Phenotypic Mutation 'southbeach'

• Allele: southbeach
• Mutation Type: missense
• Chromosome: 18
• Coordinate: 66,992,213 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Mc4r
• Gene Name: melanocortin 4 receptor
• Synonym(s): Pkcp, Fatboy
• Chromosomal Location: 66,990,776-66,993,558 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012] ; PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P56450
• SMART Domains: Protein: ENSMUSP00000054776; Gene: ENSMUSG00000047259; AA Change: L300P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	51	228	8.1e-11	PFAM
Pfam:7TM_GPCR_Srsx	55	317	6e-12	PFAM
Pfam:7tm_1	61	302	2.7e-31	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000057942)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.105)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Embryos, gDNA
• MMRRC Submission: 015984-UCD
• Last Updated: 2019-05-25 7:24 AM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2008-01-23
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Koichi Tabeta, Bruce Beutler

Accession Number

NCBI RefSeq: NM_016977; MGI: 99457

Alleles Listed at MGI

All alleles(6) : Targeted, knock-out(2) Chemically induced(4)

Phenotypic Description

The Southbeach phenotype was identified among ENU-induced homozygous G3 mutant mice. Homozygous Southbeach mice develop severe obesity but not diabetes (1). By 20 weeks of age, homozygous male Southbeach mutants weigh approximately 65% more than wild type mice (Figure 1). Heterozygotes display an intermediate weight between homozygotes and controls, demonstrating that the Southbeach phenotype is codominant.

 

Upon identification of the Southbeach mutation in the gene encoding the melanocortin 4 receptor (MC4R), Mc4r^Southbeach mutant receptors expressed in HEK 293 cells were tested for ligand binding and intracellular signaling properties (1). Ligand binding to two MC4R agonists, α-melanocyte stimulating hormone (α-MSH) and NDP-MSH, was decreased to 0.6 ± 0.1% of wild type receptor levels, despite normal to increased numbers of cells with surface expression of the mutant receptor. Signaling by Southbeach MC4R, as measured by maximal cAMP accumulation stimulated by α-MSH or NDP-MSH, was reduced to approximately 14% of wild type MC4R.

Nature of Mutation

The Southbeach mutation was mapped to Chromosome 18, and corresponds to a T to C transition at position 1331 of the Mc4r transcript. Mc4r contains one exon.

 

1315 GCCGTCATCGACCCTCTCATTTATGCCCTCCGG

295  -A--V--I--D--P--L--I--Y--A--L--R-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of leucine to proline at residue 300 of the MC4R protein.

Protein Prediction

Figure 2. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, GPCR undergoes confirmational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.

Figure 3. Domain structure and topography of mouse MC4R. The Southbeach mutation causes a conversion of leucine to proline at residue 300 of the MC4R protein.

Figure 4. 3D model of Melanocortin-4 receptor. The locations of the Big_boned, Cetacean, chubby, halloween, and Southbeach mutations are indicated. UCSF Chimera model is based on PDB 2IQR. Click on the 3D structure to view it rotate.

The MC4R protein consists of 332 amino acids and belongs to the family of melanocortin receptors, of which five have been identified (MC1R-MC5R). These receptors are seven transmembrane spanning G-protein coupled receptors (GPCRs) (Figure 2). MC4R activates the heterotrimeric G-protein G_s, which stimulates adenylyl cyclase production of cAMP from ATP (2). GPCRs have seven transmembrane helices connected by loops, and ligand binding occurs at extracellular loops facilitated by specific transmembrane helices. Studies of the protein structure of melanocortin receptors, in particular MC4R, have focused on identifying the agonist- and antagonist-binding residues of the receptor because of the potential for rational design of ligands that may be administered to control food intake in humans. Extensive mutational analysis has been performed to test the ability of several point mutants to bind to a battery of natural and synthetic agonists and antagonists. Together, these studies identified at least nine residues wherein mutations reduce the affinity for binding to at least one ligand (3-5). Based on modeling the seven transmembrane domains of MC4R on the structure of rhodopsin, these nine residues exist in TM2 (E92), TM3 (D114, D118, D122, D126), TM4 (F176), TM6 (F261, H264), and TM7 (F284).

 

A pure modeling approach to deduce the three-dimensional structure of MC4R was also performed based on the crystal structure of the bovine G-protein rhodopsin (6). When a minimal inhibitory 3-mer peptide (RFF) from the sequence of the endogenous inhibitor Agouti-related protein (Agrp) was modeled as a ligand, residues in TM3, TM4, TM5 and TM6 were predicted to flank the ligand binding site, consistent with data from mutational analysis. Extracellular loops 2 and 3 also participate in docking of ligand. Interestingly, TM1 and TM7 were not predicted to contribute to ligand binding, although F284 was found at the edge of the ligand-binding pocket (6). The third intracellular loop of MC4R is predicted to form an α-helical segment, and play an important role in coupling the receptor to G_s. Finally, the model predicts two conserved proline kinks at P260 and P299, although the role of these kinks in protein function is unknown (6).

 

The Southbeach mutation results in the substitution of leucine 300 by a proline residue.

Expression/Localization

Mc4r transcript is detected primarily in the brain by Northern blot analysis (2). In situ hybridization reveals Mc4r in regions of the thalamus, hypothalamus and hippocampus, as well as in several other brain regions and spinal cord (2;7). MC4R is normally membrane-bound.

Background

Genetic factors can contribute a predisposition to obesity, and several single spontaneous mutations in both mice and humans result in obesity (8). In all cases, the mutated gene products function within a defined hypothalamic neural network that controls energy balance through the regulation of central melanocortinergic systems. A main mechanism of regulation involves the control of signaling by the central melanocortin receptors (MCRs), MC3R and MC4R. These receptors are now known to be activated or inhibited by the hormonally controlled production and release of neuropeptide ligands, based on both long- and short-term energy requirements of the body.

 

The search for brain melanocortin receptors was triggered by the discovery that the yellow, hyperphagic (having increased feeding behavior) and obese phenotype of mice carrying the dominant agouti lethal yellow (A^y) mutation is caused by ectopic expression of Agouti protein [reviewed in (9)]. Agouti protein, a paracrine signaling molecule normally limited to the skin, controls hair color by inhibiting the melanocyte-specific Mc1r. Obesity was hypothesized to result from aberrant inhibition of a related receptor controlling body weight. RT-PCR screening of brain tissue soon identified MC3R and MC4R (2;10), and significantly, Agouti-related protein (Agrp) was discovered as a hypothalamus-specific antagonist of MC3R and MC4R (11). The endogenous MC4R agonist was shown to be α-melanocyte stimulating hormone (α-MSH), a proteolytic product of pro-opiomelanocortin (Pomc), from which all melanocortin receptor agonists arise (2). Agrp stimulates food intake and weight gain; α-MSH inhibits food intake and promotes weight loss. Both Agouti protein and Agrp antagonize MC3R and MC4R signaling, but they are truly inverse agonists rather than antagonists of the receptors. Inverse agonists stabilize the inactive conformation of a receptor, while antagonists bind but favor neither the active nor inactive form of the receptor. Agrp was shown to be an inverse agonist by its reduction of the intrinsic, constitutive activity of MC4R (12). Both Agouti protein and Agrp decrease the affinity of the ligand-receptor complex for the regulatory subunit of the G-protein, decreasing signaling from the receptor.

 

Figure 5. Agrp/Npy neurons and Pomc/Cart neurons are located in the arcuate nucleus of the hypothalamus and are regulated by leptin from adipose tissue. Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons in the hypothalamus. Agouti and Agrp are hypothalamus-specific antagonists of MC3R and MC4R while α-MSH, a proteolytic product of Pomc, is a known agonist of MC3R and MC4R. Agrp and Npy stimulate food intake and decrease energy expenditures, causing weight gain. Pomc and Cart inhibit food intake and increase energy expenditure. Agrp, Agouti-related protein; Agrp, producing Agrp; Npy, neuropeptide Y; Pomc, pro-opiomelanocortin; Cart, cocaine- and amphetamine-regulated transcript; α-MSH, α-melanocyte stimulating hormone; LEPR, leptin receptor.

The identification of the neurons expressing MC4R, and those producing the agonists and antagonists of melanocortin receptors, helped to define a central neural circuit controlling energy balance (9). Two sets of neurons in the arcuate nucleus (a region surrounding the third ventricle in the most ventral portion of the hypothalamus) act as sensors of whole-body energy status and initiate signals to maintain energy stores at a constant level (Figure 5). The Agrp/Npy neurons (producing Agrp and neuropeptide Y) are inhibited by the leptin peptide by signaling through the leptin receptor (mutated in Business class, Cherub and Well-upholstered), while Pomc/Cart neurons (producing Pomc, its proteolytic products and cocaine- and amphetamine-regulated transcript) are stimulated by leptin (13-15). Leptin is a circulating protein produced by adipose tissue, and plasma leptin levels reflect body fat stores (16-18). Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons (13;19). Thus, when leptin levels are low, Agrp/Npy neurons are activated and Pomc/Cart neurons are inhibited, producing Agrp but not Pomc, and resulting in inhibition of MC4R and increased food intake.

 

The physiological function of MC4R in the central regulation of energy balance was confirmed by the phenotype of Mc4r^-/- mice, which develop obesity like that caused by overexpression of Agouti protein in A^y mice (20). Consistent with the antagonistic function of Agouti protein and Agrp towards MC4R, transgenic overexpression of Agouti protein or Agrp in mice both result in obesity (11). Pharmacological activation of MC4R by administration of α-MSH or a synthetic agonist suppresses feeding, and conversely, inhibition of MC4R by Agrp or a synthetic antagonist promotes feeding behavior in mice (21). In addition to the control of appetite, central melanocortin receptors also regulate insulin signaling. One week-long central infusion of α-MSH enhanced the actions of insulin on both glucose uptake and production, while a synthetic antagonist had the opposite effects (22). MC4R-null mice develop hyperinsulinemia and are hyperglycemic (20).

 

In humans, mutations in MC4R are associated with obesity (OMIM #601665; *155541). By late 2005, 58 MC4R mutations had been reported [reviewed in (23)], and such mutations are the most common cause of monogenic obesity in humans. It is estimated that 4% of single gene mutations causing severe childhood-onset obesity occur in MC4R (24;25). Human patients with MC4R mutations exhibit increased body mass index, increased appetite, increased height, increased lean mass, increased bone mineral density and hyperinsulinemia (24). With the exception of increased bone mineral density, these phenotypes are recapitulated in Mc4r null mice (20). Notably, in contrast to knockout mice which exhibit defects in basal energy expenditure, humans with MC4R mutations have apparently normal basal energy expenditure, suggesting that in humans, obesity is caused primarily by hyperphagia (20;24).

Putative Mechanism

Analysis of the properties of MC4R protein containing the Southbeach mutation indicates that this receptor is correctly targeted to the plasma membrane, but fails to bind its ligands, resulting in a drastic reduction in signaling from the receptor (1). Of the 24 amino acids in TM7, all but two (295 and 296) are identical between mouse and human MC4R. Leucine 300 is conserved in humans, although no mutations in this residue have been reported among human patients. However, mutations of both proline 299 and isoleucine 301 occur in obese patients. The P299H mutation is reported to cause intracellular retention of MC4R, resulting in surface expression levels of 18 ± 7% relative to wild type receptor (26). In contrast, I301T reduces ligand binding by over 80% compared to control cells in an [¹²⁵I] NDP-αMSH binding assay using cells transiently expressing MC4R I301T (25). Either surface expression and/or ligand affinity may be reduced for the I301T receptor mutant (25). The di-isoleucine sequence at position 316/317 of human MC4R is required for cell surface expression of the receptor (27), but effects on surface expression can result from mutations throughout the sequence of the protein (23). It is not clear why the adjacent mutations L300P (1) and P299H (26) result in different effects on receptor surface expression.

 

The majority of human MC4R loss-of-function mutations follow an autosomal dominant inheritance pattern, consistent with the intermediate obesity phenotype observed in Mc4r^+/- mice compared to their homozygous and wild type littermates (20;24;25). Reports indicate dominant negative effects (28), and others a lack thereof (29), for various MC4R mutants, suggesting that haploinsufficiency and dominant negative effects are both plausible causes for mutant phenotypes which must be evaluated for each specific case. The Southbeach phenotype is codominant, but haploinsufficiency has not been rigorously tested.

Primers

Primers cannot be located by automatic search.

Genotyping

Southbeach genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

South(F): 5’-AGCGCAGCCTCCCAACTTCTACAG -3’

South(R): 5’-TCAGATCGGGCCAGAGTGACAAAG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:30

4) 68°C             1:20

5) repeat steps (2-4) 35X

6) 68°C             5:00

7) 4°C              ∞

 

Primers for sequencing

South_seq(F): 5’- TCCGCCAGGGTACCAACATGAAGG -3’

South_seq(R): 5’- CAGATCGGGCCAGAGTGACAAAG -3’

 

The following sequence of 1177 nucleotides (from Genbank genomic region NC_000084 for linear DNA sequence of Mcr4) is amplified:

 

 317                  agcg cagcctccca acttctacag gcatacagac tgggagagaa

 361 tcactcggag cttccctgac ccaggaggtt ggatcagttc aaggaggact caaatccagc

 421 tgctgcagga agatgaactc cacccaccac catggcatgt atacttccct ccacctctgg

 481 aaccgcagca gctacgggct gcacggcaat gccagcgagt cgctggggaa gggccacccg

 541 gacggaggat gctatgagca actttttgtt tcccccgagg tgtttgtgac tctgggtgtc

 601 ataagcctgt tggagaacat tctagtgatc gtggcgatag ccaagaacaa gaacctgcac

 661 tcacccatgt actttttcat ctgtagcctg gctgtggcag atatgctggt gagcgtttcg

 721 aatgggtcgg aaaccatcgt cattaccctg ttaaacagta cggatacgga tgcccagagc

 781 ttcaccgtga acattgataa tgtcattgac tctgtgatct gtagctcctt gctcgcatcc

 841 atttgcagcc tgctttccat tgcggtggac aggtatttca ctatctttta cgcgctccag

 901 taccataaca tcatgacggt taggcgggtc gggatcatca taagttgtat ctgggcagct

 961 tgcactgtgt caggcgtcct cttcatcatt tactcggaca gcagcgctgt catcatctgc

1021 ctcatttcca tgttcttcac tatgctagtt ctcatggcct ctctctatgt ccacatgttc

1081 ctgatggcga ggcttcacat taagaggatt gctgtcctcc caggcacagg gaccatccgc

1141 cagggtacca acatgaaggg ggcgattacc ttgaccatcc tgattggagt ctttgttgtc

1201 tgctgggccc cgttctttct ccatttactg ttctacatct cttgccctca gaatccatac

1261 tgcgtgtgct tcatgtctca ttttaatttg tatctcatac tgatcatgtg taacgccgtc

1321 atcgaccctc tcatttatgc cctccggagt caagaactga ggaaaacttt caaagagatc

1381 atctgtttct atcctctggg aggcatctgt gagttgtcta gcaggtatta agtgggggac

1441 agagtgcaaa ctaggtagat acctgcagac tttgtcactc tggcccgatc tga

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1.  Meehan, T. P., Tabeta, K., Du, X., Woodward, L. S., Firozi, K., Beutler, B., and Justice, M. J. (2006) Point mutations in the melanocortin-4 receptor cause variable obesity in mice, Mamm. Genome 17, 1162-1171.

   2.  Gantz, I., Miwa, H., Konda, Y., Shimoto, Y., Tashiro, T., Watson, S. J., DelValle, J., and Yamada, T. (1993) Molecular Cloning, Expression, and Gene Localization of a Fourth Melanocortin Receptor, J. Biol. Chem. 268, 15174-15179.

   3.  Yang, Y. K., Fong, T. M., Dickinson, C. J., Mao, C., Li, J. Y., Tota, M. R., Mosley, R., Van Der Ploeg, L. H., and Gantz, I. (2000) Molecular determinants of ligand binding to the human melanocortin-4 receptor, Biochemistry 39, 14900-14911.

   4.  Haskell-Luevano, C., Cone, R. D., Monck, E. K., and Wan, Y. P. (2001) Structure activity studies of the melanocortin-4 receptor by in vitro mutagenesis: identification of agouti-related protein (AGRP), melanocortin agonist and synthetic peptide antagonist interaction determinants, Biochemistry 40, 6164-6179.

   5.  Nickolls, S. A., Cismowski, M. I., Wang, X., Wolff, M., Conlon, P. J., and Maki, R. A. (2003) Molecular determinants of melanocortin 4 receptor ligand binding and MC4/MC3 receptor selectivity, J Pharmacol. Exp. Ther. 304, 1217-1227.

   6.  Yang, X., Wang, Z., Dong, W., Ling, L., Yang, H., and Chen, R. (2003) Modeling and Docking of the Three-Dimensional Structure of the Human Melanocortin 4 Receptor, Journal of Protein Chemistry 22, 335-344.

   7.  Kishi, T., Aschkenasi, C. J., Lee, C. E., Mountjoy, K. G., Saper, C. B., and Elmquist, J. K. (2003) Expression of melanocortin 4 receptor mRNA in the central nervous system of the rat, J Comp Neurol. 457, 213-235.

   8.  Bell, C. G., Walley, A. J., and Froguel, P. (2005) The genetics of human obesity, Nat. Rev. Genet. 6, 221-234.

   9.  Barsh, G. S. and Schwartz, M. W. (2002) Genetic approaches to studying energy balance: perception and integration, Nat. Rev. Genet. 3, 589-600.

 10.  Gantz, I., Konda, Y., Tashiro, T., Shimoto, Y., Miwa, H., Munzert, G., Watson, S. J., DelValle, J., and Yamada, T. (1993) Molecular cloning of a novel melanocortin receptor, J Biol. Chem. 268, 8246-8250.

 11.  Ollmann, M. M., Wilson, B. D., Yang, Y. K., Kerns, J. A., Chen, Y., Gantz, I., and Barsh, G. S. (1997) Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein, Science 278, 135-138.

 12.  Nijenhuis, W. A., Oosterom, J., and Adan, R. A. (2001) AgRP(83-132) acts as an inverse agonist on the human-melanocortin-4 receptor, Mol. Endocrinol. 15, 164-171.

 13.  Hahn, T. M., Breininger, J. F., Baskin, D. G., and Schwartz, M. W. (1998) Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons, Nat. Neurosci. 1, 271-272.

 14.  Cowley, M. A., Smart, J. L., Rubinstein, M., Cerdan, M. G., Diano, S., Horvath, T. L., Cone, R. D., and Low, M. J. (2001) Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus, Nature 411, 480-484.

 15.  Kristensen, P., Judge, M. E., Thim, L., Ribel, U., Christjansen, K. N., Wulff, B. S., Clausen, J. T., Jensen, P. B., Madsen, O. D., Vrang, N., Larsen, P. J., and Hastrup, S. (1998) Hypothalamic CART is a new anorectic peptide regulated by leptin, Nature 393, 72-76.

 16.  Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J. M. (1994) Positional cloning of the mouse obese gene and its human homologue, Nature 372, 425-432.

 17.  Ahima, R. S., Prabakaran, D., Mantzoros, C., Qu, D., Lowell, B., Maratos-Flier, E., and Flier, J. S. (1996) Role of leptin in the neuroendocrine response to fasting, Nature 382, 250-252.

 18.  Ostlund, R. E., Jr., Yang, J. W., Klein, S., and Gingerich, R. (1996) Relation between plasma leptin concentration and body fat, gender, diet, age, and metabolic covariates, J Clin. Endocrinol. Metab 81, 3909-3913.

 19.  Bagnol, D., Lu, X. Y., Kaelin, C. B., Day, H. E., Ollmann, M., Gantz, I., Akil, H., Barsh, G. S., and Watson, S. J. (1999) Anatomy of an endogenous antagonist: relationship between Agouti-related protein and proopiomelanocortin in brain, J Neurosci. 19, RC26.

 20.  Huszar, D., Lynch, C. A., Fairchild-Huntress, V., Dunmore, J. H., Fang, Q., Berkemeier, L. R., Gu, W., Kesterson, R. A., Boston, B. A., Cone, R. D., Smith, F. J., Campfield, L. A., Burn, P., and Lee, F. (1997) Targeted disruption of the melanocortin-4 receptor results in obesity in mice, Cell 88, 131-141.

 21.  Fan, W., Boston, B. A., Kesterson, R. A., Hruby, V. J., and Cone, R. D. (1997) Role of melanocortinergic neurons in feeding and the agouti obesity syndrome, Nature 385, 165-168.

 22.  Obici, S., Feng, Z., Tan, J., Liu, L., Karkanias, G., and Rossetti, L. (2001) Central melanocortin receptors regulate insulin action, J Clin. Invest 108, 1079-1085.

 23.  MacKenzie, R. G. (2006) Obesity-associated mutations in the human melanocortin-4 receptor gene, Peptides 27, 395-403.

 24.  Farooqi, I. S., Keogh, J. M., Yeo, G. S., Lank, E. J., Cheetham, T., and O'Rahilly, S. (2003) Clinical spectrum of obesity and mutations in the melanocortin 4 receptor gene, N. Engl. J Med. 348, 1085-1095.

 25.  Vaisse, C., Clement, K., Durand, E., Hercberg, S., Guy-Grand, B., and Froguel, P. (2000) Melanocortin-4 receptor mutations are a frequent and heterogeneous cause of morbid obesity, J Clin. Invest 106, 253-262.

 26.  Lubrano-Berthelier, C., Durand, E., Dubern, B., Shapiro, A., Dazin, P., Weill, J., Ferron, C., Froguel, P., and Vaisse, C. (2003) Intracellular retention is a common characteristic of childhood obesity-associated MC4R mutations, Hum. Mol. Genet. 12, 145-153.

 27.  VanLeeuwen, D., Steffey, M. E., Donahue, C., Ho, G., and MacKenzie, R. G. (2003) Cell surface expression of the melanocortin-4 receptor is dependent on a C-terminal di-isoleucine sequence at codons 316/317, J Biol. Chem. 278, 15935-15940.

 28.  Biebermann, H., Krude, H., Elsner, A., Chubanov, V., Gudermann, T., and Gruters, A. (2003) Autosomal-dominant mode of inheritance of a melanocortin-4 receptor mutation in a patient with severe early-onset obesity is due to a dominant-negative effect caused by receptor dimerization, Diabetes 52, 2984-2988.

 29.  Ho, G. and MacKenzie, R. G. (1999) Functional characterization of mutations in melanocortin-4 receptor associated with human obesity, J Biol. Chem. 274, 35816-35822.