTSW 11 44972908 nonsense probably null
oregano UTSW 11 44869169 missense probably damaging 1.00
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0141:Ebf1 UTSW 11 44908000 missense probably damaging 1.00
R0230:Ebf1 UTSW 11 44996122 missense probably damaging 1.00
R0243:Ebf1 UTSW 11 44869088 splice site probably benign
R0268:Ebf1 UTSW 11 44643413 missense probably damaging 0.96
R0414:Ebf1 UTSW 11 44924470 nonsense probably null
R0648:Ebf1 UTSW 11 44991510 missense probably damaging 0.99
R0765:Ebf1 UTSW 11 44869160 missense probably damaging 0.97
R1055:Ebf1 UTSW 11 44632775 missense probably damaging 0.98
R1432:Ebf1 UTSW 11 45004706 splice site probably benign
R1713:Ebf1 UTSW 11 44924566 missense probably damaging 1.00
R1749:Ebf1 UTSW 11 44908008 missense possibly damaging 0.68
R1989:Ebf1 UTSW 11 44621966 missense probably damaging 0.97
R2405:Ebf1 UTSW 11 44991522 missense probably damaging 0.98
R3110:Ebf1 UTSW 11 44643398 splice site probably benign
R4538:Ebf1 UTSW 11 44907995 missense probably benign 0.07
R4666:Ebf1 UTSW 11 44991557 missense probably damaging 0.99
R4855:Ebf1 UTSW 11 44972908 nonsense probably null
R4904:Ebf1 UTSW 11 44869169 missense probably damaging 1.00
R5137:Ebf1 UTSW 11 44991468 missense probably damaging 1.00
R5569:Ebf1 UTSW 11 44992401 missense possibly damaging 0.82
R5849:Ebf1 UTSW 11 44990504 splice site probably null
R5940:Ebf1 UTSW 11 44621221 missense probably damaging 1.00
R5989:Ebf1 UTSW 11 44996171 missense probably damaging 1.00
R6170:Ebf1 UTSW 11 44883885 missense probably damaging 1.00
R6512:Ebf1 UTSW 11 44992341 missense probably damaging 1.00
R6747:Ebf1 UTSW 11 44883814 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2018-07-20 11:10 AM by Diantha La Vine
Record Created 2018-03-09 8:16 AM by Anne Murray
Record Posted 2018-07-18
Phenotypic Description

Figure 1. Oregano2 mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Oregano2 mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Oregano2 mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Oregano2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5849, some of which showed reduced frequencies of B1 cells (Figure 1) as well as slight increases in the frequencies of T cells (Figure 2) and CD4+ T cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of reduced B1 cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 68 mutations (X-axis) identified in the G1 male of pedigree R5849. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Ebf1:  a T to A transversion at base pair 44,990,504 (v38) on chromosome 11, or base pair 372,405 in the GenBank genomic region NC_000077 within intron 11 (12 base pairs from exon 12. The strongest association was found with an additive model of inheritance to the normalized frequency of B1 cells, wherein six variant homozygotes departed phenotypically from 19 homozygous reference mice and six heterozygous mice with a P value of 3.482 x 10-5 (Figure 4).  

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic site in intron 11, resulting in a 31-base pair insertion of intron 11. The insertion would cause a frame-shifted protein product beginning after amino acid 376 of the protein and premature termination after the inclusion of 14 aberrant amino acids.

 

         <--exon 11       <--intron 11 exon 12-->
1196 ……CGCTTGCCAAAG ……tttttgttcttgacag GAAGTGATCCTTAA……
373  ……-R--L--P--K- ……-F--L--F--L--T-- G--S--D--P--*-
         correct                  aberrant
 

The acceptor splice site of intron 11 is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 5. Domain structure of the EBF1 protein. The oregano2 mutation and other mutations in EBF1 are noted. Click on each mutation for more information. Abbreviations: DBD, DNA-binding domain; ZK, Zinc knuckle; TIG/IPT, transcription factor immunoglobulin/Ig plexin-like fold in transcription factors; HLHLH, helix-loop-helix-loop-helix.

Early B cell factor 1 (EBF1; alternatively, EBF, O/E-1, or COE1) is a member of the COE (Collier-Olf-EBF) family of transcription factors. EBF1 has a DNA-binding domain (DBD), a TIG/IPT (transcription factor immunoglobulin (Ig)/Ig plexin-like fold in transcription factors) domain, a dimerization region similar to those found in basic helix-loop-helix proteins (termed the helix-loop-helix-loop-helix (HLHLH) domain), and a putative activation/multimerization domain that is rich in serine, threonine, and proline residues (Figure 5) (1-4). A RRARR motif between the DBD and TIG/IPT domain is predicted to be a nuclear localization sequence (5). A histidine and three cysteines within a 14-residue motif, termed the ‘zinc knuckle’, coordinates a zinc ion and mediates DNA recognition (2;6).

 

Ebf1 has two promoters, a distal promoter (α) and a proximal promoter (β), which produce two EBF1 proteins (7). The two proteins differ by 11 amino acids at the N-terminus. The proteins are predicted to have similar functions. Interleukin-7 signaling, E2A, and EBF1 activate the distal Ebf1 promoter, whereas Pax5, Ets1, and Pu.1 regulate the stronger proximal promoter (7).

 

For more information about EBF1, please see the record for crater_lake.

 

Putative Mechanism

During B cell differentiation from a common hematopoietic stem cell (HSC) progenitor to a mature B cell, PAX5 [see the record for glacier] and other lineage-specific B lymphoid transcription factors such as EBF1 and E2A function to both activate B lineage-specific genes as well as to repress the transcription of other lineage-inappropriate genes.

 

In the lymphoid lineage, common lymphoid progenitors (CLPs) are divided into Ly6D-negative all-lymphoid progenitors (ALPs) and Ly6D-positive B cell biased lymphoid progenitors (BLPs) (8). The ALPs generate B cells, T cells, natural killer cells, and lymphoid dendritic cells. The BLPs are biased towards the B cell lineage. Ebf1 expression is initially expressed in the BLPs (9). E2A/E47 and HEB activate the expression of FOXO1, which acts with E2A to induce the expression of EBF1 (10). Expression of EBF1 (and FOXO1) in common lymphoid progenitors biases the cells towards B cell lymphopoiesis. EBF1 subsequently activates the expression of PAX5, which commits cells to the B cell fate (11).

 

EBF1 is a transcription factor that is required for B cell commitment, pro-B cell development, the transition to the pre-B cell stage, germinal center formation, and class switch recombination as well as for the proliferation, survival, and signaling of pro-B cells and peripheral B-cell subsets (e.g., B1 cells, follicular, and marginal zone B cells) (9;12). Ebf1-deficient (Ebf1-/-) mice exhibit premature death (incomplete penetrance), reduced body sizes, reduced subcutaneous adipose tissue amounts, reduced serum IgM levels, decreased numbers of pro-B cells, loss of mature B cells in the blood and spleen, increased osteoblast cell numbers, and abnormal bone ossification (13;14). The Ebf1-/- mice show no V(D)J recombination.  Mice expressing a spontaneous Ebf1 mutation (Ebf1Serv/+; MGI:5007783) also exhibited reduced B cell numbers. Exogenous expression of EBF1 in mouse hematopoietic stem cells promotes B cell development, but the development of other hematopoietic cell lineages is impaired (15).

 

The phenotype observed in oregano2 mice indicates loss of EBF1oregano2 function in regulating EBF1 target genes.

Primers PCR Primer
Oregano2(F):5'- CAGCTCTTGACTCAATTAAGTGTG -3'
Oregano2(R):5'- AGATCCTGTGTTCTGAACGC -3'

Sequencing Primer
Oregano2_seq(F):5'- TGACTCAATTAAGTGTGTATGTGAAC -3'
Oregano2_seq(R):5'- ACGCATGAGTATTGCTTTCATAGGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, Evan Nair-Gill, and Bruce Beutler
List [record 1 of 4] next >> last >|