Phenotypic Mutation 'Casper' (pdf version)
List |< first << previous [record 58 of 511] next >> last >|
AlleleCasper
Mutation Type missense
Chromosome5
Coordinate75,645,875 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Kit
Gene Name kit oncogene
Synonym(s) SCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
Chromosomal Location 75,574,916-75,656,722 bp (+)
MGI Phenotype Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hemopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors.
Accession Number

NCBI RefSeq: NM_021099; MGI: 96677

Mapped Yes 
Amino Acid Change Aspartic acid changed to Glycine
Institutional SourceBeutler Lab
Ref Sequences
D676G in NCBI: NP_066922.2 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 520 542 N/A INTRINSIC
TyrKc 588 922 2.5e-138 SMART
low complexity region 941 959 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using NCBI: NP_066922.2)
Phenotypic Category hematopoietic system, immune system, pigmentation, reproductive system, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(128) : Targeted, other(12) Gene trapped(31) Spontaneous(66) Chemically induced(17) Radiation induced(2

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 1.00
IGL01149:Kit APN 5 75610876 missense possibly damaging 0.90
IGL01341:Kit APN 5 75607074 missense probably damaging 0.99
IGL02004:Kit APN 5 75621014 missense probably benign 0.00
IGL02281:Kit APN 5 75654534 missense probably benign 0.39
IGL02424:Kit APN 5 75639106 missense probably benign 0.00
IGL02697:Kit APN 5 75607259 missense probably benign 0.00
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign 0.00
IGL03127:Kit APN 5 75641188 missense possibly damaging 0.91
IGL03174:Kit APN 5 75607113 missense probably benign 0.04
IGL03381:Kit APN 5 75607128 missense probably damaging 0.98
Pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense probably benign 0.11
R0254:Kit UTSW 5 75620921 missense probably benign 0.00
R0329:Kit UTSW 5 75652829 missense probably benign 0.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign 0.01
R1115:Kit UTSW 5 75649532 splice acceptor site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.94
R2280:Kit UTSW 5 75637283 splice acceptor site probably benign
R2281:Kit UTSW 5 75637283 splice acceptor site probably benign
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 unclassified probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.98
R5203:Kit UTSW 5 75615492 nonsense probably null
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
Mode of Inheritance Autosomal Dominant
Local Stock Lost
Repository

none

Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 02/05/2008
Phenotypic Description

Casper was identified as a coat color phenotype in the G1 generation. Heterozygous mice have white patches on the belly, similar to WV/+ heterozygotes that bear a mutation at the c-kit locus (1). Homozygous Casper mice are completely white, with pink skin and black eyes. While Casper heterozygotes are fertile, homozygotes display sterility. Casper homozygotes have few or no mast cells.

Nature of Mutation
The Casper mutation corresponds to an A to G transition at position 2055 of the Kit transcript on Chromosome 5. The mutation exists in exon 14 of 21 total exons.
 
2039 TATTGTTGCTATGGTGATCTTTTGAATTTTTTG
671  -Y--C--C--Y--G--D--L--L--N--F--L-
 
The mutated nucleotide is indicated in red lettering, and results in the amino acid substitution D676G.
 
 
Protein Prediction
Figure 2. Domain structure of KIT. The position of the Casper mutation is indicated and results in the amino acid substitution D676G. Click on the image to view other mutations found in Kit.
Figure 2. Crystal structure of the bipartite KIT kinase domain. The N-lobe is shown in blue, the C-lobe is shown in green, the hinge region that forms part of the ATP binding site is shown in purple, and magnesium ions are shown in gray.  β-strands are represented by arrows and α-helices by coils. UCSF Chimera model is based on PDB 1PKG, Mol et al., J. Biol. Chem. 278, 31461-31464 (2003). The location of the Casper mutation is indicated. Click on the image to view other mutations found within the KIT kinase domain. Click again to view it rotate.

KIT is a 975 amino acid protein of the class III receptor tyrosine kinase (RTK) family, which contains five extracellular immunoglobulin (Ig) domains, a single transmembrane domain, a split tyrosine kinase domain, and a unique distribution of cysteine residues within the ligand binding domain (Figure 1) (2;3). The KIT tyrosine kinase domain has the characteristic bi-lobed architecture of all protein kinases (Figure 2; PDB ID 1PKG). Residues 582-671 comprise the small N-terminal lobe (N-lobe), and residues 678-953 comprise the large C-terminal lobe (C-lobe) [(4;5) and reviewed in (6)]. The cleft created between the two lobes contains the catalytic site. The Casper mutation results in the substitution of aspartic acid 676 by glycine. D676 resides in the hinge segment linking the two lobes of the kinase.

Please see the record for Pretty2 for information about Kit.
Putative Mechanism
Like the Pretty2 mutation (I787F), the Casper mutation likely prevents proper activation of KIT kinase activity. D676 lies in the hinge between the N- and C-lobes of the kinase domain, and forms part of the nucleotide binding site of the protein (4). In the crystal structure of active KIT, ADP is found to bind by inserting the adenine base into a hydrophobic pocket; hydrogen bonds with E671 and C673 (human protein numbering) stabilize the binding interaction (4). D677 (corresponding to mouse D676), along with R796 and G596, forms hydrogen bonds with hydroxyl groups on the ribose sugar. Replacing D676 with a glycine residue may prevent such hydrogen bonding by eliminating the oxygen atom that forms the bond. Thus, mutation of D676 may prevent or impair nucleotide binding to the KIT kinase domain, and thereby inhibit kinase activity.
Primers Primers cannot be located by automatic search.
Genotyping
Casper genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. This protocol has not been tested.
 
Primers
Casper (F): 5’- AGAAAGGGGCTTGCTTGTGCTAC -3’
Casper (R): 5’- TCCAATCCCACAGGACTAAGGCTG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
Primers for sequencing
Casper_seq(F): 5’- GTGCTACTTCACTCAGCACAATG -3’
Casper_seq(R): 5’- CAAGGGTACTACTATCTGAACTTCCG -3’
 
The following sequence of 627 nucleotides (from Genbank genomic region NC_000071 for linear genomic sequence of Kit) is amplified:
 
70600                                           a gaaaggggct tgcttgtgct
70621 acttcactca gcacaatgct gccttttttg atgagcggtg ttaacagata gaattatgtt
70681 gggactaaga aggcttagcc actgaatctg aatgttaata gccgcggtca cccatgggta
70741 tttttacagg aggcgggatt atctaaggta tatcatcttg cctataccta acattgtctt
70801 ctatcctcat agggcccacc ctggtcatta cagaatattg ttgctatggt gatcttttga
70861 attttttgag aaggaagcgt gactcgttta ttttctcaaa gcaagaagag caggcagaag
70921 cggcacttta taagaacctt ctgcactcaa cggagccttc ctggtaaggc tgatttgcat
70981 aaacagtcag ctgttgacag gcagttcatg gggtcataag ggtttgcaat caaggctgat
71041 tcttttaaaa aatgagcaga ggtgctccta ggtgtgaaat cagaattatt aaattgttta
71101 agcgtgatta actattccgg aagttcagat agtagtaccc ttgaagattc aaattgagat
71161 ttgtcactga tttctcttaa atgtgtgtct ctgtccttcc ttcagcctta gtcctgtggg
71221 attgga
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.
References
 1.  Little, C. C. and Cloudman, A. M. (1937) The Occurrence of a Dominant Spotting Mutation in the House Mouse, Proc. Natl. Acad. Sci. U. S. A 23, 535-537.
 2.  Coussens, L., Yang-Feng, T. L., Liao, Y. C., Chen, E., Gray, A., McGrath, J., Seeburg, P. H., Libermann, T. A., Schlessinger, J., Francke, U., and . (1985) Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene, Science 230, 1132-1139.
 3.  Yarden, Y., Escobedo, J. A., Kuang, W. J., Yang-Feng, T. L., Daniel, T. O., Tremble, P. M., Chen, E. Y., Ando, M. E., Harkins, R. N., Francke, U., and . (1986) Structure of the receptor for platelet-derived growth factor helps define a family of closely related growth factor receptors, Nature 323, 226-232.
 4.  Mol, C. D., Lim, K. B., Sridhar, V., Zou, H., Chien, E. Y., Sang, B. C., Nowakowski, J., Kassel, D. B., Cronin, C. N., and McRee, D. E. (2003) Structure of a c-kit product complex reveals the basis for kinase transactivation, J Biol. Chem. 278, 31461-31464.
 5.  Mol, C. D., Dougan, D. R., Schneider, T. R., Skene, R. J., Kraus, M. L., Scheibe, D. N., Snell, G. P., Zou, H., Sang, B. C., and Wilson, K. P. (2004) Structural basis for the autoinhibition and STI-571 inhibition of c-Kit tyrosine kinase, J Biol. Chem. 279, 31655-31663.
 6.  Roskoski, R., Jr. (2005) Structure and regulation of Kit protein-tyrosine kinase--the stem cell factor receptor, Biochem. Biophys. Res. Commun. 338, 1307-1315.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsXin Du, Bruce Beutler
List |< first << previous [record 58 of 511] next >> last >|
Edit History
05/25/2011 10:10 AM (current)
05/18/2011 2:14 PM
05/18/2011 2:08 PM
05/18/2011 2:08 PM
05/18/2011 2:07 PM
12/17/2010 11:16 AM
12/17/2010 11:10 AM
12/17/2010 11:10 AM
02/03/2010 9:11 AM