Phenotypic Mutation 'farfalla_notturna'

• Allele: farfalla_notturna
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 124,709,398 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Ptpn6
• Gene Name: protein tyrosine phosphatase, non-receptor type 6
• Synonym(s): Hcph, SHP-1, hcp, Ptp1C
• Chromosomal Location: 124,697,670-124,715,672 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000004377] [ENSMUSP00000108103] [ENSMUSP00000129124] [ENSMUSP00000133747] [ENSMUSP00000133991]
• AlphaFold: P29351
• SMART Domains: Protein: ENSMUSP00000004377; Gene: ENSMUSG00000004266; AA Change: Y66C

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000004377)
• SMART Domains: Protein: ENSMUSP00000108103; Gene: ENSMUSG00000004266; AA Change: Y64C

Domain	Start	End	E-Value	Type
SH2	2	85	4.05e-28	SMART
SH2	108	200	1.45e-29	SMART
PTPc	243	517	7.51e-131	SMART
low complexity region	569	579	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112484)
• SMART Domains: Protein: ENSMUSP00000129124; Gene: ENSMUSG00000004266; AA Change: Y66C

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000171549)
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000133747; Gene: ENSMUSG00000004266; AA Change: Y43C

Domain	Start	End	E-Value	Type
SH2	2	64	2.35e-6	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000173647)
• SMART Domains: Protein: ENSMUSP00000133991; Gene: ENSMUSG00000004266; AA Change: Y25C

Domain	Start	End	E-Value	Type
Pfam:SH2	1	40	3.5e-6	PFAM
SH2	69	161	1.45e-29	SMART
PTPc	204	478	7.51e-131	SMART
low complexity region	530	540	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000174265)
• Meta Mutation Damage Score: 0.8384
• Is this an essential gene?: Possibly nonessential (E-score: 0.481)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 10:29 PM by Diantha La Vine
• Record Created: 2018-03-22 8:08 AM by Anne Murray
• Record Posted: 2018-04-04
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, Evan Nair-Gill, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_013545 (variant 1), NM_001077705 (variant 2); MGI:96055

Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU)(4) Gene trapped(3) Spontaneous (4) Targeted(5)

Phenotypic Description

Figure 1. Farfalla_notturna mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Farfalla_notturna mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Farfalla_notturna mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Farfalla_notturna mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Farfalla_notturna mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Farfalla_notturna mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Farfalla_notturna mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Farfalla_notturna mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Farfalla_notturna mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Farfalla_notturna mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Farfalla_notturna mice exhibit increased expression of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The farfalla_notturna phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6056, some of which showed reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 1), naive CD4 T cells in CD4 T cells (Figure 2), and naive CD8 T cells in CD8 T cells (Figure 3) with concomitant increased frequencies of CD8+ T cells in CD3+ T cells (Figure 4), central memory CD8 T cells in CD8 T cells (Figure 5), effector memory CD8 T cells in CD8 T cells (Figure 6), effector memory CD4 T cells in CD4 T cells (Figure 7), and B1 cells (Figure 8), all in the peripheral blood. CD44 expression on peripheral blood T cells (Figure 9), CD4+ T cells (Figure 10), and CD8+ T cells (Figure 11) was increased.

Nature of Mutation

Figure 12. Linkage mapping of the reduced naive CD4 T cells in CD4 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 102 mutations (X-axis) identified in the G1 male of pedigree R6056. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 102 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ptpn6:  an A to G transition at base pair 124,732,435 (v38) on chromosome 6, or base pair 6,275 in the GenBank genomic region NC_000072. The strongest association was found with a recessive model of inheritance to the normalized frequency of peripheral blood naïve CD4 T cells in CD4 T cells, wherein five variant homozygotes departed phenotypically from 11 homozygous reference mice and nine heterozygous mice with a P value of 5.928 x 10^-11 (Figure 12).  A substantial semidominant effect was observed in most of the assays, but the mutation is preponderantly recessive. 

The mutation corresponds to residue 392 in the mRNA sequence NM_013545 within exon 3 of 16 total exons.

376 GACTTCTATGACCTGTACGGAGGGGAGAAGTTT 59  -D--F--Y--D--L--Y--G--G--E--K--F-

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine to cysteine substitution at position 64 (Y64C) in variant 1 of the SHP1 protein.

Protein Prediction

Figure 13. Domain structure of SHP1. The position of the farfalla_notturna mutation is indicated. Other mutations found in SHP1 are noted in red. Click on the mutations for more specific information.

Ptpn6 encodes SHP1, a Src-homology 2 (SH2) domain-containing cytoplasmic protein tyrosine phosphatase. SHP1 has 4 isoforms. Three isoforms of SHP1 contain variations in their N-termini; the fourth isoform is a longer form with an extended C-terminus. SHP1 contains two tandem N-terminal SH2 domains (residues 1-108 and 116-208), a central catalytic domain (residues 270-532), and a C-terminal tail [(1), discussed in (2)]. The C-terminal tail contains multiple sites for tyrosine and serine phosphorylation. The mutation results in a tyrosine to cysteine substitution at position 64 (Y64C) within the SH2 domain. The farfalla_notturna mutation is predicted to affect all of the SHP1 isoforms.

For more information on Ptpn6, please see the record for spin.

Putative Mechanism

The phenotype of the farfalla_notturna mice suggests decreased SHP1 function. The phenotype of farfalla_notturna animals is less severe than the spin (3) and spin2 phenotypes as foot lesions were not observed in the farfalla_notturna mice. The foot lesions observed in the spin mice were associated with the development of splenomegaly and an increased number of erythroid and myeloid cells in the spleen, as well as a reduction in mature B cell numbers in the peripheral blood, spleen and bone marrow. Spontaneously occurring motheaten (me) and viable motheaten (me-v) mutants are immunodeficient and exhibit multiple defects stemming from increased inflammation, including alopecia, glomerulonephritis, dermatitis, inflammation of the paws, and interstitial pneumonitis which ultimately causes death by 3 and 9 weeks of age in Ptpn6^me/me and Ptpn6^me-v/me-v mice, respectively. The phenotype of the farfalla_notturna animals is significantly less severe than the Ptpn6^me-v allele, which encodes a SHP1 protein with approximately 20% catalytic activity (4).  It is likely that the SHP1 protein encoded by the farfalla_notturna allele retains catalytic activity that is greater than 20% of normal, and greater than the SHP1 protein encoded by the spin and spin2 alleles.

Primers

PCR Primer
farfalla_notturna_pcr_F: ACTTATCTCAAGGGACAGGGC
farfalla_notturna_pcr_R: CCTTGGCAGCTCATTGTGTG

References

  1. Yang, J., Liu, L., He, D., Song, X., Liang, X., Zhao, Z. J., and Zhou, G. W. (2003) Crystal Structure of Human Protein-Tyrosine Phosphatase SHP-1. J Biol Chem. 278, 6516-6520.

  2. Poole, A. W., and Jones, M. L. (2005) A SHPing Tale: Perspectives on the Regulation of SHP-1 and SHP-2 Tyrosine Phosphatases by the C-Terminal Tail. Cell Signal. 17, 1323-1332.

  3. Croker, B. A., Lawson, B. R., Berger, M., Eidenschenk, C., Blasius, A. L., Moresco, E. M., Sovath, S., Cengia, L., Shultz, L. D., Theofilopoulos, A. N., Pettersson, S., and Beutler, B. A. (2008) Inflammation and Autoimmunity Caused by a SHP1 Mutation Depend on IL-1, MyD88, and a Microbial Trigger. Proc Natl Acad Sci U S A. 105, 15028-15033.

  4. Kozlowski, M., Mlinaric-Rascan, I., Feng, G. S., Shen, R., Pawson, T., and Siminovitch, K. A. (1993) Expression and Catalytic Activity of the Tyrosine Phosphatase PTP1C is Severely Impaired in Motheaten and Viable Motheaten Mice. J Exp Med. 178, 2157-2163.