Phenotypic Mutation 'pretty2' (pdf version)
Allelepretty2
Mutation Type missense
Chromosome5
Coordinate75,649,550 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Kit
Gene Name kit oncogene
Synonym(s) SCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
Chromosomal Location 75,574,916-75,656,722 bp (+)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021099; MGI: 96677

Mapped Yes 
Amino Acid Change Isoleucine changed to Phenylalanine
Institutional SourceBeutler Lab
Ref Sequences
I787F in NCBI: NP_066922.2 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 520 542 N/A INTRINSIC
TyrKc 588 922 2.5e-138 SMART
low complexity region 941 959 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using NCBI: NP_066922.2)
Phenotypic Category Autosomal Dominant
Penetrance 100% 
Alleles Listed at MGI

All alleles(128) : Targeted, other(12) Gene trapped(31) Spontaneous(66) Chemically induced(17) Radiation induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.02
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.96
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense probably benign 0.39
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign 0.00
IGL03381:Kit APN 5 75607128 missense probably benign 0.07
Casper UTSW 5 75645875 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site noncoding transcript
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense possibly damaging 0.53
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
U24488:Kit UTSW 5 75623014 nonsense probably null
Mode of Inheritance Autosomal Dominant
Local Stock Embryos
Repository

none

Last Updated 2018-04-16 3:52 PM by Diantha La Vine
Record Created unknown
Record Posted 2008-01-31
Phenotypic Description
Pretty2 mice were identified by their distinct coat color pattern. Heterozygotes have a diluted coat color, light ears and tail, and a white belly spot; in some cases white dorsal spots are observed. On the C57BL/6:C3H/HeN hybrid background, animals often have a white belly and a white spindle-shaped spot on the forehead. Heterozygote intercrosses produce black-eyed offspring with an entirely white coat. Heterozygote Pretty2 mice strongly resemble WV/+ heterozygotes that bear a mutation at the c-kit locus (1).
 
A very similar mutation, known as Pretty, was the first visible phenodeviant to be identified in the course of our mutagenesis, and was lost because of marked infertility of the F1 founder male.

 

Nature of Mutation
The Pretty2 mutation corresponds to an A to T transversion at position 2387 of the Kit transcript on Chromosome 5. The mutation exists in exon 17 of 21 total exons.
 
2372 GCCTCCAAGAATTGTATTCACAGAGATTTGGCA
782  -A--S--K--N--C--I--H--R--D--L--A-
 
The mutated nucleotide is indicated in red lettering, and results in the amino acid substitution I787F.
Protein Prediction
Figure 1. Domain structure of KIT. The position of the Pretty2 mutation is indicated and results in the amino acid substitution I787F. Click on the image to view other mutations found in Kit.
Figure 2. Crystal structure of the KIT/SCF complex. The KIT extracellular domains are shown in blue, while the two SCF molecules are shown in green. β-strands are represented by arrows and α-helices by coils. UCSF Chimera model is based on PDB 2E9W, Yuzawa et al., Cell. 130, 232-334 (2007). Click on the 3D structure to view it rotate.
KIT is a 975 amino acid protein of the class III receptor tyrosine kinase (RTK) family, which contains five extracellular immunoglobulin (Ig) domains, a single transmembrane domain, a split tyrosine kinase domain, and a unique distribution of cysteine residues within the ligand binding domain (Figure 1) (2;3). The family includes colony stimulating factor 1 receptor (CSF1R, also called FMS), FMS-like tyrosine kinase 3 (FLT3), and platelet-derived growth factor receptor α (PDGFRα) and β. The N terminus of KIT (residues 1-23) contains a signal peptide followed by the mature 953 amino acid KIT polypeptide (4). In addition to the five Ig domains, the extracellular domain contains six regularly spaced cysteine residues (cysteines 58, 97, 136, 186, 233, 290) and nine potential N-linked glycosylation sites (4), features present in other extracellular receptor ligand binding domains (2;3). A hydrophobic stretch of 23 amino acids (residues 521-543) comprises the transmembrane region. The cytoplasmic domain, in the C-terminal half of the protein, contains sequences homologous to tyrosine kinases, including a group of polar and positively charged amino acids flanking the transmembrane domain, and a consensus ATP-binding site (4).
 
The kinase domains of class III RTKs are divided into two regions separated by an inserted sequence that varies in length between members and is thought to contribute to substrate specificity. As in the FMS and PDGF receptors, the KIT tyrosine kinase domain contains an insert of 77 hydrophilic amino acids bisecting the kinase domain (4).
 
Stem cell factor (SCF), the ligand for KIT, found as both membrane-anchored and soluble forms, functions as a noncovalent homodimer to activate KIT (5). Binding of SCF to KIT leads to receptor dimerization and activation of KIT kinase activity. The crystal structure of the ectodomain of KIT, with and without bound stem cell factor (SCF), reveals that SCF interacts with the first, second and third Ig domains of KIT (6) (Figure 2; PDB ID 2E9W), in agreement with earlier data based on the structure of SCF alone (5). The main region for SCF binding resides in the second KIT Ig domain, and binding is mediated by complementary electrostatic interactions between SCF and KIT (6). Upon ligand binding, the fourth and fifth Ig domains of two neighboring KIT ectodomains are brought closer together, stabilizing the interaction between two receptor molecules (6). Based on these data, it was proposed that KIT receptor dimerization is driven by binding of the SCF homodimer, whose exclusive function is to bring two KIT molecules together (6). Dimerization induces reorientation of the fourth and fifth Ig domains, enabling their lateral interaction and stabilization of the dimer.
 
Figure 3. Crystal structure of the bipartite KIT kinase domain. The N-lobe is shown in blue, the C-lobe is shown in green, the hinge region that forms part of the ATP binding site is shown in purple, and magnesium ions are shown in gray.  β-strands are represented by arrows and α-helices by coils. UCSF Chimera model is based on PDB 1PKG, Mol et al., J. Biol. Chem. 278, 31461-31464 (2003). The location of the Pretty2 mutation is indicated. Click on the image to view other mutations found within the KIT kinase domain. Click again to view it rotate.
Four isoforms of human KIT and two isoforms of mouse KIT are created by alternative splicing. Both human and mouse KIT mRNA can be spliced to include a 12 base pair insertion (encoding 4 amino acids) between nucleotides 512 and 513 of the cDNA sequence (7). The four amino acids (GNNK) are added to the extracellular domain, relatively close to the transmembrane domain. The GNNK+ and GNNK- isoforms are coexpressed in some cell types, but the GNNK- sequence is typically more abundant (7;8). Although the mechanism is unknown, the presence of the GNNK insert abolishes the low level of constitutive KIT signal transduction that normally occurs in the absence of SCF (when the isoform is transiently expressed in COS cells) (7). Humans express two additional isoforms that contain or lack a serine residue at position 715, within the inserted sequence bisecting the kinase domain; both the Ser+ and Ser- isoforms are also coexpressed (8).
 
The KIT tyrosine kinase domain has the characteristic bi-lobed architecture of all protein kinases (Figure 3; PDB ID 1PKG). Residues 582-671 comprise the small N-terminal lobe (N-lobe), and residues 678-953 comprise the large C-terminal lobe (C-lobe) [(9;10) and reviewed in (11)]. The cleft created between the two lobes contains the catalytic site. The Pretty2 mutation results in the substitution of isoleucine 787 by phenylalanine. I787 resides in the C-lobe of the kinase, and immediately precedes the catalytic loop of the kinase (consisting of the sequence HRDLAARN), which surrounds the actual site of phosphate transfer.
Expression/Localization
KIT is expressed in most stem cell types. Its expression is lost during cell differentiation with the exceptions of mature mast cells, melanocytes, and the intestinal interstitial cells of Cajal (12). KIT is expressed in hematopoietic stem cells, dendritic, erythroid, megakaryotic, and myeloid progenitor cells, and pro-B and pro-T cells (12). It is localized at the cell membrane.
Background
The W (dominant white spotting) locus in mice, reported in the early 1900s, was identified when normally pigmented mice developed a white spot on their bellies (13;14). In addition to this coat color phenotype, W mice were infertile due to defects in germ cell development, developed macrocytic anemia and exhibited drastically reduced numbers of mast cells due to defects in hematopoiesis, leading to perinatal death (13;15). W mice also exhibited deafness (16;17). These various phenotypes could be attributed to the failure of stem cell populations to migrate and/or proliferate effectively during development [see (18) for a discussion of findings described here]. Defects in W mutants are intrinsic to the stem cells of the affected tissues, which fail to proliferate and survive during embryogenesis. Thus, melanoblasts and primordial germ cells in W mutants fail to proliferate as they migrate from their origins in the neural crest and yolk sac, respectively. The hematopoietic defects (anemia, mast cell deficiency) of W mice are similarly stem cell-intrinsic. The blood-forming tissues of anemic W mice contain reduced numbers of stem cells, as measured by the number of colony-forming units generated from splenic tissue. Mast cells, derived from hematopoietic stem cells, are decreased to less than 1% of their normal level in W skin, and none are detected in other W tissues (15). Transplant of wild type bone marrow into W mutants completely rescues erythroid and non-erythroid cell populations, indicating that the mutant hematopoietic environment is capable of supporting normal hematopoiesis. The loss of hearing due to a lack of endocochlear potential in W mice is correlated with the lack of pigmentation in the stria vascularis in the inner ear (17). In addition, cochlear and outer hair cell morphology is abnormal in W mice (16). This is likely due to abnormal neural crest cell migration and/or proliferation. Injection of wild type neural crest cells into 9.5-day-old W mutant embryos partially rescues stria pigmentation (19).
 
v-kit was first identified in 1986 as the viral oncogene of the Hardy-Zuckerman 4 feline sarcoma virus, captured by the retrovirus in a truncated and activated form (20). The corresponding cellular gene, designated c-kit, was found to encode a receptor tyrosine kinase (3), and two years later in 1988, mutations in KIT were identified as the causative lesion in W alleles (18;21). More than 90 white spotting mice have been reported since the first W mutants were described. The complete absence of KIT kinase activity leads to death in utero or perinatally (13), but mice with loss-of-function mutations in KIT [for example in the Kit viable dominant spotting allele, Wv (1)] are viable, having variable defects in hematopoiesis, fertility and pigmentation (22). The severity of the mutant phenotype generally correlates with the level of KIT tyrosine kinase activity.
 
Stem cell factor (SCF) or Kit ligand (KL), encoded by the Steel locus (Sl), is the ligand for KIT (23-25), and mice with loss-of-function mutations in the Sl locus have a phenotype that is virtually identical to that of W mice (26). However, defects in Sl mutants are not cell intrinsic, and Sl melanoblasts or bone marrow cells transplanted into a wild type environment develop normally. SCF is widely expressed during embryogenesis; it is detected in brain, endothelium, gametes, heart, kidney, lung, melanocytes, skin, and the stromal cells of the bone marrow, liver, and thymus (12).
 
Figure 4. Binding partners use SH2 or other phosphotyrosine binding domains to interact with specific phosphotyrosine residues on activated KIT.  Schematic of several KIT interactors and the phosphorylated tyrosine residues to which they bind (numbering corresponds to human KIT).  The effect of signaling through each interactor was determined in cultured cell lines [(12) and references therein].
Signal transduction from KIT begins with the binding of an SCF homodimer, which leads to receptor dimerization and activation of receptor tyrosine kinase activity. Receptor autophosphorylation creates binding sites for SH2-containing and phosphotyrosine-binding proteins. KIT also phosphorylates substrate proteins that are recruited to the signaling complex. Many signaling molecules have been identified as binding partners for specific phosphotyrosine residues on activated KIT (Figure 4). These include the p85 subunit of phosphatidylinositol 3’ kinase (PI3K), phospholipase Cγ, and the Grb2 and Grb7 adaptors [reviewed in (12)]. The physiological significance of PI3K binding was tested in knock-in mice expressing KIT Y719F, in which the primary PI3K binding site was mutated to phenylalanine (27;28). The mutation abolished PI3K binding to KIT and subsequent PI3K-mediated signaling. KitY719F/Y719F mice are viable and display normal hematopoiesis and pigmentation. However, males are sterile due to a block in spermatogenesis arising from extensive apoptosis of spermatogonial stem cells (28). Female KitY719F/Y719F mice exhibit defects in follicle development, but are partially fertile (27).
 
Src family kinases and the protein tyrosine phosphatases SHP-1 and SHP-2 are also reported to associate with KIT (12). The significance of the KIT/SHP-1 interaction was demonstrated in vivo using double mutant KitW-v/W-v Shp1me/me mice (29;30). The spontaneously occurring motheaten (me) mutant expresses a null allele of Shp1 (see the record for spin), and develops autoimmune disease and systemic inflammation resulting in alopecia, skin inflammation of the paws and interstitial pneumonitis (31;32). Homozygosity for both the Wv and me alleles rescues aspects of both mutant phenotypes, including the pneumonitis associated with me and the embryonic lethality and mast cell deficiency associated with Wv (29;30). However, anemia associated with Wv mutation is not affected by the me allele. The juxtamembrane tyrosines 567 and 569, which form the binding site for Src kinases and SHP-1 and SHP-2, have also been examined in knock-in mice with Y to F mutations (KitFF) (33). Most KitFF mice die by 3 months of age. They display extensive white spotting, reduced numbers of mast cells, and splenomegaly due to increased numbers of B cells, but fertility is completely normal in both males and females (33). Although the precise signaling defects in KitFF mice are unknown (Y719 phosphorylation is also reduced by the FF mutation), this type of knock-in experiment clearly reveals that distinct signaling pathways mediated by different KIT binding partners can regulate separate biological processes.
 
In humans, loss-of-function mutations in KIT result in piebaldism (34) (OMIM #172800), an autosomal dominant disease characterized by a white forelock and large, non-pigmented patches on the forehead, eyebrows, chin, chest, abdomen and extremities. Interestingly, no hematopoietic defects have been reported in humans with KIT mutations. Activating mutations in KIT are implicated in several cancers, including gastrointestinal stromal tumors (35), mastocytosis (36), and germ cell tumors (37).
Putative Mechanism
The Pretty2 mutation (I787F) likely prevents proper activation of KIT kinase activity. As mentioned above (Protein Prediction), I787 resides in the C-lobe of the kinase, and immediately precedes the catalytic loop of the kinase (consisting of the sequence HRDLAARN), which surrounds the actual site of phosphate transfer. In addition, as seen in the crystal structure of activated KIT, I787 forms hydrogen bonds with R815 of the C-lobe, stabilizing the activation loop in an extended conformation required for kinase activation (10). Thus, mutation of I787 may both disrupt catalytic loop structure or orientation, as well as prevent the activation loop from adopting an open conformation induced by ligand binding.
Primers Primers cannot be located by automatic search.
Genotyping
Pretty2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.  This protocol has not been tested.
 
Primers
Pretty2 (F): 5’- CCTCTTCCTTGTGTCCTTGGGAGAA -3’
Pretty2 (R): 5’- AAATGGATTGCTAGTTTCAGCCTATCGT -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
Primers for sequencing
Pretty2_seq(F): 5’- GCAATTATAGTCATTAGAGCCCCG -3’
Pretty2_seq(R): 5’- GGTACTAACATGTGACATTACAAGG -3’
 
The following sequence of 758 nucleotides (from Genbank genomic region NC_000071 for linear genomic sequence of Kit) is amplified:
 
74117                  cctc ttccttgtgt ccttgggaga agacgtcaag ttgaagctgt
74161 gaaacttttt tttttttttt ttttttggag aaaacgttca aagagatgca tacaaaatga
74221 actttcattt tagaaatggg atttgactat ttataatgca ttttcctgtg aatggaagga
74281 agggagaaag acgtttatta aaattgggtt ggaaagcaat tatagtcatt agagccccga
74341 tcctgtgaaa cacaaaacgg gaatatcact tgcaccataa tttttatttt cggtgtgcta
74401 aatactttaa aacgaaagtt tctttttttt tttcatgtaa acaccattgt agtattaaaa
74461 tcatcttctc tcggagagct gaaatgaatg gctgttgctg tctttccttt tctcccccaa
74521 cagtgtattc acagagattt ggcagccagg aatatcctcc tcactcacgg gcggatcaca
74581 aagatttgcg atttcgggct agccagagac atcaggaatg attcgaatta cgtggtcaaa
74641 ggaaatgtga gtacctttct ccatctcatg agtctaccca gggtgctttg gtatccagtc
74701 ttgattctaa attgttttct atgatcatta caactcctac cttgtaatgt cacatgttag
74761 taccactaag gcttgttaat agaattttta gctataattg tataattggg ggtgtgcgaa
74821 ataaacaaaa atagccttaa tttttcacga taggctgaaa ctagcaatcc attt
 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.

References
 26.  Saravella, P. A. and Russell, L. B. (1956) Steel, a new dominant gene in the house mouse, J Hered 47, 123-128.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsXin Du, Bruce Beutler
Edit History
2011-05-18 1:27 PM (current)
2011-05-18 12:24 PM
2011-05-18 12:18 PM
2011-05-18 12:12 PM
2011-05-18 12:10 PM
2011-05-18 12:08 PM
2011-05-18 12:06 PM
2011-05-18 12:04 PM
2011-05-18 12:01 PM
2011-01-07 9:34 AM
2010-12-17 11:19 AM
2010-12-17 11:18 AM
2010-12-17 11:16 AM
2010-12-17 11:05 AM
2010-12-17 11:04 AM
2010-12-17 11:02 AM
2010-02-03 10:24 AM