Phenotypic Mutation 'Vermeil' (pdf version)
AlleleVermeil
Mutation Type missense
Chromosome6
Coordinate124,732,950 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Ptpn6
Gene Name protein tyrosine phosphatase, non-receptor type 6
Synonym(s) Hcph, hcp, SHP-1, Ptp1C
Chromosomal Location 124,720,707-124,738,714 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013545 (variant 1), NM_001077705 (variant 2); MGI:96055

Mapped Yes 
Amino Acid Change Valine changed to Methionine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000004377] [ENSMUSP00000108103] [ENSMUSP00000129124] [ENSMUSP00000133747] [ENSMUSP00000133991]
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: V2M

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect probably benign

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
(Using ENSMUST00000112484)
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000133747
Gene: ENSMUSG00000004266
AA Change: V2M

DomainStartEndE-ValueType
SH2 2 64 2.35e-6 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
(Using ENSMUST00000173647)
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect probably benign
Meta Mutation Damage Score 0.0468 question?
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased 16860389
FACS B1 cells - increased
FACS CD44+ CD8 MFI - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS IgD MFI - decreased
FACS IgD+ B cell percentage - decreased 16860389
FACS IgM MFI - decreased
FACS IgM+ B cells - decreased 16860389
FACS naive CD8 T cells in CD8 T cells - decreased
Candidate Explorer Status CE: potential candidate; human score: 0; ML prob: 0.224
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU)(4) Gene trapped(3) Spontaneous (4) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ptpn6 APN 6 124732356 unclassified probably null
IGL01490:Ptpn6 APN 6 124728344 missense probably damaging 1.00
IGL01865:Ptpn6 APN 6 124732465 missense probably damaging 1.00
IGL02017:Ptpn6 APN 6 124732486 missense probably damaging 0.98
IGL02272:Ptpn6 APN 6 124721208 missense probably damaging 0.99
IGL02276:Ptpn6 APN 6 124728865 missense probably null 1.00
IGL02556:Ptpn6 APN 6 124728660 missense probably benign 0.00
candle UTSW 6 124728419 missense probably damaging 1.00
caterpillar UTSW 6 124724984 missense probably benign
farfalla_notturna UTSW 6 124732435 missense probably damaging 1.00
naphthalene UTSW 6 124721789 missense probably benign 0.42
spin UTSW 6 124728559 missense probably damaging 1.00
spin2 UTSW 6 124732369 missense probably damaging 1.00
R0183:Ptpn6 UTSW 6 124728951 missense probably damaging 1.00
R0254:Ptpn6 UTSW 6 124728150 missense probably damaging 1.00
R0636:Ptpn6 UTSW 6 124725279 missense probably benign
R0835:Ptpn6 UTSW 6 124727536 critical splice acceptor site probably null
R1383:Ptpn6 UTSW 6 124721893 missense probably damaging 1.00
R1638:Ptpn6 UTSW 6 124721185 missense probably benign
R1900:Ptpn6 UTSW 6 124728933 missense probably benign 0.15
R2047:Ptpn6 UTSW 6 124721789 missense probably benign 0.42
R2143:Ptpn6 UTSW 6 124724984 missense probably benign 0.01
R3907:Ptpn6 UTSW 6 124725276 missense possibly damaging 0.86
R4082:Ptpn6 UTSW 6 124728419 missense probably damaging 1.00
R4382:Ptpn6 UTSW 6 124727398 missense possibly damaging 0.86
R5319:Ptpn6 UTSW 6 124732950 missense probably benign 0.10
R5807:Ptpn6 UTSW 6 124724984 missense probably benign
R5878:Ptpn6 UTSW 6 124728785 missense probably damaging 1.00
R6056:Ptpn6 UTSW 6 124732435 missense probably damaging 1.00
R6374:Ptpn6 UTSW 6 124732569 unclassified probably null
R7238:Ptpn6 UTSW 6 124721858 missense possibly damaging 0.89
R7381:Ptpn6 UTSW 6 124728172 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:37 PM by Diantha La Vine
Record Created 2018-04-05 12:21 PM by Bruce Beutler
Record Posted 2018-04-09
Phenotypic Description

Figure 1. Vermeil mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Vermeil mice exhibit decreased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Vermeil mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Vermeil mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Vermeil mice exhibit decreased frequencies of peripheral naïve CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Vermeil mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Vermeil mice exhibit increased CD44 expression on peripheral blood CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Vermeil mice exhibit reduced IgD expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Vermeil mice exhibit reduced IgM expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Vermeil phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5319, some of which showed reduced frequencies of B cells (Figure 1), IgD+ B cells (Figure 2), IgM+ B cells (Figure 3), B1 cells (Figure 4), and naïve CD8 T cells in CD8 T cells (Figure 5) with concomitant increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 6), all in the peripheral blood. Some mice showed increased CD44 expression on peripheral blood CD8 T cells (Figure 7) as well as reduced IgD expression (Figure 8) and IgM expression (Figure 9) on peripheral blood B cells.

 

Retina phenotypes observed in pedigree R5319 are attributed to the co-localizing mutation in Cacna2d2 (see the record for Steveo).

Nature of Mutation

Figure 10. Linkage mapping of increased central memory CD8 T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 66 mutations (X-axis) identified in the G1 male of pedigree R5319. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 6: Cacna2d4 and Ptpn6. The mutation in Ptpn6 was presumed causative as other Ptpn6 alleles exhibit similar phenotypes to that in Vermeil (see MGI). The mutation in Ptpn6 is a G to A transition at base pair 124,732,950 (v38) on chromosome 6, or base pair 5,760 in the GenBank genomic region NC_000072. The strongest association was found with an additive model of inheritance to the normalized frequency of peripheral blood central memory CD8 T cells, wherein four variant homozygotes departed phenotypically from six homozygous reference mice and 10 heterozygous mice with a P value of 4.62 x 10-7 (Figure 10).  

 

The mutation corresponds to residue 205 in the mRNA sequence NM_013545 within exon 1 of 16 total exons.

 

202 ATGGTGAGGTGGTTTCACCGG

2   -M--V--R--W--F--H--R-

 

The mutated nucleotide is indicated in red.  The mutation results in a valine to methionine substitution at position 2 (V2M) in variant 1 of the SHP1 protein.

Protein Prediction
Figure 11. Domain structure of SHP1. The position of the Vermeil mutation is indicated. Other mutations found in SHP1 are noted in red. Click on the mutations for more specific information.

Ptpn6 encodes SHP1, a Src-homology 2 (SH2) domain-containing cytoplasmic protein tyrosine phosphatase. SHP1 has 4 isoforms. Three isoforms of SHP1 contain variations in their N-termini; the fourth isoform is a longer form with an extended C-terminus. SHP1 contains two tandem N-terminal SH2 domains (residues 1-108 and 116-208), a central catalytic domain (residues 270-532), and a C-terminal tail [Figure 11; (1), discussed in (2)]. The C-terminal tail contains multiple sites for tyrosine and serine phosphorylation. The Vermeil mutation results in a valine to methionine substitution at position 2 (V2M) within the first SH2 domain. The Vermeil mutation is predicted to affect all of the SHP1 isoforms.

  

For more information on Ptpn6, please see the record for spin.

Putative Mechanism

The phenotype of the Vermeil mice suggests decreased SHP1 function. The phenotype of Vermeil animals is less severe than the spin (3) and spin2 phenotypes as foot lesions were not observed in the Vermeil mice. The foot lesions observed in the spin mice were associated with the development of splenomegaly and an increased number of erythroid and myeloid cells in the spleen, as well as a reduction in mature B cell numbers in the peripheral blood, spleen and bone marrow. Spontaneously occurring motheaten (me) and viable motheaten (me-v) mutants are immunodeficient and exhibit multiple defects stemming from increased inflammation, including alopecia, glomerulonephritis, dermatitis, inflammation of the paws, and interstitial pneumonitis which ultimately causes death by 3 and 9 weeks of age in Ptpn6me/me and Ptpn6me-v/me-v mice, respectively. The phenotype of the Vermeil animals is significantly less severe than the Ptpn6me-v allele, which encodes a SHP1 protein with approximately 20% catalytic activity (4).  It is likely that the SHP1 protein encoded by the Vermeil allele retains catalytic activity that is greater than 20% of normal, and greater than the SHP1 protein encoded by the spin and spin2 alleles.

Primers PCR Primer
Vermeil(F):5'- AAGTCACCCTGGTTCTTGCG -3'
Vermeil(R):5'- GTTCTAGTGAGTTCCCCTAAGG -3'

Sequencing Primer
Vermeil_seq(F):5'- GTTCTTGCGGCTGGGCC -3'
Vermeil_seq(R):5'- TGTCTCCGCCCTGCTGG -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 428 nucleotides is amplified (chromosome 6, - strand):


1   gttctagtga gttcccctaa ggggtcggcc gcgccccttc ctgtctccgc cctgctggct
61  gccccaggcc agtagagtgg tagcccgggg agcaggactg caggttggct ttggaggcct
121 gggctctgag agccttgcct gaggctcatc tctagagttt gtacgtgcct gcccagacaa
181 actgttccct ccacattttc tgcagccaat tcagtgagaa ccccaggatg gtgaggtaag
241 ggcctgggac ccatggagga taggaaacaa gggtggctgg agccctgggg atattccctc
301 actgccctgt gcacttttag gtggtttcac cgggacctca gcgggcctga tgcagagacc
361 ctgctgaagg gccggggagt ccctgggagc ttcctggctc ggcccagccg caagaaccag
421 ggtgactt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler