Phenotypic Mutation 'sean' (pdf version)
List |< first << previous [record 519 of 584] next >> last >|
Allelesean
Mutation Type nonsense
Chromosome9
Coordinate96,176,237 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Gk5
Gene Name glycerol kinase 5 (putative)
Synonym(s) C330018K18Rik, G630067D24Rik
Chromosomal Location 96,119,362-96,184,608 bp (+)
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in an obvious skin phenotype and does not lead to alopecia. [provided by MGI curators]
Accession Number

NCBI Refseq: NM_177352.4; MGI: 2443336

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000082313] [ENSMUSP00000112717] [ENSMUSP00000123594]
SMART Domains Protein: ENSMUSP00000082313
Gene: ENSMUSG00000041440
AA Change: Q424*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 9e-50 PFAM
Pfam:FGGY_C 296 485 7.7e-35 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000112717
Gene: ENSMUSG00000041440
AA Change: Q424*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 1.9e-49 PFAM
Pfam:FGGY_C 296 485 1.8e-35 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000123594
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
SCOP:d1bu6o1 24 56 1e-5 SMART
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
Blood Pressure: HR Day 1 - increased
FACS CD4:CD8 - decreased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS naive CD8 T cells in CD8 T cells - decreased
skin/coat/nails 28607088
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (other)(1) Gene trapped(17) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gk5 APN 9 96137789 missense probably damaging 0.98
IGL01387:Gk5 APN 9 96177554 critical splice donor site probably null
IGL01771:Gk5 APN 9 96177435 missense probably damaging 0.97
IGL02253:Gk5 APN 9 96137771 missense probably damaging 1.00
IGL02380:Gk5 APN 9 96150480 missense possibly damaging 0.92
IGL02566:Gk5 APN 9 96129046 missense possibly damaging 0.56
IGL03137:Gk5 APN 9 96176292 unclassified probably benign
IGL03256:Gk5 APN 9 96129053 missense probably damaging 1.00
IGL03326:Gk5 APN 9 96137839 critical splice donor site probably null
barrener UTSW 9 96129096 critical splice donor site probably null
homer UTSW 9 96140656 nonsense probably null
tangyuan UTSW 9 96150797 critical splice donor site probably null
toku UTSW 9 96140629 small deletion probably null
I1329:Gk5 UTSW 9 96140629 frame shift probably null
R0279:Gk5 UTSW 9 96174804 splice site probably benign
R0284:Gk5 UTSW 9 96181770 critical splice acceptor site probably null
R1134:Gk5 UTSW 9 96133407 missense probably benign 0.00
R1184:Gk5 UTSW 9 96150420 splice site probably benign
R1772:Gk5 UTSW 9 96150797 critical splice donor site probably null
R1781:Gk5 UTSW 9 96133455 missense possibly damaging 0.79
R3691:Gk5 UTSW 9 96129096 critical splice donor site probably null
R4213:Gk5 UTSW 9 96129053 missense probably damaging 1.00
R5015:Gk5 UTSW 9 96177417 critical splice acceptor site probably null
R5166:Gk5 UTSW 9 96174768 missense probably damaging 0.99
R5643:Gk5 UTSW 9 96140656 nonsense probably null
R5857:Gk5 UTSW 9 96119455 nonsense probably null
R5924:Gk5 UTSW 9 96150510 critical splice donor site probably null
R6109:Gk5 UTSW 9 96140610 missense probably benign 0.00
R6138:Gk5 UTSW 9 96176237 nonsense probably null
R6725:Gk5 UTSW 9 96155470 missense probably benign 0.01
R6812:Gk5 UTSW 9 96150749 missense probably damaging 0.99
U15987:Gk5 UTSW 9 96176237 nonsense probably null
Mode of Inheritance Unknown
Local Stock Live Mice
Repository
Last Updated 2018-09-24 10:03 AM by Anne Murray
Record Created 2018-03-26 2:31 PM by Jamie Russell
Record Posted 2018-04-04
Phenotypic Description
Figure 1. Sean mice exhibit varying degrees of progressive alopecia.
Figure 2. Sean mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Sean mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Sean mice exhibit increased expression of CD44 on peripheral blood CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sean phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6138, some of which showed varying degrees of progressive alopecia (Figure 1). Some mice also showed increased frequencies of CD44+ CD8 T cells (Figure 2) and central memory CD8 T cells in CD8 T cells (Figure 3) in the peripheral blood. The expression of CD44 was increased on peripheral blood CD8 T cells (Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of the central memory CD8 T cell phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 30 mutations (X-axis) identified in the G1 male of pedigree R6138. Normalized data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 30 mutations. All of the above anomalies were linked to a mutation in Gk5: a C to T transition at base pair 96,176,237(v38) on chromosome 9, or base pair 56,894 in the GenBank genomic region NC_000075. The strongest association was found with a recessive model of inheritance to the central memory CD8 T cell phenotype (P = 2.164 x 10-18), wherein six affected mice were homozygous for the variant allele, and 45 unaffected mice were either heterozygous (N = 24) or homozygous for the reference allele (N = 21) (Figure 5).  

 

The mutation corresponds to residue 1,292 in the mRNA sequence NM_177352.4 within exon 14 of 17 total exons.

 

1277 GCTTTCAGGAACAAACAGTTGTACGACATGCTG

419  -A--F--R--N--K--Q--L--Y--D--M--L-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine 424 for a premature stop codon (Q424*) in the GK5 protein.

Protein Prediction
Figure 6. Domain organization of GK5. The location of the sean mutation is indicated. Domain information is from SMART and UniProt. Additional mutations in GK5 are noted. Click on each mutation to view more information.

The glycerol kinase 5 (putative) (Gk5) gene encodes the 534 amino acid (aa) GK5 protein. The protein domains and function of GK5 have not been documented. SMART predicts that this uncharacterized protein contains two domains that are found in the FGGY family of carbohydrate kinases (Figure 6). The FGGY kinases contain conserved motifs at both the N- and C-termini (aa 25-287 and aa 396-416 in GK5, respectively; SMART). The FGGY_N and FGGY_C termini are structurally similar and adopt a ribonuclease H-like fold (1;2). Between the FGGY_N and FGGY_C domains is a catalytic cleft where the sugar substrate and ATP bind (3).  The sean mutation results in substitution of glutamine 424 for a premature stop codon (Q424*) in the GK5 protein; amino acid 424 is within the FGGY_C domain.

 

For more information about Gk5, please see the entry for toku.

Putative Mechanism

The over 4,000 members of the FGGY family phosphorylate sugar substrates in an ATP-dependent manner (3). Similar to glycerol kinase, GK5 is proposed to be involved in ATP binding, phosphotransferase activity, and glycerol kinase activity. GK5 is necessary for hair growth, and functions in the regulation of SREBP-1/-2-mediated cholesterol production in the skin (4). The buildup of sterol precursors in the sebocytes results in defects in hair follicle development and homeostasis as observed in the sean mice (4).

Primers PCR Primer
sean(F):5'- AGCTGAGCATAGACTAGGTGC -3'
sean(R):5'- GCTAGGCATAAGCTTTGGAAG -3'

Sequencing Primer
sean_seq(F):5'- AGCATAGACTAGGTGCTGTCCAC -3'
sean_seq(R):5'- CTAGGCATAAGCTTTGGAAGTCATG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsLauren Prince, Duanwu Zhang, Jamie Russell, and Bruce Beutler
List |< first << previous [record 519 of 584] next >> last >|