Phenotypic Mutation 'L1n' (pdf version)
List |< first << previous [record 17 of 17]
AlleleL1n
Mutation Type missense
Chromosome17
Coordinate31,681,025 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Cryaa
Gene Name crystallin, alpha A
Synonym(s) Crya-1, DAcry-1, Acry-1, alpha-A-crystallin, Crya1
Chromosomal Location 31,677,933-31,681,724 bp (+)
MGI Phenotype FUNCTION: This gene encodes subunit a, one of two subunits of alpha-crystallin, which is a high molecular weight, soluble aggregate and is a member of the small heat shock protein (sHSP) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. It acts as a molecular chaperone and is the major protein in the eye lens, maintaining the transparency and refractive index of the lens. In mouse, deficiency in this gene is associated with smaller lenses and eyes and with increasing lens opacity with age. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a targeted null mutation have small lenses that develop progressive opacity beginning in the nucleus. Homozygotes for spontaneous or ENU-induced mutations have normal sized lenses with a white nuclear cataract by weaning age that expands progressively. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013501; MGI: 88515

Mapped Yes 
Amino Acid Change Tyrosine changed to Aspartic acid
Institutional SourceBeutler Lab
Ref Sequences
Y141D in Ensembl: ENSMUSP00000019192 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:Crystallin 1 56 6.9e-24 PFAM
Pfam:HSP20 86 185 5.3e-24 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000019192)
Phenotypic Category
Phenotypequestion? Literature verified References
vision/eye
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted(5) Spontaneous(2) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Cryaa APN 17 31681026 missense probably damaging 1.00
R1553:Cryaa UTSW 17 31679559 missense probably damaging 1.00
R2061:Cryaa UTSW 17 31681055 missense probably benign 0.00
R4612:Cryaa UTSW 17 31678474 missense probably benign 0.04
R6843:Cryaa UTSW 17 31678173 missense possibly damaging 0.89
Mode of Inheritance Autosomal Semidominant
Local Stock None
Repository

Dr. Xiaohua Gong, University of California at Berkeley

Last Updated 2016-05-13 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 2012-02-02
Phenotypic Description

The L1N phenotype was identified by slit-lamp examination (which detects cataracts) of G1 mice born to ENU-mutagenized sires (1)L1N animals develop dominant nuclear cataracts.  Homozygous mutant mice show much denser nuclear cataracts.  Heterozygous lenses weigh approximately 7% less than wild type lenses, and homozygous lenses weigh approximately 19% less than wild type lenses.  An increased amount of insoluble lens proteins are found in L1N mutant lenses.  For additional phenotype information about L1N please refer to Xia et al. (1).

 

Nature of Mutation
The L1N mutation was mapped to Chromosome 17, and corresponds to a T to G transversion at position 477 of the Cryaa transcript, in exon 4 of 4 total exons
 
462  GAATTTCACCGTCGCTACCGTCTGCCTTCCAAT
136  -E--F--H--R--R--Y--R--L--P--S--N-
 
The mutated nucleotide is indicated in red lettering and results in conversion of tyrosine to aspartic acid at codon 141 in the longer form of αA-crystallin and codon 118 in the shorter form.
Protein Prediction

Figure 1. Structure of mouse αA-crystallin (short form). The α-crystallin domain (ACD) is conserved among the small heat shock proteins (sHSPs). The members of the α-crystallin family, αA-crystallin and αB-crystallin, share variable N- and C-terminal domains, which are involved in oligomerization. The long form of αA-crystallin contains an addtional 23 amino acids between residues 63 and 64 of the short form; the long form is not expressed in humans. The L1N mutation (Y118D) is within the ACD domain and is denoted by a red asterisk.

Figure 2. Crystal structures of αA-crystallin (white) and αB-crystallin (crystallin). These crystal structures are not complete at the N- and C- termini (see text), however, the extended linker regions of the C-termini can be seen. The L1N mutation is indicated in red at residue 118 in the αA-crystallin molecule (white). The αB-crystallin is shown in magenta.  αA and αB-crystallin can form a variety of large oligomers with other crystallins and other members of the sHSP family. The α-crystallins are notable for a pallindromic C-terminal sequence that is able to bind with a wide variety of molecules. Structures are based on PDB IDs: 3L1E and 3L1F and are generated with UCSF Chimera.

Cryaa encodes mouse αA-crystallin, a 173 amino acid protein that together with αB-crystallin, forms the α-crystallin family (Figure 1).  The α-crystallins are members of the small heat-shock protein (sHSP) super family and are known to have chaperone activity (2;3)Cryaa in rodents has two splice forms. The longer form of the protein is known as αAins and contains an extra 23 amino acids between residues 63 and 64 of the short form. Human αA-crystallin also has 173 residues and is 91% identical to the shorter form of the mouse protein.  The longer form of αA-crystallin does not appear to be expressed in humans, although at the genomic level nucleotides almost identical to the extra mouse exon are present at the same location (2).

 

Structures for other sHSP proteins have been described (4).  sHSP monomers, including α-crystallins, consist of a conserved α-crystallin domain (ACD) of approximately 90 amino acids, bordered by variable N- and C-terminal extensions.  The ACD forms an immunoglobin-like fold, and contains several β-strands organized into two β-sheets responsible for dimer formation in most sHSPs.  Site-directed spin labeling (SDSL) techniques suggest a similar formation for the ACD in αA-crystallin, in which two β-sheets, one consisting of three β-strands and the other consisting of four β-strands pack face-to-face to form an aligned β-sandwich (5).  The N-terminal extension of sHSP proteins modulates oligomerization, subunit dynamics and substrate binding, whereas the flexible C-terminal extension promotes solubility, chaperoning and oligomerization (3;4;6-8).

 

α-crystallins form variably sized multimeric aggregates made up of both αA-crystallin and αB-crystallin in the lenses.  These aggregates range in size from 300 to over 1000 kD, with the average being 700 kD in vivo. The sizes of the multimeric complexes depend on many parameters including concentration, temperature, pH, ionic strength, as well as lens age and species (2;3).  Cryo-electron microscopy suggests that these aggregates have a central cavity but the quaternary structure is highly variable (3;9).  The crystal structure of truncated αA-crystallin and αB-crystallin have been solved (PDB: #3L1E and #3L1F) (Figure 2) (10).  In both of these structures, 59 and 68 N-terminal residues and 10 and 13 C-terminal residues were removed from αA-crystallin and αB-crystallin, respectively (10).  In both the αA-crystallin and αB-crystallin structures, one side of the beta sandwhich fold consists of three beta strands that form an antiparallel beta sheet interation at the dimer (i.e. αA-crystallin and αB-crystallin) interface (10).  This interface generates one side with a surface composed of six beta strands.  A C-terminal extension from the beta strand core domain binds to the top of the beta sandwich of another molecule (10).  Within the C-terminal extension there is a hinge loop and a C-terminal tail  (10)

 

The L1N mutation results in the replacement of the 118th amino acid residue, tyrosine, with an aspartic acid in the seventh β-strand of the αA-crystallin ACD.  This alteration adds a negatively charged residue to the protein and is predicted to alter protein structure and may decrease chaperone-like function (1;6-8).

 

Expression/Localization

The ocular lens contains high levels of all crystallin proteins mostly in the cytoplasm of lens fibers, but the expression patterns of specific crystallin genes vary in the lens throughout embryonic development and adult life. During ocular development, αB-crystallin transcripts are present in the lens placode at E9.5.  Transcripts of αA-crystallin are first observed in the lens cup at E10 to 10.5.  During subsequent development of the lens, αA-crystallin transcripts are most abundant in the fiber cells, and αB-crystallin mRNA is preferentially expressed in epithelial cells. However, expression of αB-crystallin shifts to lens fibers once secondary lens fibers form. In the adult mouse, transcripts of αA-crystallin are detected only in the lens.  In contrast, αB-crystallin transcripts are present in retinal pigment epithelium, optic nerve, extraocular muscle, iris, ciliary body, cornea, and several nonocular sites, such as heart and nasal epithelium (11;12).  After birth, the concentration of αA-crystallin transcripts remains high until 6 months of age and gradually decreases with age (11;13).

Background

Figure 3. Normal development of the mammalian lens. Letters A through E illustrate key features in lens development. (A) The early surface ectoderm layer and the optic vesicle orginate from the diencephalon (not shown). (B) The ectoderm invaginates, forming the lens placode as it touches the optic vesicle. (C) Further movement of the ectodermal layer continues to form the primitive lens (i.e. the lens pit). The early retina begins as the presumptive neuroretina.  (D) Complete closure of the lens placode results in the formation of the lens vescicle. The optic vescicle has now formed the optic cup. (E) The lens vescicle is closed by elongation of the primary fibers and the neuroretina is formed. The optic stalk will later become the optic nerve. (F) The cellular structure of the lens. The epithelium caps the front of the lens. Cubidal epithelial cells migrate toward the lens equator, where they begin a process of elongation (i.e. differentiation) and eventual loss of intracellular organelles and the cell nucleus to form mature fibers. Once denucleation has occured, the lens fibers remain in place throught the life of the organism.   Abbreviations: SE, surface ectoderm; OV, optic vesicle; LPL, lens placode; LP, lens pit; PNR, presumptive neuroretina; LV, lens vesicle; OC, optic cup; PF, primary fibers; NR, neuroretina; OS, optic stalk.  Modified from (14;15).


Figure 4. Normal (middle row) and abnormal (bottom row) development of mammalian lens fibers. (top) Cross-section of the normal lens. (middle row) Normal lens fibers develop from the differentiation zone through a process of denucleation and loss of organelles. Mature lens fibers filed with properly formed crystallin proteins provide a clear lens with a high refractive index to facillitate vision. (bottom row) Abnormal lense fiber development occurs upon several mutations in the α-, β-, and γ-crystallin families. The abnormal process contains a collection of possible mechanisms contributing to abnormal lens development (i.e. the retention of nuclei and organelles, the formation of vacuoles, and abnormal aggregation of crystallin proteins) and potential cataract formation.

The ocular lens is a unique organ, able to focus light on the retina as a result of physiological properties and architecture that eliminate light scattering.  Normal development of the mouse lens begins by E9.5-10 when the developing optic vesicles have approached the surface ectoderm, which begins to thicken and form the lens placode (14;15) (Figure 3).  At E10.5, the lens placode begins to invaginate to form the lens vesicle.  At E11-13, the lens is characterized by elongation of cells from the posterior wall of the lens vesicle to form primary lens fibers, leading to obliteration of the vesicle cavity.  These primary fibers are maintained throughout life and constitute the nucleus of the adult lens.  The lens of the adult eye is an avascular tissue surrounded by the lens capsule, an extracellular matrix (ECM) secreted by lens cells.  Beneath the capsule, a single layer of cuboidal epithelial cells covers the anterior surface and is bathed in aqueous humour.  Further enlargement of the lens continues by proliferation and elongation of the epithelial cells at the lens equator to form secondary fibers, a process that continues throughout adult life.  Lens fibers face the posterior chamber of the eye and are bathed in vitreous humour.  Bioactive molecules such as fibroblast growth factor (FGF), present in the vitreous humour, initiate the change from lens epithelial cell to lens fiber [reviewed in (16)].  The fiber cells adopt a flattened hexagonal profile that facilitates packing into an ordered array promoting lens transparency.  Additionally, the fiber cells lose their intracellular organelles and undergo dramatic changes in the expression of cytoplasmic and membrane proteins.   The high expression of soluble and stable cytoplasmic crystallins creates a high index of refraction.  The crystallin concentration is highest in the lens nucleus and creates a radial gradient in refractive index that corrects for the curved shape of the lens (16-19).  The avascular lens is maintained through a flow of ionic current that is directed inwards at the poles and outwards at the equator and allows for nutrient and waste transport and maintenance of appropriate membrane potential.  Na+-K+ pumps, water channels, glucose transporters and gap junctions are all critical components of the lens microcirculatory system (19-21)

 

Loss of transparency of the lens due to disruption of the microcirculatory system or the lens architecture is manifested macroscopically in cataracts, the most common cause of blindness in humans (Figure 4).  Clinical descriptions of cataracts are based on the physical appearance and location of opacities within the lens.  Whole cataracts affect the entire lens while nuclear cataracts affect the center of the lens. Cortical cataracts originate in the lens cortex and lamellar cataracts are present in only one layer of the lens.  The term “zonular” refers to opacities that are confined to one or more discrete zones of the lens other than the poles.  The term “pulverulent” refers to powdery dustlike opacities that can be either zonular or widely dispersed throughout the lens.  Other terms have also been used to describe specific cataract phenotypes including cerulean, which describes a bluish coloring, and aculeiform, which refers to needle-like crystals in the lens.  For a full list of clinical cataract phenotypes, please refer to (22).  Cataracts are often caused by mutations in crystallins (please see L10, L23), channel proteins involved in the transport of water and metabolites, and connexins, the components of gap junction channels (see L1) (2;16;20).  Mutations in crystallins often change the biochemical properties of lens proteins, resulting in their insolubility and aggregation.  Age-related post-translational modifications such as phosphorylation, acidification, and cleavage can result in similar effects (2;6-8;16;23;24).

 

The crystallin proteins in the lens are divided into three main families, α-, β-, and γ-crystallins with the β/γ-crystallins forming a superfamily.  Crystallins appear to have evolved from preexisting proteins that were recruited to new structural roles in the lens.  The α-crystallins, αAand αB, resemble heat-shock proteins and have chaperone functions, maintaining the stability and solubility of other proteins in the lens fibers (3;25).  Theβ/γ-crystallins show similarities to bacterial spore coat protein and to Physarum species stress-induced proteins and act solely as structural protein in the lens. Additional crystallins, known as the taxon-specific crystallins, also exist.  These are often structurally related to metabolic enzymes such as lactate dehydrogenase and aldose reductase (2).

 

The α-crystallin family consists of two genes, Cryaa and Cryab, which encode αA-crystallin and αB-crystallin.  These proteins share roughly 60% amino acid identity and make up 20-30% of the total lens proteins with αA-crystallin occurring at a 3:1 ratio to αB-crystallin (3).  αA-crystallin becomes progressively phosphorylated with increasing age in the soluble fraction of lens lysates whereas αB-crystallin phosphorylation is essentially complete by 10 weeks of age.  Phosphorylation of α-crystallins may cause dissociation of α oligomers and reduction of chaperone-like activity (6;24).   α-crystallins also become progressively truncated at the C-terminus with increasing age and these truncated forms are found in the insoluble fraction of lens proteins.  Truncation likely causes loss of chaperone-like activity (6-8).  In mice, mutations in Cryaa cause dominant or recessive cataracts.  CryaaAey7 results in a valine to glutamine switch at amino acid 124, and causes a dominant nuclear and zonular cataract.  Since the mutation is located in the ACD of αA-crystallin, it is suggested to decrease chaperone-like activity (26).  Three other mutations in the Cryaa gene have been found to cause recessive cataracts in mice (1;27;28)Cryaa2J and Cryaalop18 alter the arginine at codon 54 to a cysteine or a histidine, respectively.  αA-crystallin knockout mice have small lenses with nuclear cataracts.  The knockout lenses have inclusion bodies that contain αB- and γ-crystallins suggesting that αA-crystallin maintains solubility of these proteins in the lens (3;29).   Surprisingly, αB knockout animals show no lens defects.  However, they die around 6 months of age, and it is possible αB-crystallin is necessary to maintain lens transparency later in life (28)

 

Mutations in CRYAA and CRYAB genes also result in inherited cataracts in humans.  Missense mutations of CRYAA have been found to cause dominant cataracts and cataract-microcornea syndrome (OMIM #604219 and OMIM #116150) (30;31).  Three of these mutations alter the arginine at codon 116, suggesting the importance of this amino acid in the structure and function of αA-crystallin.  Another three occur in the more variable N-terminal region.  A nonsense mutation leading to premature termination at amino acid 9 was found to cause recessive cataracts in humans (32).

Putative Mechanism

The substitution of the 118th tyrosine for aspartic acid adds a negatively charged residue to αA-crystallin, and results in increased levels of insoluble crystallins in the lens. Cleaved or phosphorylated forms of αA-Y118D proteins, several β-crystallin isoforms, and a substantial number of different γ-crystallin isoforms are present in mutant lenses  (1). Similar mutations in the same region of αA-crystallin in humans produce a similar dominant cataract phenotype as the Y118D mutation. Studies of some of these altered proteins suggest alterations of structure, significant decreases of chaperone-like activity in vitro, and increased levels of membrane binding may be the mechanisms causing cataracts in vivo (31)

 

Many different posttranslational modifications of α-crystallins have been identified in normal lenses, aging lenses and cataractous lenses (2;6-8;16;23;24). These modifications can affect chaperone-like activity, size of protein aggregates, rate of subunit exchange, solubility, subcellular distribution, or other properties in vitro and may lead to cataracts in vivo. The exact consequence of the αA-Y118D mutation on protein structure and function is unknown, but likely leads to a decrease in the chaperone-like activity of αA-crystallin.

Primers Primers cannot be located by automatic search.
Genotyping
L1N genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. This protocol has not been tested.
 
Primers for PCR amplification
L1N(F): 5’- TGCAACTTTGTAGCTCTCATGG-3’
L1N(R): 5’- AGGCAGACTCTTTGCTGTGGTC-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 55°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 35X
6) 72°C             5:00
7) 4°C               ∞
 
Primers for sequencing
L1N_seq(F): 5’- GCAACTTTGTAGCTCTCATGG-3’
L1N_seq(R): 5’- GCAGACTCTTTGCTGTGGTC-3’
 
The following sequence of 450 nucleotides (from Genbank genomic region NC_000083 for linear DNA sequence of Cryaa) is amplified:
 
2875                                                            tgcaac
2881 tttgtagctc tcatggagaa ggtagctaag aatggtacac tggtcctaga gcccagcccg
2941 gtgagatcat ctgcaccctg gccaccttgt atggtccagt gtgggatggt ggccactgct
3001 gcccatcacc tctgaccatg cctctccctg gtggccctca ggatgaccat ggctacattt
3061 cccgtgaatt tcaccgtcgc taccgtctgc cttccaatgt ggaccagtcc gccctctcct
3121 gctccctgtc tgcggatggc atgctgacct tctctggccc caaggtccag tccggtttgg
3181 atgctggcca cagcgagagg gccattcctg tgtcacggga ggagaaaccc agctctgcac
3241 cctcgtcctg agctggcctc accttggttg tcccctgagg cccctggtcc atccagccca
3301 gggaccacag caaagagtct gcct
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
Science Writers Nora G. Smart, Anne Murray
Illustrators Victoria Webster
AuthorsChun-hong Xia, Xiaohua Gong, Bruce Beutler
List |< first << previous [record 17 of 17]
Edit History
2011-01-13 2:25 PM (current)
2011-01-10 1:40 PM
2011-01-07 9:17 AM
2010-02-03 9:46 AM