Phenotypic Mutation 'southbeach' (pdf version)
List |< first << previous [record 533 of 584] next >> last >|
Allelesouthbeach
Mutation Type missense
Chromosome18
Coordinate66,859,142 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Mc4r
Gene Name melanocortin 4 receptor
Synonym(s) Fatboy
Chromosomal Location 66,857,715-66,860,472 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_016977; MGI: 99457

Mapped Yes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Ref Sequences
L300P in Ensembl: ENSMUSP00000054776 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 55 317 1.8e-7 PFAM
Pfam:7tm_1 61 302 5e-35 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using Ensembl: ENSMUSP00000054776)
Phenotypic Category
Phenotypequestion? Literature verified References
adipose tissue
growth/size
Penetrance 100% 
Alleles Listed at MGI

All alleles(6) : Targeted, knock-out(2) Chemically induced(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Mc4r APN 18 66859158 missense probably benign 0.01
IGL01382:Mc4r APN 18 66859793 missense probably damaging 0.96
IGL01820:Mc4r APN 18 66859155 missense probably benign 0.00
IGL02749:Mc4r APN 18 66859662 missense probably damaging 1.00
IGL02812:Mc4r APN 18 66859247 missense probably damaging 1.00
IGL03403:Mc4r APN 18 66859526 missense possibly damaging 0.61
Big_boned UTSW 18 66859488 missense probably damaging 1.00
Cetacean UTSW 18 66859180 nonsense
chubby UTSW 18 66859847 missense probably damaging 1.00
halloween UTSW 18 66859821 missense probably damaging 1.00
R1552:Mc4r UTSW 18 66859695 missense probably benign 0.00
R1623:Mc4r UTSW 18 66859997 missense probably benign 0.03
R1666:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1668:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1781:Mc4r UTSW 18 66859847 missense probably damaging 1.00
R1873:Mc4r UTSW 18 66859460 missense probably damaging 1.00
R2105:Mc4r UTSW 18 66859598 missense probably damaging 1.00
R2210:Mc4r UTSW 18 66859395 missense probably damaging 1.00
R3714:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R3715:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R4115:Mc4r UTSW 18 66859979 missense probably benign
R4322:Mc4r UTSW 18 66859050 missense probably benign 0.00
R4492:Mc4r UTSW 18 66859640 missense probably benign 0.00
R4806:Mc4r UTSW 18 66859488 missense probably damaging 1.00
R4877:Mc4r UTSW 18 66859338 missense probably benign 0.00
R6161:Mc4r UTSW 18 66859180 nonsense probably null
R6802:Mc4r UTSW 18 66859417 missense probably benign 0.21
R6807:Mc4r UTSW 18 66859856 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock Embryos, gDNA
MMRRC Submission 015984-UCD
Last Updated 2018-07-25 10:26 AM by Diantha La Vine
Record Created unknown
Record Posted 2008-01-23
Phenotypic Description
The Southbeach phenotype was identified among ENU-induced homozygous G3 mutant mice. Homozygous Southbeach mice develop severe obesity but not diabetes (1). By 20 weeks of age, homozygous male Southbeach mutants weigh approximately 65% more than wild type mice (Figure 1). Heterozygotes display an intermediate weight between homozygotes and controls, demonstrating that the Southbeach phenotype is codominant.
 
Upon identification of the Southbeach mutation in the gene encoding the melanocortin 4 receptor (MC4R), Mc4rSouthbeach mutant receptors expressed in HEK 293 cells were tested for ligand binding and intracellular signaling properties (1). Ligand binding to two MC4R agonists, α-melanocyte stimulating hormone (α-MSH) and NDP-MSH, was decreased to 0.6 ± 0.1% of wild type receptor levels, despite normal to increased numbers of cells with surface expression of the mutant receptor. Signaling by Southbeach MC4R, as measured by maximal cAMP accumulation stimulated by α-MSH or NDP-MSH, was reduced to approximately 14% of wild type MC4R.

 

Nature of Mutation
The Southbeach mutation was mapped to Chromosome 18, and corresponds to a T to C transition at position 1331 of the Mc4r transcript. Mc4r contains one exon.
 
1315 GCCGTCATCGACCCTCTCATTTATGCCCTCCGG
295  -A--V--I--D--P--L--I--Y--A--L--R-
 
The mutated nucleotide is indicated in red lettering, and results in a conversion of leucine to proline at residue 300 of the MC4R protein.
Protein Prediction
Figure 2. GPCR activation cycle. In it’s inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, GPCR undergoes confirmational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis
of GTP to GDP by RGS leads to inactivation of the G-protein.
Figure 3. Domain structure and topography of mouse MC4R. The Southbeach mutation causes a conversion of leucine to proline at residue 300 of the MC4R protein.
Figure 4. 3D model of Melanocortin-4 receptor. The locations of the Big_boned, Cetacean, chubby, halloween, and Southbeach mutations are indicated. UCSF Chimera model is based on PDB 2IQR. Click on the 3D structure to view it rotate.
The MC4R protein consists of 332 amino acids and belongs to the family of melanocortin receptors, of which five have been identified (MC1R-MC5R). These receptors are seven transmembrane spanning G-protein coupled receptors (GPCRs) (Figure 2). MC4R activates the heterotrimeric G-protein Gs, which stimulates adenylyl cyclase production of cAMP from ATP (2). GPCRs have seven transmembrane helices connected by loops, and ligand binding occurs at extracellular loops facilitated by specific transmembrane helices. Studies of the protein structure of melanocortin receptors, in particular MC4R, have focused on identifying the agonist- and antagonist-binding residues of the receptor because of the potential for rational design of ligands that may be administered to control food intake in humans. Extensive mutational analysis has been performed to test the ability of several point mutants to bind to a battery of natural and synthetic agonists and antagonists. Together, these studies identified at least nine residues wherein mutations reduce the affinity for binding to at least one ligand (3-5). Based on modeling the seven transmembrane domains of MC4R on the structure of rhodopsin, these nine residues exist in TM2 (E92), TM3 (D114, D118, D122, D126), TM4 (F176), TM6 (F261, H264), and TM7 (F284).
 
A pure modeling approach to deduce the three-dimensional structure of MC4R was also performed based on the crystal structure of the bovine G-protein rhodopsin (6). When a minimal inhibitory 3-mer peptide (RFF) from the sequence of the endogenous inhibitor Agouti-related protein (Agrp) was modeled as a ligand, residues in TM3, TM4, TM5 and TM6 were predicted to flank the ligand binding site, consistent with data from mutational analysis. Extracellular loops 2 and 3 also participate in docking of ligand. Interestingly, TM1 and TM7 were not predicted to contribute to ligand binding, although F284 was found at the edge of the ligand-binding pocket (6). The third intracellular loop of MC4R is predicted to form an α-helical segment, and play an important role in coupling the receptor to Gs. Finally, the model predicts two conserved proline kinks at P260 and P299, although the role of these kinks in protein function is unknown (6).
 
The Southbeach mutation results in the substitution of leucine 300 by a proline residue.
Expression/Localization
Mc4r transcript is detected primarily in the brain by Northern blot analysis (2). In situ hybridization reveals Mc4r in regions of the thalamus, hypothalamus and hippocampus, as well as in several other brain regions and spinal cord (2;7). MC4R is normally membrane-bound.
Background
Genetic factors can contribute a predisposition to obesity, and several single spontaneous mutations in both mice and humans result in obesity (8). In all cases, the mutated gene products function within a defined hypothalamic neural network that controls energy balance through the regulation of central melanocortinergic systems. A main mechanism of regulation involves the control of signaling by the central melanocortin receptors (MCRs), MC3R and MC4R. These receptors are now known to be activated or inhibited by the hormonally controlled production and release of neuropeptide ligands, based on both long- and short-term energy requirements of the body.
 
The search for brain melanocortin receptors was triggered by the discovery that the yellow, hyperphagic (having increased feeding behavior) and obese phenotype of mice carrying the dominant agouti lethal yellow (Ay) mutation is caused by ectopic expression of Agouti protein [reviewed in (9)]. Agouti protein, a paracrine signaling molecule normally limited to the skin, controls hair color by inhibiting the melanocyte-specific Mc1r. Obesity was hypothesized to result from aberrant inhibition of a related receptor controlling body weight. RT-PCR screening of brain tissue soon identified MC3R and MC4R (2;10), and significantly, Agouti-related protein (Agrp) was discovered as a hypothalamus-specific antagonist of MC3R and MC4R (11). The endogenous MC4R agonist was shown to be α-melanocyte stimulating hormone (α-MSH), a proteolytic product of pro-opiomelanocortin (Pomc), from which all melanocortin receptor agonists arise (2). Agrp stimulates food intake and weight gain; α-MSH inhibits food intake and promotes weight loss. Both Agouti protein and Agrp antagonize MC3R and MC4R signaling, but they are truly inverse agonists rather than antagonists of the receptors. Inverse agonists stabilize the inactive conformation of a receptor, while antagonists bind but favor neither the active nor inactive form of the receptor. Agrp was shown to be an inverse agonist by its reduction of the intrinsic, constitutive activity of MC4R (12). Both Agouti protein and Agrp decrease the affinity of the ligand-receptor complex for the regulatory subunit of the G-protein, decreasing signaling from the receptor.
 
Figure 5. Agrp/Npy neurons and Pomc/Cart neurons are located in the arcuate nucleus of the hypothalamus and are regulated by leptin from adipose tissue. Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons in the hypothalamus. Agouti and Agrp are hypothalamus-specific antagonists of MC3R and MC4R while α-MSH, a proteolytic product of Pomc, is a known agoinst of MC3R and MC4R. Agrp and Npy stimulate food intake and decrease energy expenditures, causing weight gain. Pomc and Cart inhibit food intake and increase energy expenditure. Agrp, Agouti-related protein; Agrp, producing Agrp; Npy, neuropeptide Y; Pomc, pro-opiomelanocortin; Cart, cocaine- and amphetamine-regulated transcript; α-MSH, α-melanocyte stimulating hormone; LEPR, leptin receptor.
The identification of the neurons expressing MC4R, and those producing the agonists and antagonists of melanocortin receptors, helped to define a central neural circuit controlling energy balance (9). Two sets of neurons in the arcuate nucleus (a region surrounding the third ventricle in the most ventral portion of the hypothalamus) act as sensors of whole-body energy status and initiate signals to maintain energy stores at a constant level (Figure 5). The Agrp/Npy neurons (producing Agrp and neuropeptide Y) are inhibited by the leptin peptide by signaling through the leptin receptor (mutated in Business class, Cherub and Well-upholstered), while Pomc/Cart neurons (producing Pomc, its proteolytic products and cocaine- and amphetamine-regulated transcript) are stimulated by leptin (13-15). Leptin is a circulating protein produced by adipose tissue, and plasma leptin levels reflect body fat stores (16-18). Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons (13;19). Thus, when leptin levels are low, Agrp/Npy neurons are activated and Pomc/Cart neurons are inhibited, producing Agrp but not Pomc, and resulting in inhibition of MC4R and increased food intake.
 
The physiological function of MC4R in the central regulation of energy balance was confirmed by the phenotype of Mc4r-/- mice, which develop obesity like that caused by overexpression of Agouti protein in Ay mice (20). Consistent with the antagonistic function of Agouti protein and Agrp towards MC4R, transgenic overexpression of Agouti protein or Agrp in mice both result in obesity (11). Pharmacological activation of MC4R by administration of α-MSH or a synthetic agonist suppresses feeding, and conversely, inhibition of MC4R by Agrp or a synthetic antagonist promotes feeding behavior in mice (21). In addition to the control of appetite, central melanocortin receptors also regulate insulin signaling. One week-long central infusion of α-MSH enhanced the actions of insulin on both glucose uptake and production, while a synthetic antagonist had the opposite effects (22). MC4R-null mice develop hyperinsulinemia and are hyperglycemic (20).
 
In humans, mutations in MC4R are associated with obesity (OMIM #601665; *155541). By late 2005, 58 MC4R mutations had been reported [reviewed in (23)], and such mutations are the most common cause of monogenic obesity in humans. It is estimated that 4% of single gene mutations causing severe childhood-onset obesity occur in MC4R (24;25). Human patients with MC4R mutations exhibit increased body mass index, increased appetite, increased height, increased lean mass, increased bone mineral density and hyperinsulinemia (24). With the exception of increased bone mineral density, these phenotypes are recapitulated in Mc4r null mice (20). Notably, in contrast to knockout mice which exhibit defects in basal energy expenditure, humans with MC4R mutations have apparently normal basal energy expenditure, suggesting that in humans, obesity is caused primarily by hyperphagia (20;24).
Putative Mechanism
Analysis of the properties of MC4R protein containing the Southbeach mutation indicates that this receptor is correctly targeted to the plasma membrane, but fails to bind its ligands, resulting in a drastic reduction in signaling from the receptor (1). Of the 24 amino acids in TM7, all but two (295 and 296) are identical between mouse and human MC4R. Leucine 300 is conserved in humans, although no mutations in this residue have been reported among human patients. However, mutations of both proline 299 and isoleucine 301 occur in obese patients. The P299H mutation is reported to cause intracellular retention of MC4R, resulting in surface expression levels of 18 ± 7% relative to wild type receptor (26). In contrast, I301T reduces ligand binding by over 80% compared to control cells in an [125I] NDP-αMSH binding assay using cells transiently expressing MC4R I301T (25). Either surface expression and/or ligand affinity may be reduced for the I301T receptor mutant (25). The di-isoleucine sequence at position 316/317 of human MC4R is required for cell surface expression of the receptor (27), but effects on surface expression can result from mutations throughout the sequence of the protein (23). It is not clear why the adjacent mutations L300P (1) and P299H (26) result in different effects on receptor surface expression.
 
The majority of human MC4R loss-of-function mutations follow an autosomal dominant inheritance pattern, consistent with the intermediate obesity phenotype observed in Mc4r+/- mice compared to their homozygous and wild type littermates (20;24;25). Reports indicate dominant negative effects (28), and others a lack thereof (29), for various MC4R mutants, suggesting that haploinsufficiency and dominant negative effects are both plausible causes for mutant phenotypes which must be evaluated for each specific case. The Southbeach phenotype is codominant, but haploinsufficiency has not been rigorously tested.
Primers Primers cannot be located by automatic search.
Genotyping
Southbeach genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
South(F): 5’-AGCGCAGCCTCCCAACTTCTACAG -3’
South(R): 5’-TCAGATCGGGCCAGAGTGACAAAG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:30
4) 68°C             1:20
5) repeat steps (2-4) 35X
6) 68°C             5:00
7) 4°C              ∞
 
Primers for sequencing
South_seq(F): 5’- TCCGCCAGGGTACCAACATGAAGG -3’
South_seq(R): 5’- CAGATCGGGCCAGAGTGACAAAG -3’
 
The following sequence of 1177 nucleotides (from Genbank genomic region NC_000084 for linear DNA sequence of Mcr4) is amplified:
 
 317                  agcg cagcctccca acttctacag gcatacagac tgggagagaa
 361 tcactcggag cttccctgac ccaggaggtt ggatcagttc aaggaggact caaatccagc
 421 tgctgcagga agatgaactc cacccaccac catggcatgt atacttccct ccacctctgg
 481 aaccgcagca gctacgggct gcacggcaat gccagcgagt cgctggggaa gggccacccg
 541 gacggaggat gctatgagca actttttgtt tcccccgagg tgtttgtgac tctgggtgtc
 601 ataagcctgt tggagaacat tctagtgatc gtggcgatag ccaagaacaa gaacctgcac
 661 tcacccatgt actttttcat ctgtagcctg gctgtggcag atatgctggt gagcgtttcg
 721 aatgggtcgg aaaccatcgt cattaccctg ttaaacagta cggatacgga tgcccagagc
 781 ttcaccgtga acattgataa tgtcattgac tctgtgatct gtagctcctt gctcgcatcc
 841 atttgcagcc tgctttccat tgcggtggac aggtatttca ctatctttta cgcgctccag
 901 taccataaca tcatgacggt taggcgggtc gggatcatca taagttgtat ctgggcagct
 961 tgcactgtgt caggcgtcct cttcatcatt tactcggaca gcagcgctgt catcatctgc
1021 ctcatttcca tgttcttcac tatgctagtt ctcatggcct ctctctatgt ccacatgttc
1081 ctgatggcga ggcttcacat taagaggatt gctgtcctcc caggcacagg gaccatccgc
1141 cagggtacca acatgaaggg ggcgattacc ttgaccatcc tgattggagt ctttgttgtc
1201 tgctgggccc cgttctttct ccatttactg ttctacatct cttgccctca gaatccatac
1261 tgcgtgtgct tcatgtctca ttttaatttg tatctcatac tgatcatgtg taacgccgtc
1321 atcgaccctc tcatttatgc cctccggagt caagaactga ggaaaacttt caaagagatc
1381 atctgtttct atcctctggg aggcatctgt gagttgtcta gcaggtatta agtgggggac
1441 agagtgcaaa ctaggtagat acctgcagac tttgtcactc tggcccgatc tga
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsKoichi Tabeta, Bruce Beutler
List |< first << previous [record 533 of 584] next >> last >|
Edit History
2011-07-06 2:22 PM (current)
2011-07-06 2:22 PM
2011-07-06 2:22 PM
2011-07-06 2:20 PM
2011-07-06 12:02 PM
2011-07-06 12:01 PM
2011-07-06 10:34 AM
2011-07-06 10:30 AM
2011-01-07 9:45 AM
2010-02-03 3:11 PM