Phenotypic Mutation 'pretty2'

• Allele: pretty2
• Mutation Type: missense
• Chromosome: 5
• Coordinate: 75,810,210 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Kit
• Gene Name: KIT proto-oncogene receptor tyrosine kinase
• Synonym(s): Gsfsco1, CD117, SCO1, Gsfsow3, belly-spot, SCO5, SOW3, Tr-kit, c-KIT, Steel Factor Receptor, Gsfsco5, Dominant white spotting
• Chromosomal Location: 75,735,647-75,817,382 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Phenylalanine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P05532
• PDB Structure: Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000005815; Gene: ENSMUSG00000005672; AA Change: I791F

Domain	Start	End	E-Value	Type
low complexity region	10	18	N/A	INTRINSIC
low complexity region	25	38	N/A	INTRINSIC
IG	43	113	3.02e0	SMART
IG_like	122	206	1.09e2	SMART
IGc2	225	300	3.79e-4	SMART
IG	323	413	1.21e-2	SMART
IG_like	429	501	1.88e0	SMART
transmembrane domain	524	546	N/A	INTRINSIC
TyrKc	592	926	2.5e-138	SMART
low complexity region	945	963	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000005815)
• SMART Domains: Protein: ENSMUSP00000116465; Gene: ENSMUSG00000005672; AA Change: I787F

Domain	Start	End	E-Value	Type
low complexity region	1	10	N/A	INTRINSIC
low complexity region	22	30	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
IG	55	125	3.02e0	SMART
IG_like	134	218	1.09e2	SMART
IGc2	237	312	3.79e-4	SMART
IG	335	425	1.21e-2	SMART
IG_like	441	513	1.88e0	SMART
transmembrane domain	532	554	N/A	INTRINSIC
TyrKc	600	934	2.5e-138	SMART
low complexity region	953	971	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000144270)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably essential (E-score: 0.963)
• Phenotypic Category: Autosomal Dominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Embryos
• Last Updated: 2019-06-23 3:56 PM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2008-01-31
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Xin Du, Bruce Beutler

Accession Number

NCBI RefSeq: NM_021099; MGI: 96677

Alleles Listed at MGI

All alleles(128) : Targeted, other(12) Gene trapped(31) Spontaneous(66) Chemically induced(17) Radiation induced(2)

Repository

none

Phenotypic Description

Pretty2 mice were identified by their distinct coat color pattern. Heterozygotes have a diluted coat color, light ears and tail, and a white belly spot; in some cases white dorsal spots are observed. On the C57BL/6:C3H/HeN hybrid background, animals often have a white belly and a white spindle-shaped spot on the forehead. Heterozygote intercrosses produce black-eyed offspring with an entirely white coat. Heterozygote Pretty2 mice strongly resemble W^V/+ heterozygotes that bear a mutation at the c-kit locus (1).

 

A very similar mutation, known as Pretty, was the first visible phenodeviant to be identified in the course of our mutagenesis, and was lost because of marked infertility of the F1 founder male.

Nature of Mutation

The Pretty2 mutation corresponds to an A to T transversion at position 2387 of the Kit transcript on Chromosome 5. The mutation exists in exon 17 of 21 total exons.

 

2372 GCCTCCAAGAATTGTATTCACAGAGATTTGGCA

782  -A--S--K--N--C--I--H--R--D--L--A-

 

The mutated nucleotide is indicated in red lettering, and results in the amino acid substitution I787F.

Protein Prediction

Figure 1. Domain structure of KIT. The position of the Pretty2 mutation is indicated and results in the amino acid substitution I787F. Click on the image to view other mutations found in Kit.

Figure 2. Crystal structure of the KIT/SCF complex. The KIT extracellular domains are shown in blue, while the two SCF molecules are shown in green. β-strands are represented by arrows and α-helices by coils. UCSF Chimera model is based on PDB 2E9W, Yuzawa et al., Cell. 130, 232-334 (2007). Click on the 3D structure to view it rotate.

KIT is a 975 amino acid protein of the class III receptor tyrosine kinase (RTK) family, which contains five extracellular immunoglobulin (Ig) domains, a single transmembrane domain, a split tyrosine kinase domain, and a unique distribution of cysteine residues within the ligand binding domain (Figure 1) (2;3). The family includes colony stimulating factor 1 receptor (CSF1R, also called FMS), FMS-like tyrosine kinase 3 (FLT3), and platelet-derived growth factor receptor α (PDGFRα) and β. The N terminus of KIT (residues 1-23) contains a signal peptide followed by the mature 953 amino acid KIT polypeptide (4). In addition to the five Ig domains, the extracellular domain contains six regularly spaced cysteine residues (cysteines 58, 97, 136, 186, 233, 290) and nine potential N-linked glycosylation sites (4), features present in other extracellular receptor ligand binding domains (2;3). A hydrophobic stretch of 23 amino acids (residues 521-543) comprises the transmembrane region. The cytoplasmic domain, in the C-terminal half of the protein, contains sequences homologous to tyrosine kinases, including a group of polar and positively charged amino acids flanking the transmembrane domain, and a consensus ATP-binding site (4).

 

The kinase domains of class III RTKs are divided into two regions separated by an inserted sequence that varies in length between members and is thought to contribute to substrate specificity. As in the FMS and PDGF receptors, the KIT tyrosine kinase domain contains an insert of 77 hydrophilic amino acids bisecting the kinase domain (4).

 

Stem cell factor (SCF), the ligand for KIT, found as both membrane-anchored and soluble forms, functions as a noncovalent homodimer to activate KIT (5). Binding of SCF to KIT leads to receptor dimerization and activation of KIT kinase activity. The crystal structure of the ectodomain of KIT, with and without bound stem cell factor (SCF), reveals that SCF interacts with the first, second and third Ig domains of KIT (6) (Figure 2; PDB ID 2E9W), in agreement with earlier data based on the structure of SCF alone (5). The main region for SCF binding resides in the second KIT Ig domain, and binding is mediated by complementary electrostatic interactions between SCF and KIT (6). Upon ligand binding, the fourth and fifth Ig domains of two neighboring KIT ectodomains are brought closer together, stabilizing the interaction between two receptor molecules (6). Based on these data, it was proposed that KIT receptor dimerization is driven by binding of the SCF homodimer, whose exclusive function is to bring two KIT molecules together (6). Dimerization induces reorientation of the fourth and fifth Ig domains, enabling their lateral interaction and stabilization of the dimer.

 

Figure 3. Crystal structure of the bipartite KIT kinase domain. The N-lobe is shown in blue, the C-lobe is shown in green, the hinge region that forms part of the ATP binding site is shown in purple, and magnesium ions are shown in gray.  β-strands are represented by arrows and α-helices by coils. UCSF Chimera model is based on PDB 1PKG, Mol et al., J. Biol. Chem. 278, 31461-31464 (2003). The location of the Pretty2 mutation is indicated. Click on the image to view other mutations found within the KIT kinase domain. Click again to view it rotate.

Four isoforms of human KIT and two isoforms of mouse KIT are created by alternative splicing. Both human and mouse KIT mRNA can be spliced to include a 12 base pair insertion (encoding 4 amino acids) between nucleotides 512 and 513 of the cDNA sequence (7). The four amino acids (GNNK) are added to the extracellular domain, relatively close to the transmembrane domain. The GNNK⁺ and GNNK^- isoforms are coexpressed in some cell types, but the GNNK^- sequence is typically more abundant (7;8). Although the mechanism is unknown, the presence of the GNNK insert abolishes the low level of constitutive KIT signal transduction that normally occurs in the absence of SCF (when the isoform is transiently expressed in COS cells) (7). Humans express two additional isoforms that contain or lack a serine residue at position 715, within the inserted sequence bisecting the kinase domain; both the Ser⁺ and Ser^- isoforms are also coexpressed (8).

 

The KIT tyrosine kinase domain has the characteristic bi-lobed architecture of all protein kinases (Figure 3; PDB ID 1PKG). Residues 582-671 comprise the small N-terminal lobe (N-lobe), and residues 678-953 comprise the large C-terminal lobe (C-lobe) [(9;10) and reviewed in (11)]. The cleft created between the two lobes contains the catalytic site. The Pretty2 mutation results in the substitution of isoleucine 787 by phenylalanine. I787 resides in the C-lobe of the kinase, and immediately precedes the catalytic loop of the kinase (consisting of the sequence HRDLAARN), which surrounds the actual site of phosphate transfer.

Expression/Localization

KIT is expressed in most stem cell types. Its expression is lost during cell differentiation with the exceptions of mature mast cells, melanocytes, and the intestinal interstitial cells of Cajal (12). KIT is expressed in hematopoietic stem cells, dendritic, erythroid, megakaryotic, and myeloid progenitor cells, and pro-B and pro-T cells (12). It is localized at the cell membrane.

Background

The W (dominant white spotting) locus in mice, reported in the early 1900s, was identified when normally pigmented mice developed a white spot on their bellies (13;14). In addition to this coat color phenotype, W mice were infertile due to defects in germ cell development, developed macrocytic anemia and exhibited drastically reduced numbers of mast cells due to defects in hematopoiesis, leading to perinatal death (13;15). W mice also exhibited deafness (16;17). These various phenotypes could be attributed to the failure of stem cell populations to migrate and/or proliferate effectively during development [see (18) for a discussion of findings described here]. Defects in W mutants are intrinsic to the stem cells of the affected tissues, which fail to proliferate and survive during embryogenesis. Thus, melanoblasts and primordial germ cells in W mutants fail to proliferate as they migrate from their origins in the neural crest and yolk sac, respectively. The hematopoietic defects (anemia, mast cell deficiency) of W mice are similarly stem cell-intrinsic. The blood-forming tissues of anemic W mice contain reduced numbers of stem cells, as measured by the number of colony-forming units generated from splenic tissue. Mast cells, derived from hematopoietic stem cells, are decreased to less than 1% of their normal level in W skin, and none are detected in other W tissues (15). Transplant of wild type bone marrow into W mutants completely rescues erythroid and non-erythroid cell populations, indicating that the mutant hematopoietic environment is capable of supporting normal hematopoiesis. The loss of hearing due to a lack of endocochlear potential in W mice is correlated with the lack of pigmentation in the stria vascularis in the inner ear (17). In addition, cochlear and outer hair cell morphology is abnormal in W mice (16). This is likely due to abnormal neural crest cell migration and/or proliferation. Injection of wild type neural crest cells into 9.5-day-old W mutant embryos partially rescues stria pigmentation (19).

 

v-kit was first identified in 1986 as the viral oncogene of the Hardy-Zuckerman 4 feline sarcoma virus, captured by the retrovirus in a truncated and activated form (20). The corresponding cellular gene, designated c-kit, was found to encode a receptor tyrosine kinase (3), and two years later in 1988, mutations in KIT were identified as the causative lesion in W alleles (18;21). More than 90 white spotting mice have been reported since the first W mutants were described. The complete absence of KIT kinase activity leads to death in utero or perinatally (13), but mice with loss-of-function mutations in KIT [for example in the Kit viable dominant spotting allele, W^v (1)] are viable, having variable defects in hematopoiesis, fertility and pigmentation (22). The severity of the mutant phenotype generally correlates with the level of KIT tyrosine kinase activity.

 

Stem cell factor (SCF) or Kit ligand (KL), encoded by the Steel locus (Sl), is the ligand for KIT (23-25), and mice with loss-of-function mutations in the Sl locus have a phenotype that is virtually identical to that of W mice (26). However, defects in Sl mutants are not cell intrinsic, and Sl melanoblasts or bone marrow cells transplanted into a wild type environment develop normally. SCF is widely expressed during embryogenesis; it is detected in brain, endothelium, gametes, heart, kidney, lung, melanocytes, skin, and the stromal cells of the bone marrow, liver, and thymus (12).

 

Figure 4. Binding partners use SH2 or other phosphotyrosine binding domains to interact with specific phosphotyrosine residues on activated KIT.  Schematic of several KIT interactors and the phosphorylated tyrosine residues to which they bind (numbering corresponds to human KIT).  The effect of signaling through each interactor was determined in cultured cell lines [(12) and references therein].

Signal transduction from KIT begins with the binding of an SCF homodimer, which leads to receptor dimerization and activation of receptor tyrosine kinase activity. Receptor autophosphorylation creates binding sites for SH2-containing and phosphotyrosine-binding proteins. KIT also phosphorylates substrate proteins that are recruited to the signaling complex. Many signaling molecules have been identified as binding partners for specific phosphotyrosine residues on activated KIT (Figure 4). These include the p85 subunit of phosphatidylinositol 3’ kinase (PI3K), phospholipase Cγ, and the Grb2 and Grb7 adaptors [reviewed in (12)]. The physiological significance of PI3K binding was tested in knock-in mice expressing KIT Y719F, in which the primary PI3K binding site was mutated to phenylalanine (27;28). The mutation abolished PI3K binding to KIT and subsequent PI3K-mediated signaling. Kit^Y719F/Y719F mice are viable and display normal hematopoiesis and pigmentation. However, males are sterile due to a block in spermatogenesis arising from extensive apoptosis of spermatogonial stem cells (28). Female Kit^Y719F/Y719F mice exhibit defects in follicle development, but are partially fertile (27).

 

Src family kinases and the protein tyrosine phosphatases SHP-1 and SHP-2 are also reported to associate with KIT (12). The significance of the KIT/SHP-1 interaction was demonstrated in vivo using double mutant Kit^W-v/W-v Shp1^me/me mice (29;30). The spontaneously occurring motheaten (me) mutant expresses a null allele of Shp1 (see the record for spin), and develops autoimmune disease and systemic inflammation resulting in alopecia, skin inflammation of the paws and interstitial pneumonitis (31;32). Homozygosity for both the W^v and me alleles rescues aspects of both mutant phenotypes, including the pneumonitis associated with me and the embryonic lethality and mast cell deficiency associated with W^v (29;30). However, anemia associated with W^v mutation is not affected by the me allele. The juxtamembrane tyrosines 567 and 569, which form the binding site for Src kinases and SHP-1 and SHP-2, have also been examined in knock-in mice with Y to F mutations (Kit^FF) (33). Most Kit^FF mice die by 3 months of age. They display extensive white spotting, reduced numbers of mast cells, and splenomegaly due to increased numbers of B cells, but fertility is completely normal in both males and females (33). Although the precise signaling defects in Kit^FF mice are unknown (Y719 phosphorylation is also reduced by the FF mutation), this type of knock-in experiment clearly reveals that distinct signaling pathways mediated by different KIT binding partners can regulate separate biological processes.

 

In humans, loss-of-function mutations in KIT result in piebaldism (34) (OMIM #172800), an autosomal dominant disease characterized by a white forelock and large, non-pigmented patches on the forehead, eyebrows, chin, chest, abdomen and extremities. Interestingly, no hematopoietic defects have been reported in humans with KIT mutations. Activating mutations in KIT are implicated in several cancers, including gastrointestinal stromal tumors (35), mastocytosis (36), and germ cell tumors (37).

Putative Mechanism

The Pretty2 mutation (I787F) likely prevents proper activation of KIT kinase activity. As mentioned above (Protein Prediction), I787 resides in the C-lobe of the kinase, and immediately precedes the catalytic loop of the kinase (consisting of the sequence HRDLAARN), which surrounds the actual site of phosphate transfer. In addition, as seen in the crystal structure of activated KIT, I787 forms hydrogen bonds with R815 of the C-lobe, stabilizing the activation loop in an extended conformation required for kinase activation (10). Thus, mutation of I787 may both disrupt catalytic loop structure or orientation, as well as prevent the activation loop from adopting an open conformation induced by ligand binding.

Primers

Primers cannot be located by automatic search.

Genotyping

Pretty2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.  This protocol has not been tested.

 

Primers

Pretty2 (F): 5’- CCTCTTCCTTGTGTCCTTGGGAGAA -3’

Pretty2 (R): 5’- AAATGGATTGCTAGTTTCAGCCTATCGT -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C              ∞

 

Primers for sequencing

Pretty2_seq(F): 5’- GCAATTATAGTCATTAGAGCCCCG -3’

Pretty2_seq(R): 5’- GGTACTAACATGTGACATTACAAGG -3’

 

The following sequence of 758 nucleotides (from Genbank genomic region NC_000071 for linear genomic sequence of Kit) is amplified:

 

74117                  cctc ttccttgtgt ccttgggaga agacgtcaag ttgaagctgt

74161 gaaacttttt tttttttttt ttttttggag aaaacgttca aagagatgca tacaaaatga

74221 actttcattt tagaaatggg atttgactat ttataatgca ttttcctgtg aatggaagga

74281 agggagaaag acgtttatta aaattgggtt ggaaagcaat tatagtcatt agagccccga

74341 tcctgtgaaa cacaaaacgg gaatatcact tgcaccataa tttttatttt cggtgtgcta

74401 aatactttaa aacgaaagtt tctttttttt tttcatgtaa acaccattgt agtattaaaa

74461 tcatcttctc tcggagagct gaaatgaatg gctgttgctg tctttccttt tctcccccaa

74521 cagtgtattc acagagattt ggcagccagg aatatcctcc tcactcacgg gcggatcaca

74581 aagatttgcg atttcgggct agccagagac atcaggaatg attcgaatta cgtggtcaaa

74641 ggaaatgtga gtacctttct ccatctcatg agtctaccca gggtgctttg gtatccagtc

74701 ttgattctaa attgttttct atgatcatta caactcctac cttgtaatgt cacatgttag

74761 taccactaag gcttgttaat agaattttta gctataattg tataattggg ggtgtgcgaa

74821 ataaacaaaa atagccttaa tttttcacga taggctgaaa ctagcaatcc attt

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.

References

   1.  Little, C. C. and Cloudman, A. M. (1937) The Occurrence of a Dominant Spotting Mutation in the House Mouse, Proc. Natl. Acad. Sci. U. S. A 23, 535-537.

   2.  Coussens, L., Yang-Feng, T. L., Liao, Y. C., Chen, E., Gray, A., McGrath, J., Seeburg, P. H., Libermann, T. A., Schlessinger, J., Francke, U., and . (1985) Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene, Science 230, 1132-1139.

   3.  Yarden, Y., Escobedo, J. A., Kuang, W. J., Yang-Feng, T. L., Daniel, T. O., Tremble, P. M., Chen, E. Y., Ando, M. E., Harkins, R. N., Francke, U., and . (1986) Structure of the receptor for platelet-derived growth factor helps define a family of closely related growth factor receptors, Nature 323, 226-232.

   4.  Yarden, Y., Kuang, W. J., Yang-Feng, T., Coussens, L., Munemitsu, S., Dull, T. J., Chen, E., Schlessinger, J., Francke, U., and Ullrich, A. (1987) Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand, EMBO J 6, 3341-3351.

   5.  Zhang, Z., Zhang, R., Joachimiak, A., Schlessinger, J., and Kong, X. P. (2000) Crystal structure of human stem cell factor: implication for stem cell factor receptor dimerization and activation, Proc. Natl. Acad. Sci. U. S. A 97, 7732-7737.

   6.  Yuzawa, S., Opatowsky, Y., Zhang, Z., Mandiyan, V., Lax, I., and Schlessinger, J. (2007) Structural basis for activation of the receptor tyrosine kinase KIT by stem cell factor, Cell 130, 323-334.

   7.  Reith, A. D., Ellis, C., Lyman, S. D., Anderson, D. M., Williams, D. E., Bernstein, A., and Pawson, T. (1991) Signal transduction by normal isoforms and W mutant variants of the Kit receptor tyrosine kinase, EMBO J 10, 2451-2459.

   8.  Crosier, P. S., Ricciardi, S. T., Hall, L. R., Vitas, M. R., Clark, S. C., and Crosier, K. E. (1993) Expression of isoforms of the human receptor tyrosine kinase c-kit in leukemic cell lines and acute myeloid leukemia, Blood 82, 1151-1158.

   9.  Mol, C. D., Lim, K. B., Sridhar, V., Zou, H., Chien, E. Y., Sang, B. C., Nowakowski, J., Kassel, D. B., Cronin, C. N., and McRee, D. E. (2003) Structure of a c-kit product complex reveals the basis for kinase transactivation, J Biol. Chem. 278, 31461-31464.

 10.  Mol, C. D., Dougan, D. R., Schneider, T. R., Skene, R. J., Kraus, M. L., Scheibe, D. N., Snell, G. P., Zou, H., Sang, B. C., and Wilson, K. P. (2004) Structural basis for the autoinhibition and STI-571 inhibition of c-Kit tyrosine kinase, J Biol. Chem. 279, 31655-31663.

 11.  Roskoski, R., Jr. (2005) Structure and regulation of Kit protein-tyrosine kinase--the stem cell factor receptor, Biochem. Biophys. Res. Commun. 338, 1307-1315.

 12.  Roskoski, R., Jr. (2005) Signaling by Kit protein-tyrosine kinase--the stem cell factor receptor, Biochem. Biophys. Res. Commun. 337, 1-13.

 13.  Russell, E. S. (1979) Hereditary anemias of the mouse: a review for geneticists, Adv. Genet. 20, 357-459.

 14.  Dunn, L. C. (1937) Studies on Spotting Patterns II. Genetic Analysis of Variegated Spotting in the House Mouse, Genetics 22, 43-64.

 15.  Kitamura, Y., Go, S., and Hatanaka, K. (1978) Decrease of mast cells in W/Wv mice and their increase by bone marrow transplantation, Blood 52, 447-452.

 16.  Deol, M. S. (1970) The origin of the acoustic ganglion and effects of the gene dominant spotting (Wv) in the mouse, J Embryol. Exp. Morphol. 23, 773-784.

 17.  Cable, J., Barkway, C., and Steel, K. P. (1992) Characteristics of stria vascularis melanocytes of viable dominant spotting (Wv/Wv) mouse mutants, Hear. Res. 64, 6-20.

 18.  Geissler, E. N., Ryan, M. A., and Housman, D. E. (1988) The dominant-white spotting (W) locus of the mouse encodes the c-kit proto-oncogene, Cell 55, 185-192.

 19.  Cable, J., Huszar, D., Jaenisch, R., and Steel, K. P. (1994) Effects of mutations at the W locus (c-kit) on inner ear pigmentation and function in the mouse, Pigment Cell Res. 7, 17-32.

 20.  Besmer, P., Murphy, J. E., George, P. C., Qiu, F. H., Bergold, P. J., Lederman, L., Snyder, H. W., Jr., Brodeur, D., Zuckerman, E. E., and Hardy, W. D. (1986) A new acute transforming feline retrovirus and relationship of its oncogene v-kit with the protein kinase gene family, Nature 320, 415-421.

 21.  Chabot, B., Stephenson, D. A., Chapman, V. M., Besmer, P., and Bernstein, A. (1988) The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus, Nature 335, 88-89.

 22.  Russell, E. S. (1949) Analysis of pleiotropism at the W-locus in the mouse; relationship between the effects of W and Wv substitution on hair pigmentation and on erythrocytes, Genetics 34, 708-723.

 23.  Huang, E., Nocka, K., Beier, D. R., Chu, T. Y., Buck, J., Lahm, H. W., Wellner, D., Leder, P., and Besmer, P. (1990) The hematopoietic growth factor KL is encoded by the Sl locus and is the ligand of the c-kit receptor, the gene product of the W locus, Cell 63, 225-233.

 24.  Martin, F. H., Suggs, S. V., Langley, K. E., Lu, H. S., Ting, J., Okino, K. H., Morris, C. F., McNiece, I. K., Jacobsen, F. W., Mendiaz, E. A., and . (1990) Primary structure and functional expression of rat and human stem cell factor DNAs, Cell 63, 203-211.

 25.  Williams, D. E., Eisenman, J., Baird, A., Rauch, C., Van, N. K., March, C. J., Park, L. S., Martin, U., Mochizuki, D. Y., Boswell, H. S., and . (1990) Identification of a ligand for the c-kit proto-oncogene, Cell 63, 167-174.

 26.  Saravella, P. A. and Russell, L. B. (1956) Steel, a new dominant gene in the house mouse, J Hered 47, 123-128.

 27.  Kissel, H., Timokhina, I., Hardy, M. P., Rothschild, G., Tajima, Y., Soares, V., Angeles, M., Whitlow, S. R., Manova, K., and Besmer, P. (2000) Point mutation in kit receptor tyrosine kinase reveals essential roles for kit signaling in spermatogenesis and oogenesis without affecting other kit responses, EMBO J 19, 1312-1326.

 28.  Blume-Jensen, P., Jiang, G., Hyman, R., Lee, K. F., O'Gorman, S., and Hunter, T. (2000) Kit/stem cell factor receptor-induced activation of phosphatidylinositol 3'-kinase is essential for male fertility, Nat. Genet. 24, 157-162.

 29.  Lorenz, U., Bergemann, A. D., Steinberg, H. N., Flanagan, J. G., Li, X., Galli, S. J., and Neel, B. G. (1996) Genetic analysis reveals cell type-specific regulation of receptor tyrosine kinase c-Kit by the protein tyrosine phosphatase SHP1, J Exp. Med. 184, 1111-1126.

 30.  Paulson, R. F., Vesely, S., Siminovitch, K. A., and Bernstein, A. (1996) Signalling by the W/Kit receptor tyrosine kinase is negatively regulated in vivo by the protein tyrosine phosphatase Shp1, Nat. Genet. 13, 309-315.

 31.  Green, M. C. and Shultz, L. D. (1975) Motheaten, an immunodeficient mutant of the mouse. I. Genetics and pathology, J. Hered. 66, 250-258.

 32.  Shultz, L. D., Coman, D. R., Bailey, C. L., Beamer, W. G., and Sidman, C. L. (1984) "Viable motheaten," a new allele at the motheaten locus. I. Pathology, Am. J. Pathol. 116, 179-192.

 33.  Kimura, Y., Jones, N., Kluppel, M., Hirashima, M., Tachibana, K., Cohn, J. B., Wrana, J. L., Pawson, T., and Bernstein, A. (2004) Targeted mutations of the juxtamembrane tyrosines in the Kit receptor tyrosine kinase selectively affect multiple cell lineages, Proc. Natl. Acad. Sci. U. S. A 101, 6015-6020.

 34.  Giebel, L. B. and Spritz, R. A. (1991) Mutation of the KIT (mast/stem cell growth factor receptor) protooncogene in human piebaldism, Proc. Natl. Acad. Sci. U. S. A 88, 8696-8699.

 35.  Hirota, S., Isozaki, K., Moriyama, Y., Hashimoto, K., Nishida, T., Ishiguro, S., Kawano, K., Hanada, M., Kurata, A., Takeda, M., Muhammad, T. G., Matsuzawa, Y., Kanakura, Y., Shinomura, Y., and Kitamura, Y. (1998) Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors, Science 279, 577-580.

 36.  Longley, B. J., Tyrrell, L., Lu, S. Z., Ma, Y. S., Langley, K., Ding, T. G., Duffy, T., Jacobs, P., Tang, L. H., and Modlin, I. (1996) Somatic c-KIT activating mutation in urticaria pigmentosa and aggressive mastocytosis: establishment of clonality in a human mast cell neoplasm, Nat. Genet. 12, 312-314.

 37.  Tian, Q., Frierson, H. F., Jr., Krystal, G. W., and Moskaluk, C. A. (1999) Activating c-kit gene mutations in human germ cell tumors, Am. J Pathol. 154, 1643-1647.